Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ANDA01000031 Streptococcus agalactiae CCUG 28551 ctg120004390327, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000090 Streptococcus agalactiae CCUG 28551 ctg120004390386, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000096 Streptococcus agalactiae CCUG 28551 ctg120004390392, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANDA01000005 Streptococcus agalactiae CCUG 28551 ctg120004390300, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000061 Streptococcus agalactiae CCUG 28551 ctg120004390357, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000098 Streptococcus agalactiae CCUG 28551 ctg120004390394, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000109 Streptococcus agalactiae CCUG 28551 ctg120004390405, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000072 Streptococcus agalactiae CCUG 28551 ctg120004390368, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANDA01000050 Streptococcus agalactiae CCUG 28551 ctg120004390346, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000030 Streptococcus agalactiae CCUG 28551 ctg120004390326, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ANDA01000068 Streptococcus agalactiae CCUG 28551 ctg120004390364, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000113 Streptococcus agalactiae CCUG 28551 ctg120004390416, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000081 Streptococcus agalactiae CCUG 28551 ctg120004390377, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000082 Streptococcus agalactiae CCUG 28551 ctg120004390378, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000055 Streptococcus agalactiae CCUG 28551 ctg120004390351, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000091 Streptococcus agalactiae CCUG 28551 ctg120004390387, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000033 Streptococcus agalactiae CCUG 28551 ctg120004390329, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000001 Streptococcus agalactiae CCUG 28551 ctg120004390083, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000048 Streptococcus agalactiae CCUG 28551 ctg120004390344, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000003 Streptococcus agalactiae CCUG 28551 ctg120004390298, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000094 Streptococcus agalactiae CCUG 28551 ctg120004390390, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000097 Streptococcus agalactiae CCUG 28551 ctg120004390393, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANDA01000106 Streptococcus agalactiae CCUG 28551 ctg120004390402, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000084 Streptococcus agalactiae CCUG 28551 ctg120004390380, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000029 Streptococcus agalactiae CCUG 28551 ctg120004390325, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000040 Streptococcus agalactiae CCUG 28551 ctg120004390336, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000092 Streptococcus agalactiae CCUG 28551 ctg120004390388, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000013 Streptococcus agalactiae CCUG 28551 ctg120004390309, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000111 Streptococcus agalactiae CCUG 28551 ctg120004390407, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000057 Streptococcus agalactiae CCUG 28551 ctg120004390353, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000073 Streptococcus agalactiae CCUG 28551 ctg120004390369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000083 Streptococcus agalactiae CCUG 28551 ctg120004390379, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANDA01000067 Streptococcus agalactiae CCUG 28551 ctg120004390363, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000064 Streptococcus agalactiae CCUG 28551 ctg120004390360, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000034 Streptococcus agalactiae CCUG 28551 ctg120004390330, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000002 Streptococcus agalactiae CCUG 28551 ctg120004390290, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000078 Streptococcus agalactiae CCUG 28551 ctg120004390374, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000104 Streptococcus agalactiae CCUG 28551 ctg120004390400, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANDA01000028 Streptococcus agalactiae CCUG 28551 ctg120004390324, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ANDA01000042 Streptococcus agalactiae CCUG 28551 ctg120004390338, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000085 Streptococcus agalactiae CCUG 28551 ctg120004390381, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000108 Streptococcus agalactiae CCUG 28551 ctg120004390404, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000008 Streptococcus agalactiae CCUG 28551 ctg120004390304, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000026 Streptococcus agalactiae CCUG 28551 ctg120004390322, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000018 Streptococcus agalactiae CCUG 28551 ctg120004390314, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANDA01000035 Streptococcus agalactiae CCUG 28551 ctg120004390331, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000069 Streptococcus agalactiae CCUG 28551 ctg120004390365, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000079 Streptococcus agalactiae CCUG 28551 ctg120004390375, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000071 Streptococcus agalactiae CCUG 28551 ctg120004390367, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000021 Streptococcus agalactiae CCUG 28551 ctg120004390317, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000025 Streptococcus agalactiae CCUG 28551 ctg120004390321, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000077 Streptococcus agalactiae CCUG 28551 ctg120004390373, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000054 Streptococcus agalactiae CCUG 28551 ctg120004390350, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000039 Streptococcus agalactiae CCUG 28551 ctg120004390335, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000027 Streptococcus agalactiae CCUG 28551 ctg120004390323, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000012 Streptococcus agalactiae CCUG 28551 ctg120004390308, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000066 Streptococcus agalactiae CCUG 28551 ctg120004390362, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000052 Streptococcus agalactiae CCUG 28551 ctg120004390348, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000063 Streptococcus agalactiae CCUG 28551 ctg120004390359, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_ANDA01000110 Streptococcus agalactiae CCUG 28551 ctg120004390406, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ANDA01000007 Streptococcus agalactiae CCUG 28551 ctg120004390303, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000044 Streptococcus agalactiae CCUG 28551 ctg120004390340, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000088 Streptococcus agalactiae CCUG 28551 ctg120004390384, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000022 Streptococcus agalactiae CCUG 28551 ctg120004390318, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000037 Streptococcus agalactiae CCUG 28551 ctg120004390333, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000060 Streptococcus agalactiae CCUG 28551 ctg120004390356, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000038 Streptococcus agalactiae CCUG 28551 ctg120004390334, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000105 Streptococcus agalactiae CCUG 28551 ctg120004390401, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 0 17 2 0
NZ_ANDA01000065 Streptococcus agalactiae CCUG 28551 ctg120004390361, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANDA01000019 Streptococcus agalactiae CCUG 28551 ctg120004390315, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000051 Streptococcus agalactiae CCUG 28551 ctg120004390347, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000086 Streptococcus agalactiae CCUG 28551 ctg120004390382, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000047 Streptococcus agalactiae CCUG 28551 ctg120004390343, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000009 Streptococcus agalactiae CCUG 28551 ctg120004390305, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000046 Streptococcus agalactiae CCUG 28551 ctg120004390342, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000059 Streptococcus agalactiae CCUG 28551 ctg120004390355, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000016 Streptococcus agalactiae CCUG 28551 ctg120004390312, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_ANDA01000036 Streptococcus agalactiae CCUG 28551 ctg120004390332, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000032 Streptococcus agalactiae CCUG 28551 ctg120004390328, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ANDA01000112 Streptococcus agalactiae CCUG 28551 ctg120004390415, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000041 Streptococcus agalactiae CCUG 28551 ctg120004390337, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000049 Streptococcus agalactiae CCUG 28551 ctg120004390345, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000102 Streptococcus agalactiae CCUG 28551 ctg120004390398, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ANDA01000099 Streptococcus agalactiae CCUG 28551 ctg120004390395, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000004 Streptococcus agalactiae CCUG 28551 ctg120004390299, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000017 Streptococcus agalactiae CCUG 28551 ctg120004390313, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000070 Streptococcus agalactiae CCUG 28551 ctg120004390366, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000062 Streptococcus agalactiae CCUG 28551 ctg120004390358, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000089 Streptococcus agalactiae CCUG 28551 ctg120004390385, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000006 Streptococcus agalactiae CCUG 28551 ctg120004390301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000020 Streptococcus agalactiae CCUG 28551 ctg120004390316, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000014 Streptococcus agalactiae CCUG 28551 ctg120004390310, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000080 Streptococcus agalactiae CCUG 28551 ctg120004390376, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000010 Streptococcus agalactiae CCUG 28551 ctg120004390306, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000100 Streptococcus agalactiae CCUG 28551 ctg120004390396, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANDA01000074 Streptococcus agalactiae CCUG 28551 ctg120004390370, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ANDA01000011 Streptococcus agalactiae CCUG 28551 ctg120004390307, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000015 Streptococcus agalactiae CCUG 28551 ctg120004390311, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANDA01000103 Streptococcus agalactiae CCUG 28551 ctg120004390399, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000075 Streptococcus agalactiae CCUG 28551 ctg120004390371, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000076 Streptococcus agalactiae CCUG 28551 ctg120004390372, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000045 Streptococcus agalactiae CCUG 28551 ctg120004390341, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000087 Streptococcus agalactiae CCUG 28551 ctg120004390383, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000093 Streptococcus agalactiae CCUG 28551 ctg120004390389, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000056 Streptococcus agalactiae CCUG 28551 ctg120004390352, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000023 Streptococcus agalactiae CCUG 28551 ctg120004390319, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000095 Streptococcus agalactiae CCUG 28551 ctg120004390391, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000024 Streptococcus agalactiae CCUG 28551 ctg120004390320, whole genome shotgun sequence 1 crisprs NA 0 1 0 0
NZ_ANDA01000058 Streptococcus agalactiae CCUG 28551 ctg120004390354, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000107 Streptococcus agalactiae CCUG 28551 ctg120004390403, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000101 Streptococcus agalactiae CCUG 28551 ctg120004390397, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000053 Streptococcus agalactiae CCUG 28551 ctg120004390349, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDA01000043 Streptococcus agalactiae CCUG 28551 ctg120004390339, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ANDA01000096
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 422 : 10933 11 Streptococcus_phage(100.0%) holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ANDA01000100
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1258 : 6302 8 Streptococcus_phage(85.71%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ANDA01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 68176 : 77169 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ANDA01000065
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15509 : 52383 60 Streptococcus_phage(61.7%) portal,terminase,integrase,tail attL 8583:8597|attR 30266:30280
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ANDA01000024
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ANDA01000024_1 33347-33419 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ANDA01000024_1 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder 33370-33396 27 NZ_CP024108 Bacillus cytotoxicus strain CH_15 plasmid pCh15_83, complete sequence 19107-19133 6 0.778
NZ_ANDA01000024_1 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder 33370-33396 27 NZ_CP024100 Bacillus cytotoxicus strain CH_38 plasmid pCh38_83, complete sequence 81938-81964 6 0.778
NZ_ANDA01000024_1 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder 33370-33396 27 NZ_CP024122 Bacillus cytotoxicus strain CH_1 plasmid pCh1_67, complete sequence 36523-36549 6 0.778
NZ_ANDA01000024_1 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder 33370-33396 27 NZ_CP024115 Bacillus cytotoxicus strain CH_3 plasmid pCh3_83, complete sequence 6072-6098 6 0.778
NZ_ANDA01000024_1 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder 33370-33396 27 NZ_CP024110 Bacillus cytotoxicus strain CH_13 plasmid pCh13_79, complete sequence 12311-12337 6 0.778
NZ_ANDA01000024_1 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder 33370-33396 27 NZ_CP024106 Bacillus cytotoxicus strain CH_23 plasmid pCh23_67, complete sequence 66618-66644 6 0.778
NZ_ANDA01000024_1 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder 33370-33396 27 NZ_CP024118 Bacillus cytotoxicus strain CH_2 plasmid pCh2_83, complete sequence 12322-12348 6 0.778
NZ_ANDA01000024_1 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder 33370-33396 27 NZ_CP024097 Bacillus cytotoxicus strain CH_39 plasmid pCh39_83, complete sequence 23267-23293 6 0.778
NZ_ANDA01000024_1 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder 33370-33396 27 NZ_CP024103 Bacillus cytotoxicus strain CH_25 plasmid pCh25_67, complete sequence 36800-36826 6 0.778

1. spacer 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder matches to NZ_CP024108 (Bacillus cytotoxicus strain CH_15 plasmid pCh15_83, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

2. spacer 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder matches to NZ_CP024100 (Bacillus cytotoxicus strain CH_38 plasmid pCh38_83, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

3. spacer 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder matches to NZ_CP024122 (Bacillus cytotoxicus strain CH_1 plasmid pCh1_67, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

4. spacer 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder matches to NZ_CP024115 (Bacillus cytotoxicus strain CH_3 plasmid pCh3_83, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

5. spacer 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder matches to NZ_CP024110 (Bacillus cytotoxicus strain CH_13 plasmid pCh13_79, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

6. spacer 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder matches to NZ_CP024106 (Bacillus cytotoxicus strain CH_23 plasmid pCh23_67, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

7. spacer 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder matches to NZ_CP024118 (Bacillus cytotoxicus strain CH_2 plasmid pCh2_83, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

8. spacer 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder matches to NZ_CP024097 (Bacillus cytotoxicus strain CH_39 plasmid pCh39_83, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

9. spacer 1.1|33370|27|NZ_ANDA01000024|CRISPRCasFinder matches to NZ_CP024103 (Bacillus cytotoxicus strain CH_25 plasmid pCh25_67, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ANDA01000018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3994 : 9552 10 Streptococcus_phage(50.0%) transposase,integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ANDA01000083
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 26449 : 34834 7 Streptococcus_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ANDA01000097
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 18759 : 23745 7 Streptococcus_phage(71.43%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ANDA01000072
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7415 : 14589 8 Streptococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_ANDA01000032
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ANDA01000032.1|WP_000384271.1|3624_3951_+|hypothetical-protein 3624_3951_+ 108 aa aa AcrIIA21 NA NA No NA
11. NZ_ANDA01000105
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ANDA01000105_1 168297-169982 TypeII II-A
25 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ANDA01000105_1 1.8|168795|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168795-168824 30 MK448729 Streptococcus phage Javan31, complete genome 10214-10243 0 1.0
NZ_ANDA01000105_1 1.8|168795|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168795-168824 30 MK448691 Streptococcus phage Javan17, complete genome 10214-10243 0 1.0
NZ_ANDA01000105_1 1.8|168795|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168795-168824 30 MK448948 Streptococcus phage Javan46, complete genome 10214-10243 0 1.0
NZ_ANDA01000105_1 1.8|168795|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168795-168824 30 MK448768 Streptococcus phage Javan47, complete genome 11359-11388 0 1.0
NZ_ANDA01000105_1 1.10|168927|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168927-168956 30 MK448837 Streptococcus phage Javan10, complete genome 31707-31736 0 1.0
NZ_ANDA01000105_1 1.11|168993|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168993-169022 30 JX409894 Streptococcus phage LYGO9, complete genome 13282-13311 0 1.0
NZ_ANDA01000105_1 1.11|168993|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168993-169022 30 JX409895 Streptococcus phage JX01, complete genome 25129-25158 0 1.0
NZ_ANDA01000105_1 1.11|168993|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168993-169022 30 MK448742 Streptococcus phage Javan37, complete genome 30526-30555 0 1.0
NZ_ANDA01000105_1 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169719-169748 30 MK448971 Streptococcus phage Javan52, complete genome 1773-1802 0 1.0
NZ_ANDA01000105_1 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169719-169748 30 MK449010 Streptococcus phage Javan90, complete genome 2127-2156 0 1.0
NZ_ANDA01000105_1 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169719-169748 30 MK448833 Streptococcus phage Javan87, complete genome 2127-2156 0 1.0
NZ_ANDA01000105_1 1.23|169785|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169785-169814 30 MK448971 Streptococcus phage Javan52, complete genome 1998-2027 0 1.0
NZ_ANDA01000105_1 1.23|169785|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169785-169814 30 MK449010 Streptococcus phage Javan90, complete genome 2352-2381 0 1.0
NZ_ANDA01000105_1 1.23|169785|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169785-169814 30 MK448833 Streptococcus phage Javan87, complete genome 2352-2381 0 1.0
NZ_ANDA01000105_1 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169917-169946 30 MK448946 Streptococcus phage Javan456, complete genome 2732-2761 0 1.0
NZ_ANDA01000105_1 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169917-169946 30 MK448975 Streptococcus phage Javan526, complete genome 2524-2553 0 1.0
NZ_ANDA01000105_1 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169917-169946 30 MK448782 Streptococcus phage Javan501, complete genome 2863-2892 0 1.0
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MK448771 Streptococcus phage Javan481, complete genome 9490-9519 1 0.967
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MK448973 Streptococcus phage Javan522, complete genome 12366-12395 1 0.967
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MK448772 Streptococcus phage Javan483, complete genome 13998-14027 1 0.967
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MK448778 Streptococcus phage Javan493, complete genome 12381-12410 1 0.967
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MK448949 Streptococcus phage Javan460, complete genome 14251-14280 1 0.967
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MK448958 Streptococcus phage Javan486, complete genome 12126-12155 1 0.967
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MK448782 Streptococcus phage Javan501, complete genome 15012-15041 1 0.967
NZ_ANDA01000105_1 1.11|168993|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168993-169022 30 MK448956 Streptococcus phage Javan48, complete genome 33832-33861 1 0.967
NZ_ANDA01000105_1 1.12|169059|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169059-169088 30 MK448826 Streptococcus phage Javan645, complete genome 3085-3114 1 0.967
NZ_ANDA01000105_1 1.12|169059|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169059-169088 30 MK449001 Streptococcus phage Javan640, complete genome 3085-3114 1 0.967
NZ_ANDA01000105_1 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169125-169154 30 MK448708 Streptococcus phage Javan23, complete genome 17274-17303 1 0.967
NZ_ANDA01000105_1 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169125-169154 30 MK448897 Streptococcus phage Javan28, complete genome 17274-17303 1 0.967
NZ_ANDA01000105_1 1.16|169323|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169323-169352 30 MK448826 Streptococcus phage Javan645, complete genome 3085-3114 1 0.967
NZ_ANDA01000105_1 1.16|169323|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169323-169352 30 MK449001 Streptococcus phage Javan640, complete genome 3085-3114 1 0.967
NZ_ANDA01000105_1 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169851-169880 30 MK448946 Streptococcus phage Javan456, complete genome 2554-2583 1 0.967
NZ_ANDA01000105_1 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169851-169880 30 MK448675 Streptococcus phage Javan129, complete genome 2709-2738 1 0.967
NZ_ANDA01000105_1 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169851-169880 30 MK448775 Streptococcus phage Javan489, complete genome 2763-2792 1 0.967
NZ_ANDA01000105_1 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169851-169880 30 MK448944 Streptococcus phage Javan452, complete genome 2545-2574 1 0.967
NZ_ANDA01000105_1 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169851-169880 30 MK448975 Streptococcus phage Javan526, complete genome 2346-2375 1 0.967
NZ_ANDA01000105_1 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169851-169880 30 MK448683 Streptococcus phage Javan149, complete genome 2483-2512 1 0.967
NZ_ANDA01000105_1 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169851-169880 30 MK448782 Streptococcus phage Javan501, complete genome 2685-2714 1 0.967
NZ_ANDA01000105_1 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169917-169946 30 MK448675 Streptococcus phage Javan129, complete genome 2887-2916 1 0.967
NZ_ANDA01000105_1 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169917-169946 30 MK448858 Streptococcus phage Javan166, complete genome 2843-2872 1 0.967
NZ_ANDA01000105_1 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169917-169946 30 MK448775 Streptococcus phage Javan489, complete genome 2941-2970 1 0.967
NZ_ANDA01000105_1 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169917-169946 30 MK448944 Streptococcus phage Javan452, complete genome 2723-2752 1 0.967
NZ_ANDA01000105_1 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169917-169946 30 MK448683 Streptococcus phage Javan149, complete genome 2661-2690 1 0.967
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 NC_004585 Streptococcus prophage 315.2, complete genome 14128-14157 2 0.933
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MK448966 Streptococcus phage Javan508, complete genome 13983-14012 2 0.933
NZ_ANDA01000105_1 1.10|168927|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168927-168956 30 JX409894 Streptococcus phage LYGO9, complete genome 10619-10648 2 0.933
NZ_ANDA01000105_1 1.10|168927|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168927-168956 30 JX409895 Streptococcus phage JX01, complete genome 22466-22495 2 0.933
NZ_ANDA01000105_1 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169719-169748 30 MK448798 Streptococcus phage Javan533, complete genome 2132-2161 2 0.933
NZ_ANDA01000105_1 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169719-169748 30 MK448783 Streptococcus phage Javan503, complete genome 2052-2081 2 0.933
NZ_ANDA01000105_1 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169719-169748 30 MK448967 Streptococcus phage Javan510, complete genome 2133-2162 2 0.933
NZ_ANDA01000105_1 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169719-169748 30 KY349816 Streptococcus phage Str01, complete genome 24296-24325 2 0.933
NZ_ANDA01000105_1 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169719-169748 30 NC_004588 Streptococcus prophage 315.5, complete genome 2282-2311 2 0.933
NZ_ANDA01000105_1 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169851-169880 30 MK448858 Streptococcus phage Javan166, complete genome 2665-2694 2 0.933
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MK448761 Streptococcus phage Javan445, complete genome 14183-14212 4 0.867
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MK448760 Streptococcus phage Javan443, complete genome 14183-14212 4 0.867
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 KU878088 Bacillus phage AR9, complete genome 165573-165602 5 0.833
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MF360957 Bacillus virus PBS1, complete genome 75400-75429 5 0.833
NZ_ANDA01000105_1 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169191-169220 30 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 474277-474306 5 0.833
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 NZ_CP018748 Borreliella garinii strain CIP 103362 isolate 20047 plasmid unnamed3 19373-19402 5 0.833
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 NZ_CP013708 Clostridium botulinum strain F634 plasmid pRSJ2_1, complete sequence 5530-5559 5 0.833
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 NZ_CP028868 Borreliella garinii strain 20047 plasmid cp32-6, complete sequence 19424-19453 5 0.833
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 NC_017239 Borreliella afzelii PKo plasmid lp28-2, complete sequence 3401-3430 5 0.833
NZ_ANDA01000105_1 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169917-169946 30 MK448933 Streptococcus phage Javan420, complete genome 2414-2443 5 0.833
NZ_ANDA01000105_1 1.4|168531|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168531-168560 30 AP014352 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C33, *** SEQUENCING IN PROGRESS *** 25577-25606 6 0.8
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MH319757 Marine virus AG-345-O18 Ga0172273_11 genomic sequence 30695-30724 6 0.8
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MN693943 Marine virus AFVG_250M49, complete genome 30477-30506 6 0.8
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 201411-201440 6 0.8
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 MT080590 UNVERIFIED: Staphylococcus phage vB_SauM_EW27, complete genome 26814-26843 6 0.8
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 KY779848 Staphylococcus phage qdsa001, complete genome 88874-88903 6 0.8
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 KX532239 Staphylococcus phage StAP1, complete genome 68894-68923 6 0.8
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 JX194239 Staphylococcus phage SA11, complete genome 67359-67388 6 0.8
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 MT080584 UNVERIFIED: Staphylococcus phage vB_SauM_EW15, complete genome 109058-109087 6 0.8
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 MT080587 UNVERIFIED: Staphylococcus phage vB_SauM_EW20, complete genome 90449-90478 6 0.8
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 NC_007581 Clostridium phage c-st, complete genome 13912-13941 6 0.8
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 KP881332 Staphylococcus phage Stau2, complete genome 61141-61170 6 0.8
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 MT080588 UNVERIFIED: Staphylococcus phage vB_SauM_EW22, complete genome 66672-66701 6 0.8
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 AP008983 Clostridium phage c-st genomic DNA, complete genome 13912-13941 6 0.8
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 MT451873 Vibrio phage vB_VhaS-VHB1, complete genome 22848-22877 6 0.8
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 NC_016567 Vibrio phage SIO-2, complete genome 57446-57475 6 0.8
NZ_ANDA01000105_1 1.12|169059|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169059-169088 30 NZ_CP017574 Bacillus thuringiensis strain SCG04-02 plasmid PSCG364, complete sequence 81747-81776 7 0.767
NZ_ANDA01000105_1 1.12|169059|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169059-169088 30 NC_017401 Borreliella burgdorferi N40 plasmid N40_cp26, complete sequence 17658-17687 7 0.767
NZ_ANDA01000105_1 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169191-169220 30 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 473664-473693 7 0.767
NZ_ANDA01000105_1 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169191-169220 30 NZ_KJ776580 Clostridium botulinum strain CDC5900 plasmid pCDC5900, complete sequence 5593-5622 7 0.767
NZ_ANDA01000105_1 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169191-169220 30 NZ_CP007625 Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence 284952-284981 7 0.767
NZ_ANDA01000105_1 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169191-169220 30 NZ_CP009650 Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence 227979-228008 7 0.767
NZ_ANDA01000105_1 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169191-169220 30 MG592576 Vibrio phage 1.206.O._10N.222.51.B10, partial genome 27486-27515 7 0.767
NZ_ANDA01000105_1 1.15|169257|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169257-169286 30 NZ_CP013072 Sphingobium indicum B90A plasmid pSRL2, complete sequence 93023-93052 7 0.767
NZ_ANDA01000105_1 1.15|169257|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169257-169286 30 NZ_CP005190 Sphingobium sp. MI1205 plasmid pMI1, complete sequence 70816-70845 7 0.767
NZ_ANDA01000105_1 1.16|169323|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169323-169352 30 NZ_CP017574 Bacillus thuringiensis strain SCG04-02 plasmid PSCG364, complete sequence 81747-81776 7 0.767
NZ_ANDA01000105_1 1.16|169323|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169323-169352 30 NC_017401 Borreliella burgdorferi N40 plasmid N40_cp26, complete sequence 17658-17687 7 0.767
NZ_ANDA01000105_1 1.17|169389|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169389-169418 30 MN694670 Marine virus AFVG_250M589, complete genome 29513-29542 7 0.767
NZ_ANDA01000105_1 1.17|169389|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169389-169418 30 HQ634190 Cyanophage Syn2 genomic sequence 105428-105457 7 0.767
NZ_ANDA01000105_1 1.17|169389|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169389-169418 30 GU071097 Synechococcus phage S-SSM5, complete genome 171105-171134 7 0.767
NZ_ANDA01000105_1 1.17|169389|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169389-169418 30 NC_015286 Synechococcus phage Syn19, complete genome 171318-171347 7 0.767
NZ_ANDA01000105_1 1.18|169455|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169455-169484 30 MN694670 Marine virus AFVG_250M589, complete genome 29513-29542 7 0.767
NZ_ANDA01000105_1 1.18|169455|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169455-169484 30 HQ634190 Cyanophage Syn2 genomic sequence 105428-105457 7 0.767
NZ_ANDA01000105_1 1.18|169455|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169455-169484 30 GU071097 Synechococcus phage S-SSM5, complete genome 171105-171134 7 0.767
NZ_ANDA01000105_1 1.18|169455|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169455-169484 30 NC_015286 Synechococcus phage Syn19, complete genome 171318-171347 7 0.767
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 NC_013940 Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence 257659-257688 7 0.767
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 NZ_CP021643 Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence 2890-2919 7 0.767
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 MN692972 Marine virus AFVG_117M68, complete genome 28271-28300 7 0.767
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 MN693697 Marine virus AFVG_250M256, complete genome 26308-26337 7 0.767
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 MN694054 Marine virus AFVG_250M255, complete genome 26027-26056 7 0.767
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 MN694075 Marine virus AFVG_250M257, complete genome 924-953 7 0.767
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 MN693016 Marine virus AFVG_117M69, complete genome 27342-27371 7 0.767
NZ_ANDA01000105_1 1.23|169785|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169785-169814 30 NC_013793 Bacillus pseudofirmus OF4 plasmid pBpOF4-02, complete sequence 93802-93831 7 0.767
NZ_ANDA01000105_1 1.23|169785|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169785-169814 30 MF001357 Clostridium phage CP3, partial genome 28948-28977 7 0.767
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 NZ_CP051648 Staphylococcus caprae strain SY333 plasmid pSY333-45, complete sequence 25483-25512 8 0.733
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 NZ_CP040462 Enterococcus sp. M190262 plasmid pM190262, complete sequence 10382-10411 8 0.733
NZ_ANDA01000105_1 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169125-169154 30 MT774411 CrAssphage cr273_1, complete genome 91946-91975 8 0.733
NZ_ANDA01000105_1 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169125-169154 30 MT774410 CrAssphage cr272_1, complete genome 40926-40955 8 0.733
NZ_ANDA01000105_1 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169125-169154 30 NZ_CP045419 Pseudoalteromonas sp. THAF3 plasmid pTHAF3_a, complete sequence 428420-428449 8 0.733
NZ_ANDA01000105_1 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169125-169154 30 NC_031274 Pseudomonas phage O4, complete genome 9990-10019 8 0.733
NZ_ANDA01000105_1 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169125-169154 30 MF788075 Pseudomonas phage IME180, complete genome 9501-9530 8 0.733
NZ_ANDA01000105_1 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169191-169220 30 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 655420-655449 8 0.733
NZ_ANDA01000105_1 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169191-169220 30 NZ_CP020744 Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence 311665-311694 8 0.733
NZ_ANDA01000105_1 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169191-169220 30 NZ_CP045607 Bacillus cereus strain SB1 plasmid p1, complete sequence 493398-493427 8 0.733
NZ_ANDA01000105_1 1.15|169257|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169257-169286 30 NZ_CP022991 Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence 307848-307877 8 0.733
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 NZ_CP026129 Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence 115699-115728 8 0.733
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 NZ_CP017108 Lactobacillus salivarius strain CICC23174 plasmid pLS_1 sequence 149052-149081 8 0.733
NZ_ANDA01000105_1 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169653-169682 30 NZ_CP017110 Lactobacillus salivarius strain CICC23174 plasmid pLS_3, complete sequence 25744-25773 8 0.733
NZ_ANDA01000105_1 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169719-169748 30 MN693045 Marine virus AFVG_25M135, complete genome 29673-29702 8 0.733
NZ_ANDA01000105_1 1.23|169785|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169785-169814 30 NC_022534 Plautia stali symbiont plasmid pPstS2 DNA, complete genome 16624-16653 8 0.733
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 KY860935 Salmonella phage LPST10, complete genome 24807-24836 9 0.7
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MH424446 Salmonella virus VSt472, complete genome 17036-17065 9 0.7
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MK599416 Salmonella phage Akira, complete genome 25279-25308 9 0.7
NZ_ANDA01000105_1 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 168861-168890 30 MN692673 Salmonella phage VB_StyS_BS5, complete genome 7016-7045 9 0.7
NZ_ANDA01000105_1 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169125-169154 30 KU160641 Arthrobacter phage CaptnMurica, complete genome 18771-18800 9 0.7
NZ_ANDA01000105_1 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169125-169154 30 MH825711 Arthrobacter phage Tenno, complete genome 18765-18794 9 0.7
NZ_ANDA01000105_1 1.17|169389|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169389-169418 30 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 226743-226772 9 0.7
NZ_ANDA01000105_1 1.17|169389|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169389-169418 30 MH617331 Microviridae sp. isolate ctbd619, complete genome 1763-1792 9 0.7
NZ_ANDA01000105_1 1.18|169455|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169455-169484 30 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 226743-226772 9 0.7
NZ_ANDA01000105_1 1.18|169455|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder 169455-169484 30 MH617331 Microviridae sp. isolate ctbd619, complete genome 1763-1792 9 0.7

1. spacer 1.8|168795|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0

tatcgctcaagcattcgtatttgttttgga	CRISPR spacer
tatcgctcaagcattcgtatttgttttgga	Protospacer
******************************

2. spacer 1.8|168795|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0

tatcgctcaagcattcgtatttgttttgga	CRISPR spacer
tatcgctcaagcattcgtatttgttttgga	Protospacer
******************************

3. spacer 1.8|168795|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0

tatcgctcaagcattcgtatttgttttgga	CRISPR spacer
tatcgctcaagcattcgtatttgttttgga	Protospacer
******************************

4. spacer 1.8|168795|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

tatcgctcaagcattcgtatttgttttgga	CRISPR spacer
tatcgctcaagcattcgtatttgttttgga	Protospacer
******************************

5. spacer 1.10|168927|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 0, identity: 1.0

tgccccgttttctagcactcgtgtaaaaat	CRISPR spacer
tgccccgttttctagcactcgtgtaaaaat	Protospacer
******************************

6. spacer 1.11|168993|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 0, identity: 1.0

tatcagtccacttataatcaagatagtttg	CRISPR spacer
tatcagtccacttataatcaagatagtttg	Protospacer
******************************

7. spacer 1.11|168993|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 0, identity: 1.0

tatcagtccacttataatcaagatagtttg	CRISPR spacer
tatcagtccacttataatcaagatagtttg	Protospacer
******************************

8. spacer 1.11|168993|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 0, identity: 1.0

tatcagtccacttataatcaagatagtttg	CRISPR spacer
tatcagtccacttataatcaagatagtttg	Protospacer
******************************

9. spacer 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 0, identity: 1.0

ctaatgctgataagtatgtaacttttgcct	CRISPR spacer
ctaatgctgataagtatgtaacttttgcct	Protospacer
******************************

10. spacer 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK449010 (Streptococcus phage Javan90, complete genome) position: , mismatch: 0, identity: 1.0

ctaatgctgataagtatgtaacttttgcct	CRISPR spacer
ctaatgctgataagtatgtaacttttgcct	Protospacer
******************************

11. spacer 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448833 (Streptococcus phage Javan87, complete genome) position: , mismatch: 0, identity: 1.0

ctaatgctgataagtatgtaacttttgcct	CRISPR spacer
ctaatgctgataagtatgtaacttttgcct	Protospacer
******************************

12. spacer 1.23|169785|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 0, identity: 1.0

tagtaattctcccattattaaattaaattt	CRISPR spacer
tagtaattctcccattattaaattaaattt	Protospacer
******************************

13. spacer 1.23|169785|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK449010 (Streptococcus phage Javan90, complete genome) position: , mismatch: 0, identity: 1.0

tagtaattctcccattattaaattaaattt	CRISPR spacer
tagtaattctcccattattaaattaaattt	Protospacer
******************************

14. spacer 1.23|169785|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448833 (Streptococcus phage Javan87, complete genome) position: , mismatch: 0, identity: 1.0

tagtaattctcccattattaaattaaattt	CRISPR spacer
tagtaattctcccattattaaattaaattt	Protospacer
******************************

15. spacer 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448946 (Streptococcus phage Javan456, complete genome) position: , mismatch: 0, identity: 1.0

gaaatgcgatagtggaagccatataaattc	CRISPR spacer
gaaatgcgatagtggaagccatataaattc	Protospacer
******************************

16. spacer 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448975 (Streptococcus phage Javan526, complete genome) position: , mismatch: 0, identity: 1.0

gaaatgcgatagtggaagccatataaattc	CRISPR spacer
gaaatgcgatagtggaagccatataaattc	Protospacer
******************************

17. spacer 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448782 (Streptococcus phage Javan501, complete genome) position: , mismatch: 0, identity: 1.0

gaaatgcgatagtggaagccatataaattc	CRISPR spacer
gaaatgcgatagtggaagccatataaattc	Protospacer
******************************

18. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448771 (Streptococcus phage Javan481, complete genome) position: , mismatch: 1, identity: 0.967

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
atttccagtaagctcaaatttaacaaatgt	Protospacer
************.*****************

19. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 1, identity: 0.967

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
atttccagtaagctcaaatttaacaaatgt	Protospacer
************.*****************

20. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448772 (Streptococcus phage Javan483, complete genome) position: , mismatch: 1, identity: 0.967

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
atttccagtaagctcaaatttaacaaatgt	Protospacer
************.*****************

21. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 1, identity: 0.967

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
atttccagtaagctcaaatttaacaaatgt	Protospacer
************.*****************

22. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448949 (Streptococcus phage Javan460, complete genome) position: , mismatch: 1, identity: 0.967

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
atttccagtaagctcaaatttaacaaatgt	Protospacer
************.*****************

23. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448958 (Streptococcus phage Javan486, complete genome) position: , mismatch: 1, identity: 0.967

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
atttccagtaagctcaaatttaacaaatgt	Protospacer
************.*****************

24. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448782 (Streptococcus phage Javan501, complete genome) position: , mismatch: 1, identity: 0.967

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
atttccagtaagctcaaatttaacaaatgt	Protospacer
************.*****************

25. spacer 1.11|168993|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 1, identity: 0.967

tatcagtccacttataatcaagatagtttg	CRISPR spacer
tgtcagtccacttataatcaagatagtttg	Protospacer
*.****************************

26. spacer 1.12|169059|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448826 (Streptococcus phage Javan645, complete genome) position: , mismatch: 1, identity: 0.967

agttttaacattaaatcacgtcttaaataa	CRISPR spacer
agttttaatattaaatcacgtcttaaataa	Protospacer
********.*********************

27. spacer 1.12|169059|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK449001 (Streptococcus phage Javan640, complete genome) position: , mismatch: 1, identity: 0.967

agttttaacattaaatcacgtcttaaataa	CRISPR spacer
agttttaatattaaatcacgtcttaaataa	Protospacer
********.*********************

28. spacer 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448708 (Streptococcus phage Javan23, complete genome) position: , mismatch: 1, identity: 0.967

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
taccgcaataagatcaccaatgttatttga	Protospacer
************************.*****

29. spacer 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448897 (Streptococcus phage Javan28, complete genome) position: , mismatch: 1, identity: 0.967

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
taccgcaataagatcaccaatgttatttga	Protospacer
************************.*****

30. spacer 1.16|169323|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448826 (Streptococcus phage Javan645, complete genome) position: , mismatch: 1, identity: 0.967

agttttaacattaaatcacgtcttaaataa	CRISPR spacer
agttttaatattaaatcacgtcttaaataa	Protospacer
********.*********************

31. spacer 1.16|169323|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK449001 (Streptococcus phage Javan640, complete genome) position: , mismatch: 1, identity: 0.967

agttttaacattaaatcacgtcttaaataa	CRISPR spacer
agttttaatattaaatcacgtcttaaataa	Protospacer
********.*********************

32. spacer 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448946 (Streptococcus phage Javan456, complete genome) position: , mismatch: 1, identity: 0.967

aacatcattttcttaggcgctacaccgaag	CRISPR spacer
aacatcattttcttaggctctacaccgaag	Protospacer
****************** ***********

33. spacer 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 1, identity: 0.967

aacatcattttcttaggcgctacaccgaag	CRISPR spacer
aacatcattttcttaggctctacaccgaag	Protospacer
****************** ***********

34. spacer 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448775 (Streptococcus phage Javan489, complete genome) position: , mismatch: 1, identity: 0.967

aacatcattttcttaggcgctacaccgaag	CRISPR spacer
aacatcattttcttaggctctacaccgaag	Protospacer
****************** ***********

35. spacer 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 1, identity: 0.967

aacatcattttcttaggcgctacaccgaag	CRISPR spacer
aacatcattttcttaggctctacaccgaag	Protospacer
****************** ***********

36. spacer 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448975 (Streptococcus phage Javan526, complete genome) position: , mismatch: 1, identity: 0.967

aacatcattttcttaggcgctacaccgaag	CRISPR spacer
aacatcattttcttaggctctacaccgaag	Protospacer
****************** ***********

37. spacer 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448683 (Streptococcus phage Javan149, complete genome) position: , mismatch: 1, identity: 0.967

aacatcattttcttaggcgctacaccgaag	CRISPR spacer
aacatcattttcttaggctctacaccgaag	Protospacer
****************** ***********

38. spacer 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448782 (Streptococcus phage Javan501, complete genome) position: , mismatch: 1, identity: 0.967

aacatcattttcttaggcgctacaccgaag	CRISPR spacer
aacatcattttcttaggctctacaccgaag	Protospacer
****************** ***********

39. spacer 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 1, identity: 0.967

gaaatgcgatagtggaagccatataaattc	CRISPR spacer
gaaatgcaatagtggaagccatataaattc	Protospacer
*******.**********************

40. spacer 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448858 (Streptococcus phage Javan166, complete genome) position: , mismatch: 1, identity: 0.967

gaaatgcgatagtggaagccatataaattc	CRISPR spacer
gaaatgcaatagtggaagccatataaattc	Protospacer
*******.**********************

41. spacer 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448775 (Streptococcus phage Javan489, complete genome) position: , mismatch: 1, identity: 0.967

gaaatgcgatagtggaagccatataaattc	CRISPR spacer
gaaatgcaatagtggaagccatataaattc	Protospacer
*******.**********************

42. spacer 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 1, identity: 0.967

gaaatgcgatagtggaagccatataaattc	CRISPR spacer
gaaatgcaatagtggaagccatataaattc	Protospacer
*******.**********************

43. spacer 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448683 (Streptococcus phage Javan149, complete genome) position: , mismatch: 1, identity: 0.967

gaaatgcgatagtggaagccatataaattc	CRISPR spacer
gaaatgcaatagtggaagccatataaattc	Protospacer
*******.**********************

44. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NC_004585 (Streptococcus prophage 315.2, complete genome) position: , mismatch: 2, identity: 0.933

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
atctccagtaagctcaaatttaacaaatgt	Protospacer
**.*********.*****************

45. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448966 (Streptococcus phage Javan508, complete genome) position: , mismatch: 2, identity: 0.933

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
atctccagtaagctcaaatttaacaaatgt	Protospacer
**.*********.*****************

46. spacer 1.10|168927|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 2, identity: 0.933

tgccccgttttctagcactcgtgtaaaaat	CRISPR spacer
tgccccattttctagcactcgtgtgaaaat	Protospacer
******.*****************.*****

47. spacer 1.10|168927|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 2, identity: 0.933

tgccccgttttctagcactcgtgtaaaaat	CRISPR spacer
tgccccattttctagcactcgtgtgaaaat	Protospacer
******.*****************.*****

48. spacer 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448798 (Streptococcus phage Javan533, complete genome) position: , mismatch: 2, identity: 0.933

ctaatgctgataagtatgtaacttttgcct	CRISPR spacer
ctaatgctgataagtacgtaacttttacct	Protospacer
****************.*********.***

49. spacer 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448783 (Streptococcus phage Javan503, complete genome) position: , mismatch: 2, identity: 0.933

ctaatgctgataagtatgtaacttttgcct	CRISPR spacer
ctaatgctgataagtacgtaacttttacct	Protospacer
****************.*********.***

50. spacer 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448967 (Streptococcus phage Javan510, complete genome) position: , mismatch: 2, identity: 0.933

ctaatgctgataagtatgtaacttttgcct	CRISPR spacer
ctaatgctgataagtacgtaacttttacct	Protospacer
****************.*********.***

51. spacer 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to KY349816 (Streptococcus phage Str01, complete genome) position: , mismatch: 2, identity: 0.933

ctaatgctgataagtatgtaacttttgcct	CRISPR spacer
ctaatgctgataagtacgtaacttttacct	Protospacer
****************.*********.***

52. spacer 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NC_004588 (Streptococcus prophage 315.5, complete genome) position: , mismatch: 2, identity: 0.933

ctaatgctgataagtatgtaacttttgcct	CRISPR spacer
ctaatgctgataagtacgtaacttttacct	Protospacer
****************.*********.***

53. spacer 1.24|169851|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448858 (Streptococcus phage Javan166, complete genome) position: , mismatch: 2, identity: 0.933

aacatcattttcttaggcgctacaccgaag	CRISPR spacer
aacatcattttcttaggctctacaccaaag	Protospacer
****************** *******.***

54. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448761 (Streptococcus phage Javan445, complete genome) position: , mismatch: 4, identity: 0.867

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
atttccagtaagttcaaatttcataaacgc	Protospacer
********************* *.***.*.

55. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448760 (Streptococcus phage Javan443, complete genome) position: , mismatch: 4, identity: 0.867

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
atttccagtaagttcaaatttcataaacgc	Protospacer
********************* *.***.*.

56. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to KU878088 (Bacillus phage AR9, complete genome) position: , mismatch: 5, identity: 0.833

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
catttcagtaatttcaaatttaacaaattt	Protospacer
  **.****** **************** *

57. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MF360957 (Bacillus virus PBS1, complete genome) position: , mismatch: 5, identity: 0.833

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
catttcagtaatttcaaatttaacaaattt	Protospacer
  **.****** **************** *

58. spacer 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
agctaagatgttgatatgaaattaacattt	Protospacer
.. .******* ******************

59. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018748 (Borreliella garinii strain CIP 103362 isolate 20047 plasmid unnamed3) position: , mismatch: 5, identity: 0.833

cattaat--ttagaattaataaacaataaaaa	CRISPR spacer
--tgaattattagaaataataaaaaataaaaa	Protospacer
  * ***  ****** ******* ********

60. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013708 (Clostridium botulinum strain F634 plasmid pRSJ2_1, complete sequence) position: , mismatch: 5, identity: 0.833

--cattaatttagaattaataaacaataaaaa	CRISPR spacer
agaatta--ttagaattaataaataataaaga	Protospacer
   ****  **************.******.*

61. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028868 (Borreliella garinii strain 20047 plasmid cp32-6, complete sequence) position: , mismatch: 5, identity: 0.833

cattaat--ttagaattaataaacaataaaaa	CRISPR spacer
--tgaattattagaaataataaaaaataaaaa	Protospacer
  * ***  ****** ******* ********

62. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NC_017239 (Borreliella afzelii PKo plasmid lp28-2, complete sequence) position: , mismatch: 5, identity: 0.833

cattaat--ttagaattaataaacaataaaaa	CRISPR spacer
--tgaattattagaactaataaaaaataaaaa	Protospacer
  * ***  ******.******* ********

63. spacer 1.25|169917|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK448933 (Streptococcus phage Javan420, complete genome) position: , mismatch: 5, identity: 0.833

gaaatgcgatagtggaagccatataaattc	CRISPR spacer
gaaatgcaatagtggaagccatataaccct	Protospacer
*******.****************** ...

64. spacer 1.4|168531|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to AP014352 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C33, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

atttccataatcagtcgaaactgtaatttg	CRISPR spacer
atttgcataatcagttgaaactggtcttgg	Protospacer
**** **********.*******   ** *

65. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MH319757 (Marine virus AG-345-O18 Ga0172273_11 genomic sequence) position: , mismatch: 6, identity: 0.8

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
ctcatcagtaagatcaaaattaacaaatgt	Protospacer
 *. .******* ***** ***********

66. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MN693943 (Marine virus AFVG_250M49, complete genome) position: , mismatch: 6, identity: 0.8

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
atttccagtcagttcagatttaacttttgc	Protospacer
********* ******.*******   **.

67. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 6, identity: 0.8

cattaatttagaattaataaacaataaaaa	CRISPR spacer
taaaactttagaagtaataaacaaaaaaaa	Protospacer
.*  * ******* ********** *****

68. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MT080590 (UNVERIFIED: Staphylococcus phage vB_SauM_EW27, complete genome) position: , mismatch: 6, identity: 0.8

cattaatttagaattaataaacaataaaaa	CRISPR spacer
tatagagttagaattaacaaacaataaaat	Protospacer
.** .* **********.*********** 

69. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to KY779848 (Staphylococcus phage qdsa001, complete genome) position: , mismatch: 6, identity: 0.8

cattaatttagaattaataaacaataaaaa	CRISPR spacer
tatagagttagaattaacaaacaataaaat	Protospacer
.** .* **********.*********** 

70. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to KX532239 (Staphylococcus phage StAP1, complete genome) position: , mismatch: 6, identity: 0.8

cattaatttagaattaataaacaataaaaa	CRISPR spacer
tatagagttagaattaacaaacaataaaat	Protospacer
.** .* **********.*********** 

71. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to JX194239 (Staphylococcus phage SA11, complete genome) position: , mismatch: 6, identity: 0.8

cattaatttagaattaataaacaataaaaa	CRISPR spacer
tatagagttagaattaacaaacaataaaat	Protospacer
.** .* **********.*********** 

72. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MT080584 (UNVERIFIED: Staphylococcus phage vB_SauM_EW15, complete genome) position: , mismatch: 6, identity: 0.8

cattaatttagaattaataaacaataaaaa	CRISPR spacer
tatagagttagaattaacaaacaataaaat	Protospacer
.** .* **********.*********** 

73. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MT080587 (UNVERIFIED: Staphylococcus phage vB_SauM_EW20, complete genome) position: , mismatch: 6, identity: 0.8

cattaatttagaattaataaacaataaaaa	CRISPR spacer
tatagagttagaattaacaaacaataaaat	Protospacer
.** .* **********.*********** 

74. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NC_007581 (Clostridium phage c-st, complete genome) position: , mismatch: 6, identity: 0.8

cattaatttagaattaataaacaataaaaa	CRISPR spacer
tttaattttataattcataaacaataaaaa	Protospacer
. * * **** **** **************

75. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to KP881332 (Staphylococcus phage Stau2, complete genome) position: , mismatch: 6, identity: 0.8

cattaatttagaattaataaacaataaaaa	CRISPR spacer
tatagagttagaattaacaaacaataaaat	Protospacer
.** .* **********.*********** 

76. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MT080588 (UNVERIFIED: Staphylococcus phage vB_SauM_EW22, complete genome) position: , mismatch: 6, identity: 0.8

cattaatttagaattaataaacaataaaaa	CRISPR spacer
tatagagttagaattaacaaacaataaaat	Protospacer
.** .* **********.*********** 

77. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to AP008983 (Clostridium phage c-st genomic DNA, complete genome) position: , mismatch: 6, identity: 0.8

cattaatttagaattaataaacaataaaaa	CRISPR spacer
tttaattttataattcataaacaataaaaa	Protospacer
. * * **** **** **************

78. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MT451873 (Vibrio phage vB_VhaS-VHB1, complete genome) position: , mismatch: 6, identity: 0.8

cattaatttagaattaataaacaataaaaa	CRISPR spacer
gatctataaagaattaataaagaataaaaa	Protospacer
 **. **  ************ ********

79. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NC_016567 (Vibrio phage SIO-2, complete genome) position: , mismatch: 6, identity: 0.8

cattaatttagaattaataaacaataaaaa	CRISPR spacer
gatctataaagaattaataaagaataaaaa	Protospacer
 **. **  ************ ********

80. spacer 1.12|169059|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017574 (Bacillus thuringiensis strain SCG04-02 plasmid PSCG364, complete sequence) position: , mismatch: 7, identity: 0.767

agttttaacattaaatcacgtcttaaataa	CRISPR spacer
ttgtataacattaaatcacttgttaaatag	Protospacer
   * ************** * *******.

81. spacer 1.12|169059|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NC_017401 (Borreliella burgdorferi N40 plasmid N40_cp26, complete sequence) position: , mismatch: 7, identity: 0.767

agttttaacattaaatcacgtcttaaataa	CRISPR spacer
gattttaaccttaaatcacttcttataaag	Protospacer
..******* ********* ***** * *.

82. spacer 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
atgaaaactgttgatatgaaattaacattt	Protospacer
. . **. *** ******************

83. spacer 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ776580 (Clostridium botulinum strain CDC5900 plasmid pCDC5900, complete sequence) position: , mismatch: 7, identity: 0.767

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
attcaaaatgaagatatgaaattaacagtg	Protospacer
.  ***.*** **************** * 

84. spacer 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP007625 (Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
taagttactgttgatatgaaattaacattt	Protospacer
 **   . *** ******************

85. spacer 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009650 (Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence) position: , mismatch: 7, identity: 0.767

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
taagttactgttgatatgaaattaacattt	Protospacer
 **   . *** ******************

86. spacer 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MG592576 (Vibrio phage 1.206.O._10N.222.51.B10, partial genome) position: , mismatch: 7, identity: 0.767

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
gattaaggtgtagatattaaattaacaaga	Protospacer
** .***.********* *********   

87. spacer 1.15|169257|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013072 (Sphingobium indicum B90A plasmid pSRL2, complete sequence) position: , mismatch: 7, identity: 0.767

tcaaccaccgccgcataatcgaaatcatcc	CRISPR spacer
ttgaatgccgccgcataatcgaaatcgtcg	Protospacer
*..* ..*******************.** 

88. spacer 1.15|169257|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP005190 (Sphingobium sp. MI1205 plasmid pMI1, complete sequence) position: , mismatch: 7, identity: 0.767

tcaaccaccgccgcataatcgaaatcatcc	CRISPR spacer
ttgaaggccgccgcataatcgaaatcgtcg	Protospacer
*..*  .*******************.** 

89. spacer 1.16|169323|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017574 (Bacillus thuringiensis strain SCG04-02 plasmid PSCG364, complete sequence) position: , mismatch: 7, identity: 0.767

agttttaacattaaatcacgtcttaaataa	CRISPR spacer
ttgtataacattaaatcacttgttaaatag	Protospacer
   * ************** * *******.

90. spacer 1.16|169323|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NC_017401 (Borreliella burgdorferi N40 plasmid N40_cp26, complete sequence) position: , mismatch: 7, identity: 0.767

agttttaacattaaatcacgtcttaaataa	CRISPR spacer
gattttaaccttaaatcacttcttataaag	Protospacer
..******* ********* ***** * *.

91. spacer 1.17|169389|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MN694670 (Marine virus AFVG_250M589, complete genome) position: , mismatch: 7, identity: 0.767

aaaggaagtaaaaaaggttctaaattaaga	CRISPR spacer
caaggaattaaaaaaggttctaaagaatat	Protospacer
 ****** ****************  * . 

92. spacer 1.17|169389|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to HQ634190 (Cyanophage Syn2 genomic sequence) position: , mismatch: 7, identity: 0.767

aaaggaagtaaaaaaggttctaaattaaga	CRISPR spacer
ccaggacgtaaaaaacgttctaaataatgt	Protospacer
  **** ******** ********* * * 

93. spacer 1.17|169389|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to GU071097 (Synechococcus phage S-SSM5, complete genome) position: , mismatch: 7, identity: 0.767

aaaggaagtaaaaaaggttctaaattaaga	CRISPR spacer
ccaggacgtaaaaaacgttctaaataatgt	Protospacer
  **** ******** ********* * * 

94. spacer 1.17|169389|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NC_015286 (Synechococcus phage Syn19, complete genome) position: , mismatch: 7, identity: 0.767

aaaggaagtaaaaaaggttctaaattaaga	CRISPR spacer
ccaggacgtaaaaaacgttctaaataatgt	Protospacer
  **** ******** ********* * * 

95. spacer 1.18|169455|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MN694670 (Marine virus AFVG_250M589, complete genome) position: , mismatch: 7, identity: 0.767

aaaggaagtaaaaaaggttctaaattaaga	CRISPR spacer
caaggaattaaaaaaggttctaaagaatat	Protospacer
 ****** ****************  * . 

96. spacer 1.18|169455|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to HQ634190 (Cyanophage Syn2 genomic sequence) position: , mismatch: 7, identity: 0.767

aaaggaagtaaaaaaggttctaaattaaga	CRISPR spacer
ccaggacgtaaaaaacgttctaaataatgt	Protospacer
  **** ******** ********* * * 

97. spacer 1.18|169455|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to GU071097 (Synechococcus phage S-SSM5, complete genome) position: , mismatch: 7, identity: 0.767

aaaggaagtaaaaaaggttctaaattaaga	CRISPR spacer
ccaggacgtaaaaaacgttctaaataatgt	Protospacer
  **** ******** ********* * * 

98. spacer 1.18|169455|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NC_015286 (Synechococcus phage Syn19, complete genome) position: , mismatch: 7, identity: 0.767

aaaggaagtaaaaaaggttctaaattaaga	CRISPR spacer
ccaggacgtaaaaaacgttctaaataatgt	Protospacer
  **** ******** ********* * * 

99. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NC_013940 (Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence) position: , mismatch: 7, identity: 0.767

cattaatttagaattaataaacaataaaaa	CRISPR spacer
acgaaattaataattaataaacaataaaag	Protospacer
    **** * ******************.

100. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021643 (Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence) position: , mismatch: 7, identity: 0.767

cattaatttagaattaataaacaataaaaa	CRISPR spacer
gtttaatttagacttaatatacaatgcaag	Protospacer
  ********** ****** *****. **.

101. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MN692972 (Marine virus AFVG_117M68, complete genome) position: , mismatch: 7, identity: 0.767

cattaatttagaattaataaacaataaaaa	CRISPR spacer
taaaatattagaattaataaaaaataaata	Protospacer
.*  *  ************** ****** *

102. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MN693697 (Marine virus AFVG_250M256, complete genome) position: , mismatch: 7, identity: 0.767

cattaatttagaattaataaacaataaaaa	CRISPR spacer
taaaatattagaattaataaaaaataaata	Protospacer
.*  *  ************** ****** *

103. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MN694054 (Marine virus AFVG_250M255, complete genome) position: , mismatch: 7, identity: 0.767

cattaatttagaattaataaacaataaaaa	CRISPR spacer
taaaatattagaattaataaaaaataaata	Protospacer
.*  *  ************** ****** *

104. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MN694075 (Marine virus AFVG_250M257, complete genome) position: , mismatch: 7, identity: 0.767

cattaatttagaattaataaacaataaaaa	CRISPR spacer
taaaatattagaattaataaaaaataaata	Protospacer
.*  *  ************** ****** *

105. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MN693016 (Marine virus AFVG_117M69, complete genome) position: , mismatch: 7, identity: 0.767

cattaatttagaattaataaacaataaaaa	CRISPR spacer
taaaatattagaattaataaaaaataaata	Protospacer
.*  *  ************** ****** *

106. spacer 1.23|169785|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NC_013793 (Bacillus pseudofirmus OF4 plasmid pBpOF4-02, complete sequence) position: , mismatch: 7, identity: 0.767

tagtaattctcccattattaaattaaattt	CRISPR spacer
atataattctccgtttattaaattaatgtt	Protospacer
  .*********  ************  **

107. spacer 1.23|169785|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MF001357 (Clostridium phage CP3, partial genome) position: , mismatch: 7, identity: 0.767

tagtaattctcccattattaaat--taaattt	CRISPR spacer
tagtaactctctcattattaaatactgagc--	Protospacer
******.****.***********  *.*..  

108. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051648 (Staphylococcus caprae strain SY333 plasmid pSY333-45, complete sequence) position: , mismatch: 8, identity: 0.733

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
ttcaatagtaatttcaaatttaacaaataa	Protospacer
 *.  .***** ****************. 

109. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040462 (Enterococcus sp. M190262 plasmid pM190262, complete sequence) position: , mismatch: 8, identity: 0.733

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
aactcctgtaaattcaaatttaacaacatc	Protospacer
* .*** ****.**************   .

110. spacer 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MT774411 (CrAssphage cr273_1, complete genome) position: , mismatch: 8, identity: 0.733

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
cttgttaataagatcagcaatgttctttga	Protospacer
. .  .********** ******* *****

111. spacer 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MT774410 (CrAssphage cr272_1, complete genome) position: , mismatch: 8, identity: 0.733

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
cttgttaataagatcagcaatgttctttga	Protospacer
. .  .********** ******* *****

112. spacer 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045419 (Pseudoalteromonas sp. THAF3 plasmid pTHAF3_a, complete sequence) position: , mismatch: 8, identity: 0.733

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
gattacaataagatcaacaatgttatttat	Protospacer
 *...*********** *******.***. 

113. spacer 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NC_031274 (Pseudomonas phage O4, complete genome) position: , mismatch: 8, identity: 0.733

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
tgtggcaataagaccaccactgttgttacc	Protospacer
*.. *********.***** *******   

114. spacer 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MF788075 (Pseudomonas phage IME180, complete genome) position: , mismatch: 8, identity: 0.733

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
tgtggcaataagaccaccactgttgttacc	Protospacer
*.. *********.***** *******   

115. spacer 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.733

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
tacattcatgtagatattgaattaacattt	Protospacer
 *     ********** .***********

116. spacer 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020744 (Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
ctgttaaatgttgatatgaaatcaacattt	Protospacer
  .. *.**** **********.*******

117. spacer 1.14|169191|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045607 (Bacillus cereus strain SB1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
atcttaaatgttgatatgaaattaacatct	Protospacer
.  . *.**** ****************.*

118. spacer 1.15|169257|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022991 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence) position: , mismatch: 8, identity: 0.733

tcaaccaccgccgcataatcgaaatcatcc	CRISPR spacer
ccaaccaccgccgcataaacgatccgttct	Protospacer
.***************** ***  .  **.

119. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026129 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence) position: , mismatch: 8, identity: 0.733

cattaatttagaattaataaacaataaaaa	CRISPR spacer
atgaaatttatatttaataaacaataaatt	Protospacer
    ****** * ***************  

120. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017108 (Lactobacillus salivarius strain CICC23174 plasmid pLS_1 sequence) position: , mismatch: 8, identity: 0.733

cattaatttagaattaataaacaataaaaa	CRISPR spacer
cataaatttagaattaataaatttcattac	Protospacer
*** *****************.  .*  * 

121. spacer 1.21|169653|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017110 (Lactobacillus salivarius strain CICC23174 plasmid pLS_3, complete sequence) position: , mismatch: 8, identity: 0.733

cattaatttagaattaataaacaataaaaa	CRISPR spacer
tcataatttagaattaataaaaaaaggtaa	Protospacer
.  ****************** ** .. **

122. spacer 1.22|169719|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MN693045 (Marine virus AFVG_25M135, complete genome) position: , mismatch: 8, identity: 0.733

ctaatgctgataagtatgtaacttttgcct	CRISPR spacer
ctaatgctgataagtatgcaaaagatattt	Protospacer
******************.**    *...*

123. spacer 1.23|169785|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NC_022534 (Plautia stali symbiont plasmid pPstS2 DNA, complete genome) position: , mismatch: 8, identity: 0.733

tagtaattctcccattattaaattaaattt	CRISPR spacer
aaaatgctcttccattattaaattaatttt	Protospacer
 *.  ..***.*************** ***

124. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to KY860935 (Salmonella phage LPST10, complete genome) position: , mismatch: 9, identity: 0.7

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
gtttccatttagttcaaatttaacgccaca	Protospacer
.****** * **************.     

125. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MH424446 (Salmonella virus VSt472, complete genome) position: , mismatch: 9, identity: 0.7

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
gtttccatttagttcaaatttaacgccaca	Protospacer
.****** * **************.     

126. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MK599416 (Salmonella phage Akira, complete genome) position: , mismatch: 9, identity: 0.7

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
gtttccatttagttcaaatttaacgccaca	Protospacer
.****** * **************.     

127. spacer 1.9|168861|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MN692673 (Salmonella phage VB_StyS_BS5, complete genome) position: , mismatch: 9, identity: 0.7

atttccagtaagttcaaatttaacaaatgt	CRISPR spacer
gtttccatttagttcaaatttaacgccaca	Protospacer
.****** * **************.     

128. spacer 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to KU160641 (Arthrobacter phage CaptnMurica, complete genome) position: , mismatch: 9, identity: 0.7

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
tgtgagaataagatcaccattgttgttaat	Protospacer
*.. . ************* ******* . 

129. spacer 1.13|169125|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MH825711 (Arthrobacter phage Tenno, complete genome) position: , mismatch: 9, identity: 0.7

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
tgtgagaataagatcaccattgttgttaat	Protospacer
*.. . ************* ******* . 

130. spacer 1.17|169389|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 9, identity: 0.7

aaaggaagtaaaaaaggttctaaattaaga	CRISPR spacer
attaccctaaacaaaggttctaaattaaga	Protospacer
*  .     ** ******************

131. spacer 1.17|169389|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MH617331 (Microviridae sp. isolate ctbd619, complete genome) position: , mismatch: 9, identity: 0.7

aaaggaagtaaaaaaggttctaaattaaga	CRISPR spacer
aaaggtagtaaaaaaggttctgccgtttac	Protospacer
***** ***************.   *  . 

132. spacer 1.18|169455|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 9, identity: 0.7

aaaggaagtaaaaaaggttctaaattaaga	CRISPR spacer
attaccctaaacaaaggttctaaattaaga	Protospacer
*  .     ** ******************

133. spacer 1.18|169455|30|NZ_ANDA01000105|CRT,PILER-CR,CRISPRCasFinder matches to MH617331 (Microviridae sp. isolate ctbd619, complete genome) position: , mismatch: 9, identity: 0.7

aaaggaagtaaaaaaggttctaaattaaga	CRISPR spacer
aaaggtagtaaaaaaggttctgccgtttac	Protospacer
***** ***************.   *  . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 43402 : 52785 9 uncultured_Caudovirales_phage(28.57%) NA NA
DBSCAN-SWA_2 90666 : 113775 25 Streptococcus_phage(80.0%) integrase,transposase attL 82860:82874|attR 98496:98510
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_ANDA01000104
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 786 : 5497 6 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage