Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ANDC01000019 Streptococcus agalactiae CCUG 29782 ctg120000959616, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDC01000007 Streptococcus agalactiae CCUG 29782 ctg120000959604, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDC01000021 Streptococcus agalactiae CCUG 29782 ctg120000959618, whole genome shotgun sequence 0 crisprs cas3,csa3 0 0 1 0
NZ_ANDC01000013 Streptococcus agalactiae CCUG 29782 ctg120000959610, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDC01000004 Streptococcus agalactiae CCUG 29782 ctg120000959601, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ANDC01000024 Streptococcus agalactiae CCUG 29782 ctg120000959621, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_ANDC01000003 Streptococcus agalactiae CCUG 29782 ctg120000959600, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDC01000023 Streptococcus agalactiae CCUG 29782 ctg120000959620, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 0 12 0 0
NZ_ANDC01000020 Streptococcus agalactiae CCUG 29782 ctg120000959617, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDC01000011 Streptococcus agalactiae CCUG 29782 ctg120000959608, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDC01000022 Streptococcus agalactiae CCUG 29782 ctg120000959619, whole genome shotgun sequence 1 crisprs csm6 0 0 0 0
NZ_ANDC01000014 Streptococcus agalactiae CCUG 29782 ctg120000959611, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ANDC01000018 Streptococcus agalactiae CCUG 29782 ctg120000959615, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANDC01000002 Streptococcus agalactiae CCUG 29782 ctg120000959599, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDC01000005 Streptococcus agalactiae CCUG 29782 ctg120000959602, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDC01000006 Streptococcus agalactiae CCUG 29782 ctg120000959603, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDC01000001 Streptococcus agalactiae CCUG 29782 ctg120000959567, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDC01000015 Streptococcus agalactiae CCUG 29782 ctg120000959612, whole genome shotgun sequence 1 crisprs DEDDh,WYL 0 0 2 0
NZ_ANDC01000009 Streptococcus agalactiae CCUG 29782 ctg120000959606, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDC01000016 Streptococcus agalactiae CCUG 29782 ctg120000959613, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDC01000010 Streptococcus agalactiae CCUG 29782 ctg120000959607, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDC01000008 Streptococcus agalactiae CCUG 29782 ctg120000959605, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANDC01000012 Streptococcus agalactiae CCUG 29782 ctg120000959609, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANDC01000017 Streptococcus agalactiae CCUG 29782 ctg120000959614, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0

Results visualization

1. NZ_ANDC01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ANDC01000004.1|WP_000384271.1|6341_6668_-|hypothetical-protein 6341_6668_- 108 aa aa AcrIIA21 NA NA No NA
2. NZ_ANDC01000024
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 33623 : 42614 8 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_2 95418 : 104802 9 uncultured_Caudovirales_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ANDC01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3721 : 11275 11 Streptococcus_phage(50.0%) integrase,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ANDC01000023
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ANDC01000023_1 69538-70431 TypeII II-A:II-A,II-B
13 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ANDC01000023_1 1.5|69838|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69838-69867 30 MK448742 Streptococcus phage Javan37, complete genome 28973-29002 0 1.0
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 MK448749 Streptococcus phage Javan39, complete genome 20005-20034 0 1.0
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 MH853356 Streptococcus phage LF2, partial genome 43016-43045 0 1.0
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448956 Streptococcus phage Javan48, complete genome 33900-33929 1 0.967
NZ_ANDC01000023_1 1.5|69838|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69838-69867 30 MK448956 Streptococcus phage Javan48, complete genome 32279-32308 1 0.967
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 MK448742 Streptococcus phage Javan37, complete genome 29903-29932 1 0.967
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 MK448851 Streptococcus phage Javan14, complete genome 33850-33879 1 0.967
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 JX409894 Streptococcus phage LYGO9, complete genome 13214-13243 2 0.933
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448971 Streptococcus phage Javan52, complete genome 35890-35919 2 0.933
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448829 Streptococcus phage Javan7, complete genome 30583-30612 2 0.933
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448736 Streptococcus phage Javan35, complete genome 31054-31083 2 0.933
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448781 Streptococcus phage Javan5, complete genome 33076-33105 2 0.933
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448749 Streptococcus phage Javan39, complete genome 35482-35511 2 0.933
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MH853355 Streptococcus phage LF1, complete genome 21440-21469 2 0.933
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 JX409895 Streptococcus phage JX01, complete genome 25061-25090 2 0.933
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448938 Streptococcus phage Javan44, complete genome 31055-31084 2 0.933
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MH853356 Streptococcus phage LF2, partial genome 27496-27525 2 0.933
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448911 Streptococcus phage Javan34, complete genome 31054-31083 2 0.933
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448837 Streptococcus phage Javan10, complete genome 29112-29141 2 0.933
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MH853358 Streptococcus phage LF4, complete genome 21440-21469 2 0.933
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448916 Streptococcus phage Javan36, complete genome 31054-31083 2 0.933
NZ_ANDC01000023_1 1.5|69838|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69838-69867 30 MK448796 Streptococcus phage Javan53, complete genome 37775-37804 2 0.933
NZ_ANDC01000023_1 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69904-69933 30 MK448924 Streptococcus phage Javan384, complete genome 7947-7976 2 0.933
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 MK448956 Streptococcus phage Javan48, complete genome 33209-33238 2 0.933
NZ_ANDC01000023_1 1.10|70168|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70168-70197 30 JX409894 Streptococcus phage LYGO9, complete genome 31844-31873 2 0.933
NZ_ANDC01000023_1 1.10|70168|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70168-70197 30 JX409895 Streptococcus phage JX01, complete genome 662-691 2 0.933
NZ_ANDC01000023_1 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70300-70329 30 MK448796 Streptococcus phage Javan53, complete genome 36041-36070 2 0.933
NZ_ANDC01000023_1 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70300-70329 30 MK448971 Streptococcus phage Javan52, complete genome 32226-32255 2 0.933
NZ_ANDC01000023_1 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70300-70329 30 MK448829 Streptococcus phage Javan7, complete genome 26921-26950 2 0.933
NZ_ANDC01000023_1 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70300-70329 30 MK448956 Streptococcus phage Javan48, complete genome 30545-30574 2 0.933
NZ_ANDC01000023_1 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70300-70329 30 MH853355 Streptococcus phage LF1, complete genome 17778-17807 2 0.933
NZ_ANDC01000023_1 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70300-70329 30 MH853358 Streptococcus phage LF4, complete genome 17778-17807 2 0.933
NZ_ANDC01000023_1 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69904-69933 30 AJ609634 Bacteriophage EJ-1 proviral DNA, complete genome 10413-10442 3 0.9
NZ_ANDC01000023_1 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69904-69933 30 NC_005294 Streptococcus prophage EJ-1, complete genome 10413-10442 3 0.9
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 MK448859 Streptococcus phage Javan170, complete genome 20220-20249 3 0.9
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 MK448690 Streptococcus phage Javan169, complete genome 20578-20607 3 0.9
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 MK448850 Streptococcus phage Javan132, complete genome 19807-19836 3 0.9
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 MK448676 Streptococcus phage Javan131, complete genome 22730-22759 3 0.9
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 MK448688 Streptococcus phage Javan161, complete genome 20173-20202 3 0.9
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 MK448973 Streptococcus phage Javan522, complete genome 19671-19700 3 0.9
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 MK448955 Streptococcus phage Javan478, complete genome 21048-21077 3 0.9
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 MK448778 Streptococcus phage Javan493, complete genome 19213-19242 3 0.9
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 MK448962 Streptococcus phage Javan496, complete genome 9204-9233 3 0.9
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 MK448975 Streptococcus phage Javan526, complete genome 19995-20024 3 0.9
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 MK448782 Streptococcus phage Javan501, complete genome 22353-22382 3 0.9
NZ_ANDC01000023_1 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70300-70329 30 MK448837 Streptococcus phage Javan10, complete genome 25450-25479 3 0.9
NZ_ANDC01000023_1 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70300-70329 30 MK448742 Streptococcus phage Javan37, complete genome 27241-27270 3 0.9
NZ_ANDC01000023_1 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70300-70329 30 MK448851 Streptococcus phage Javan14, complete genome 31180-31209 3 0.9
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 KC465899 Pelagibacter phage HTVC008M, complete genome 125202-125231 4 0.867
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 JX409894 Streptococcus phage LYGO9, complete genome 28656-28685 4 0.867
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 MK448675 Streptococcus phage Javan129, complete genome 20470-20499 4 0.867
NZ_ANDC01000023_1 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70234-70263 30 JX409895 Streptococcus phage JX01, complete genome 40503-40532 4 0.867
NZ_ANDC01000023_1 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70300-70329 30 MK448749 Streptococcus phage Javan39, complete genome 31818-31847 4 0.867
NZ_ANDC01000023_1 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70300-70329 30 MH853356 Streptococcus phage LF2, partial genome 31159-31188 4 0.867
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MN693096 Marine virus AFVG_25M80, complete genome 24962-24991 5 0.833
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP035396 Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence 5260-5289 6 0.8
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP032856 Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence 45542-45571 6 0.8
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_MG557999 Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence 51740-51769 6 0.8
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_MF497781 Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence 51740-51769 6 0.8
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 MT074138 Bacteroides phage DAC17, complete genome 95749-95778 6 0.8
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 MT074136 Bacteroides phage DAC15, complete genome 96339-96368 6 0.8
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP046030 Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence 15565-15594 6 0.8
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 AP014166 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C61-MedDCM-OCT-S46-C82, *** SEQUENCING IN PROGRESS *** 5438-5467 6 0.8
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 AP014287 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S24-C25, *** SEQUENCING IN PROGRESS *** 29553-29582 6 0.8
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448932 Streptococcus phage Javan42, complete genome 30325-30354 7 0.767
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448742 Streptococcus phage Javan37, complete genome 30594-30623 7 0.767
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448669 Streptococcus phage Javan11, complete genome 30754-30783 7 0.767
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448708 Streptococcus phage Javan23, complete genome 33082-33111 7 0.767
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK448897 Streptococcus phage Javan28, complete genome 33082-33111 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_KR091915 Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence 42923-42952 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP025915 Escherichia coli strain 203740 plasmid p203740_35, complete sequence 8594-8623 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_LS999564 Escherichia coli isolate EC-TO143 plasmid 5, complete sequence 682-711 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_LN824136 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671 16675-16704 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP054370 Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence 19258-19287 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP006640 Escherichia coli PCN061 plasmid PCN061p4, complete sequence 5957-5986 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP029801 Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence 7884-7913 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP015505 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence 27842-27871 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP026060 Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence 16877-16906 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP024853 Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence 326-355 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_LT985287 Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence 31253-31282 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP028999 Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence 14730-14759 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP027258 Escherichia coli strain EC11 plasmid unnamed3, complete sequence 21718-21747 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP019200 Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence 31777-31806 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP023823 Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence 16675-16704 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP026025 Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence 33042-33071 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP018988 Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence 682-711 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_MK033500 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence 7491-7520 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_MK033501 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence 55790-55819 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_MK033499 Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence 107898-107927 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 MN693256 Marine virus AFVG_25M339, complete genome 27548-27577 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_LR215001 Mycoplasma conjunctivae strain NCTC10147 plasmid 5 7233-7262 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 MN855807 Siphoviridae sp. isolate 122, partial genome 13518-13547 7 0.767
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 FJ429185 Lactococcus phage P087, complete genome 18714-18743 7 0.767
NZ_ANDC01000023_1 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69772-69801 30 MT778840 Rhizobium phage P11VFA, complete genome 28085-28114 7 0.767
NZ_ANDC01000023_1 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69772-69801 30 KF614509 Rhizobium phage vB_RleS_L338C, complete genome 63260-63289 7 0.767
NZ_ANDC01000023_1 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69772-69801 30 MF417890 Uncultured Caudovirales phage clone 7F_15, partial genome 31755-31784 7 0.767
NZ_ANDC01000023_1 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69772-69801 30 MF417953 Uncultured Caudovirales phage clone 7S_15, partial genome 5050-5079 7 0.767
NZ_ANDC01000023_1 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69772-69801 30 GU557055 Puniceispirillum phage HMO-2011, complete genome 33660-33689 7 0.767
NZ_ANDC01000023_1 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69904-69933 30 NZ_CP044019 Acinetobacter indicus strain HY20 plasmid pAI01, complete sequence 64701-64730 7 0.767
NZ_ANDC01000023_1 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69904-69933 30 MN855940 Myoviridae sp. isolate 64, complete genome 2455-2484 7 0.767
NZ_ANDC01000023_1 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69904-69933 30 CAJCJZ010000002 Enterococcus phage vB_EfaS_140 genome assembly, contig: phage140-genome, whole genome shotgun sequence 37602-37631 7 0.767
NZ_ANDC01000023_1 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69904-69933 30 MT119360 Enterococcus phage nattely, complete genome 46883-46912 7 0.767
NZ_ANDC01000023_1 1.7|69970|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69970-69999 30 NZ_CP028120 Escherichia coli O43 str. RM10042 plasmid pRM10042-1, complete sequence 45471-45500 7 0.767
NZ_ANDC01000023_1 1.7|69970|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69970-69999 30 NZ_CP033633 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb2, complete sequence 135584-135613 7 0.767
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 NC_012530 Lactobacillus phage Lb338-1, complete genome 12604-12633 7 0.767
NZ_ANDC01000023_1 1.13|70366|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70366-70395 30 NC_004534 Corynebacterium glutamicum plasmid pCG2, complete sequence 2537-2566 7 0.767
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK250021 Prevotella phage Lak-B2, complete genome 147280-147309 8 0.733
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK250024 Prevotella phage Lak-B5, complete genome 142029-142058 8 0.733
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK250028 Prevotella phage Lak-B9, complete genome 146163-146192 8 0.733
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK250023 Prevotella phage Lak-B4, complete genome 147183-147212 8 0.733
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK250025 Prevotella phage Lak-B6, complete genome 145222-145251 8 0.733
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK250022 Prevotella phage Lak-B3, complete genome 145237-145266 8 0.733
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK250027 Prevotella phage Lak-B8, complete genome 147394-147423 8 0.733
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK250026 Prevotella phage Lak-B7, complete genome 147393-147422 8 0.733
NZ_ANDC01000023_1 1.1|69574|30|NZ_ANDC01000023|CRT 69574-69603 30 MK250020 Prevotella phage Lak-B1, complete genome 146143-146172 8 0.733
NZ_ANDC01000023_1 1.2|69640|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69640-69669 30 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 273778-273807 8 0.733
NZ_ANDC01000023_1 1.2|69640|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69640-69669 30 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 256698-256727 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP039286 Leptospira interrogans strain FMAS_AW1 plasmid pLiSL3, complete sequence 70939-70968 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP012103 Bacillus thuringiensis strain HS18-1 plasmid pHS18-4, complete sequence 20110-20139 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_LR214953 Mycoplasma neurolyticum strain NCTC10166 plasmid 3 5510-5539 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP009352 Francisella tularensis subsp. novicida F6168 plasmid unnamed, complete sequence 2297-2326 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NZ_CP051681 Cohnella sp. MFER-1 plasmid unnamed1 74376-74405 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NC_004952 Francisella novicida plasmid pFNL10, complete sequence 110-139 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NC_002109 Francisella tularensis plasmid pOM1, complete sequence 110-139 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 LC494302 Escherichia phage SP27 DNA, complete genome 245480-245509 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 MK817115 Escherichia phage vB_EcoM_phAPEC6, complete genome 230963-230992 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 NC_027364 Escherichia phage PBECO 4, complete genome 39408-39437 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 MH383160 Escherichia phage UB, complete genome 99995-100024 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 MK327931 Escherichia phage vB_EcoM_G17, complete genome 256257-256286 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 MN871445 UNVERIFIED: Serratia phage KpHz_2, complete genome 75797-75826 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 MK448636 Streptococcus satellite phage Javan749, complete genome 10387-10416 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 MN871444 UNVERIFIED: Serratia phage KpGz_1, complete genome 13324-13353 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 MN693101 Marine virus AFVG_25M559, complete genome 25633-25662 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 KT725776 Bacillus phage vB_BceS-MY192, partial genome 2349-2378 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 LT603033 Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I 187103-187132 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 KM507819 Escherichia phage 121Q, complete genome 246579-246608 8 0.733
NZ_ANDC01000023_1 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69772-69801 30 NC_008201 Mannheimia phage phiMHaA1, complete genome 22041-22070 8 0.733
NZ_ANDC01000023_1 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69772-69801 30 DQ426905 Bacteriophage phi-MhaA1-BAA410, complete genome 22116-22145 8 0.733
NZ_ANDC01000023_1 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69772-69801 30 KP137432 Mannheimia phage vB_MhM_535AP1, complete genome 22081-22110 8 0.733
NZ_ANDC01000023_1 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69772-69801 30 JN255163 Mannheimia phage vB_MhM_1152AP, complete genome 22277-22306 8 0.733
NZ_ANDC01000023_1 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69772-69801 30 KP137438 Mannheimia phage vB_MhM_2256AP1, complete genome 22442-22471 8 0.733
NZ_ANDC01000023_1 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69772-69801 30 DQ426904 Bacteriophage phi-MhaA1-PHL101, complete genome 22041-22070 8 0.733
NZ_ANDC01000023_1 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69904-69933 30 MK448665 Streptococcus phage Javan1, complete genome 31865-31894 8 0.733
NZ_ANDC01000023_1 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69904-69933 30 NZ_CP053834 Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence 102759-102788 8 0.733
NZ_ANDC01000023_1 1.7|69970|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 69970-69999 30 NC_014502 Gloeothece verrucosa PCC 7822 plasmid Cy782203, complete sequence 95768-95797 8 0.733
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 MN871480 UNVERIFIED: Pseudomonas phage PaSz-1_45_270k, complete genome 229744-229773 8 0.733
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 MT001829 Salmonella phage SE_PL, complete genome 257363-257392 8 0.733
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 DI373487 KR 1020130142837-A/1: Bacteriophage of Pseudomonas aeruginosa and uses thereof 253719-253748 8 0.733
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 MK773491 Salmonella phage 7t3, complete genome 91373-91402 8 0.733
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 MN871489 UNVERIFIED: Pseudomonas phage PaZh_1, complete genome 261622-261651 8 0.733
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 NC_042081 Pseudomonas phage SL2, complete genome 232282-232311 8 0.733
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 MK268344 Salmonella phage Munch, complete genome 28685-28714 8 0.733
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 NC_042060 Pseudomonas phage PA7, partial genome 253719-253748 8 0.733
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 NC_004629 Pseudomonas phage phiKZ, complete genome 52347-52376 8 0.733
NZ_ANDC01000023_1 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder 69706-69735 30 HQ683709 Planktothrix phage PaV-LD, complete genome 72162-72191 9 0.7
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 NZ_CP046044 Acinetobacter towneri strain 19110F47 plasmid p19110F47-2, complete sequence 79842-79871 9 0.7
NZ_ANDC01000023_1 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR 70102-70131 30 NZ_CP048015 Acinetobacter towneri strain 205 plasmid pAT205, complete sequence 1512-1541 9 0.7

1. spacer 1.5|69838|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 0, identity: 1.0

ctagctttatttatcccgttgcggatgttt	CRISPR spacer
ctagctttatttatcccgttgcggatgttt	Protospacer
******************************

2. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 0, identity: 1.0

atagtcatccatcataacgactggtgtgat	CRISPR spacer
atagtcatccatcataacgactggtgtgat	Protospacer
******************************

3. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 0, identity: 1.0

atagtcatccatcataacgactggtgtgat	CRISPR spacer
atagtcatccatcataacgactggtgtgat	Protospacer
******************************

4. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 1, identity: 0.967

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaacaaatgattttgtaccatc	Protospacer
****** ***********************

5. spacer 1.5|69838|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 1, identity: 0.967

ctagctttatttatcccgttgcggatgttt	CRISPR spacer
ctaactttatttatcccgttgcggatgttt	Protospacer
***.**************************

6. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 1, identity: 0.967

agctctaaatcaacatatccatcaacttca	CRISPR spacer
agttctaaatcaacatatccatcaacttca	Protospacer
**.***************************

7. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 1, identity: 0.967

agctctaaatcaacatatccatcaacttca	CRISPR spacer
agttctaaatcaacatatccatcaacttca	Protospacer
**.***************************

8. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 2, identity: 0.933

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaaaaaatgattttgtaccatc	Protospacer
****** **** ******************

9. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 2, identity: 0.933

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaaaaaatgattttgtaccatc	Protospacer
****** **** ******************

10. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448829 (Streptococcus phage Javan7, complete genome) position: , mismatch: 2, identity: 0.933

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaaaaaatgattttgtaccatc	Protospacer
****** **** ******************

11. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 2, identity: 0.933

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaaaaaatgattttgtaccatc	Protospacer
****** **** ******************

12. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 2, identity: 0.933

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaaaaaatgattttgtaccatc	Protospacer
****** **** ******************

13. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 2, identity: 0.933

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaaaaaatgattttgtaccatc	Protospacer
****** **** ******************

14. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MH853355 (Streptococcus phage LF1, complete genome) position: , mismatch: 2, identity: 0.933

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaaaaaatgattttgtaccatc	Protospacer
****** **** ******************

15. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 2, identity: 0.933

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaaaaaatgattttgtaccatc	Protospacer
****** **** ******************

16. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 2, identity: 0.933

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaaaaaatgattttgtaccatc	Protospacer
****** **** ******************

17. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 2, identity: 0.933

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaaaaaatgattttgtaccatc	Protospacer
****** **** ******************

18. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 2, identity: 0.933

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaaaaaatgattttgtaccatc	Protospacer
****** **** ******************

19. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 2, identity: 0.933

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaaaaaatgattttgtaccatc	Protospacer
****** **** ******************

20. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MH853358 (Streptococcus phage LF4, complete genome) position: , mismatch: 2, identity: 0.933

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaaaaaatgattttgtaccatc	Protospacer
****** **** ******************

21. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 2, identity: 0.933

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtcccaaaaaatgattttgtaccatc	Protospacer
****** **** ******************

22. spacer 1.5|69838|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 2, identity: 0.933

ctagctttatttatcccgttgcggatgttt	CRISPR spacer
ctagctttatttattccgttgcggatgttc	Protospacer
**************.**************.

23. spacer 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448924 (Streptococcus phage Javan384, complete genome) position: , mismatch: 2, identity: 0.933

gaagtaaaagatatttatgcagaagtgatt	CRISPR spacer
gaagtaaaagatatttatgcagaagttatc	Protospacer
************************** **.

24. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 2, identity: 0.933

agctctaaatcaacatatccatcaacttca	CRISPR spacer
agttctaaatcaacatatccatcgacttca	Protospacer
**.********************.******

25. spacer 1.10|70168|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 2, identity: 0.933

cctacacactcgtctcacgtactgttgaca	CRISPR spacer
cctacacactcgtcgcacgtactgctgaca	Protospacer
************** *********.*****

26. spacer 1.10|70168|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 2, identity: 0.933

cctacacactcgtctcacgtactgttgaca	CRISPR spacer
cctacacactcgtcgcacgtactgctgaca	Protospacer
************** *********.*****

27. spacer 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 2, identity: 0.933

gaaattcaaactgcttgtaaaatctccagc	CRISPR spacer
ggaatttaaactgcttgtaaaatctccagc	Protospacer
*.****.***********************

28. spacer 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 2, identity: 0.933

gaaattcaaactgcttgtaaaatctccagc	CRISPR spacer
gaaattcaaactgcttataaaatctccaac	Protospacer
****************.***********.*

29. spacer 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448829 (Streptococcus phage Javan7, complete genome) position: , mismatch: 2, identity: 0.933

gaaattcaaactgcttgtaaaatctccagc	CRISPR spacer
ggaatttaaactgcttgtaaaatctccagc	Protospacer
*.****.***********************

30. spacer 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 2, identity: 0.933

gaaattcaaactgcttgtaaaatctccagc	CRISPR spacer
gaaattcaaactgcttataaaatctccaac	Protospacer
****************.***********.*

31. spacer 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MH853355 (Streptococcus phage LF1, complete genome) position: , mismatch: 2, identity: 0.933

gaaattcaaactgcttgtaaaatctccagc	CRISPR spacer
ggaatttaaactgcttgtaaaatctccagc	Protospacer
*.****.***********************

32. spacer 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MH853358 (Streptococcus phage LF4, complete genome) position: , mismatch: 2, identity: 0.933

gaaattcaaactgcttgtaaaatctccagc	CRISPR spacer
ggaatttaaactgcttgtaaaatctccagc	Protospacer
*.****.***********************

33. spacer 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to AJ609634 (Bacteriophage EJ-1 proviral DNA, complete genome) position: , mismatch: 3, identity: 0.9

gaagtaaaagatatttatgcagaagtgatt	CRISPR spacer
gaagtgaaagatatttatgcagaagttatc	Protospacer
*****.******************** **.

34. spacer 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to NC_005294 (Streptococcus prophage EJ-1, complete genome) position: , mismatch: 3, identity: 0.9

gaagtaaaagatatttatgcagaagtgatt	CRISPR spacer
gaagtgaaagatatttatgcagaagttatc	Protospacer
*****.******************** **.

35. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448859 (Streptococcus phage Javan170, complete genome) position: , mismatch: 3, identity: 0.9

atagtcatccatcataacgactggtgtgat	CRISPR spacer
gtagtcatccatcataataactggtgtgat	Protospacer
.****************..***********

36. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448690 (Streptococcus phage Javan169, complete genome) position: , mismatch: 3, identity: 0.9

atagtcatccatcataacgactggtgtgat	CRISPR spacer
gtagtcatccatcataataactggtgtgat	Protospacer
.****************..***********

37. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448850 (Streptococcus phage Javan132, complete genome) position: , mismatch: 3, identity: 0.9

atagtcatccatcataacgactggtgtgat	CRISPR spacer
gtagtcatccatcataataactggtgtgat	Protospacer
.****************..***********

38. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448676 (Streptococcus phage Javan131, complete genome) position: , mismatch: 3, identity: 0.9

atagtcatccatcataacgactggtgtgat	CRISPR spacer
gtagtcatccatcataataactggtgtgat	Protospacer
.****************..***********

39. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448688 (Streptococcus phage Javan161, complete genome) position: , mismatch: 3, identity: 0.9

atagtcatccatcataacgactggtgtgat	CRISPR spacer
gtagtcatccatcataataactggtgtgat	Protospacer
.****************..***********

40. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 3, identity: 0.9

atagtcatccatcataacgactggtgtgat	CRISPR spacer
aaaatcatccatcataacaactggtgtgat	Protospacer
* *.**************.***********

41. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448955 (Streptococcus phage Javan478, complete genome) position: , mismatch: 3, identity: 0.9

atagtcatccatcataacgactggtgtgat	CRISPR spacer
aaaatcatccatcataacaactggtgtgat	Protospacer
* *.**************.***********

42. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 3, identity: 0.9

atagtcatccatcataacgactggtgtgat	CRISPR spacer
aaaatcatccatcataacaactggtgtgat	Protospacer
* *.**************.***********

43. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448962 (Streptococcus phage Javan496, complete genome) position: , mismatch: 3, identity: 0.9

atagtcatccatcataacgactggtgtgat	CRISPR spacer
aaaatcatccatcataacaactggtgtgat	Protospacer
* *.**************.***********

44. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448975 (Streptococcus phage Javan526, complete genome) position: , mismatch: 3, identity: 0.9

atagtcatccatcataacgactggtgtgat	CRISPR spacer
aaaatcatccatcataacaactggtgtgat	Protospacer
* *.**************.***********

45. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448782 (Streptococcus phage Javan501, complete genome) position: , mismatch: 3, identity: 0.9

atagtcatccatcataacgactggtgtgat	CRISPR spacer
aaaatcatccatcataacaactggtgtgat	Protospacer
* *.**************.***********

46. spacer 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 3, identity: 0.9

gaaattcaaactgcttgtaaaatctccagc	CRISPR spacer
ggaatttaaactgcttataaaatctccagc	Protospacer
*.****.*********.*************

47. spacer 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 3, identity: 0.9

gaaattcaaactgcttgtaaaatctccagc	CRISPR spacer
ggaatttaaactgcttataaaatctccagc	Protospacer
*.****.*********.*************

48. spacer 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 3, identity: 0.9

gaaattcaaactgcttgtaaaatctccagc	CRISPR spacer
gaaattcaaattgcttataaaatctccaac	Protospacer
**********.*****.***********.*

49. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to KC465899 (Pelagibacter phage HTVC008M, complete genome) position: , mismatch: 4, identity: 0.867

aaatgttcttttttaaaatctttcatgttc-	CRISPR spacer
aaatctacttttttaaaatcttt-atattca	Protospacer
**** * **************** **.*** 

50. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 4, identity: 0.867

atagtcatccatcataacgactggtgtgat	CRISPR spacer
aaaatcatccatcataataactggtgtgat	Protospacer
* *.*************..***********

51. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 4, identity: 0.867

atagtcatccatcataacgactggtgtgat	CRISPR spacer
aaaatcatccatcataataactggtgtgat	Protospacer
* *.*************..***********

52. spacer 1.11|70234|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 4, identity: 0.867

atagtcatccatcataacgactggtgtgat	CRISPR spacer
aaaatcatccatcataataactggtgtgat	Protospacer
* *.*************..***********

53. spacer 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 4, identity: 0.867

gaaattcaaactgcttgtaaaatctccagc	CRISPR spacer
ggaatttaaactgcttataaaatctccaac	Protospacer
*.****.*********.***********.*

54. spacer 1.12|70300|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 4, identity: 0.867

gaaattcaaactgcttgtaaaatctccagc	CRISPR spacer
ggaatttaaactgcttataaaatctccaac	Protospacer
*.****.*********.***********.*

55. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MN693096 (Marine virus AFVG_25M80, complete genome) position: , mismatch: 5, identity: 0.833

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
acaagaaacaacaaatgattttgtaccaac	Protospacer
*. ** * ******************** *

56. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP035396 (Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
ccaagttcttttttaaaatcattcatgtgt	Protospacer
  * **************** ******* .

57. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP032856 (Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
ccaagttcttttttaaaatcattcatgtgt	Protospacer
  * **************** ******* .

58. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 6, identity: 0.8

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttaaaatctttcaccccc	Protospacer
.** *********************. ..*

59. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 6, identity: 0.8

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttaaaatctttcaccccc	Protospacer
.** *********************. ..*

60. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to MT074138 (Bacteroides phage DAC17, complete genome) position: , mismatch: 6, identity: 0.8

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
atatgttcttttttaaagtcttgcattgtt	Protospacer
* ***************.**** ***  *.

61. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to MT074136 (Bacteroides phage DAC15, complete genome) position: , mismatch: 6, identity: 0.8

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
atatgttcttttttaaagtcttgcattgtt	Protospacer
* ***************.**** ***  *.

62. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP046030 (Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

---aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gctaaa---tcttttctaaaatctttcatggtg	Protospacer
   ***   ******.************** * 

63. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to AP014166 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C61-MedDCM-OCT-S46-C82, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
aaatcttcttttttagaatctttaacttta	Protospacer
**** **********.******* *. ** 

64. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to AP014287 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S24-C25, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

agctctaaatcaacatatccatcaacttca	CRISPR spacer
accttgaaatcaacatctccatcaactttg	Protospacer
* **. ********** ***********..

65. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448932 (Streptococcus phage Javan42, complete genome) position: , mismatch: 7, identity: 0.767

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
ccaacttccagaaaatgattttgtaccatc	Protospacer
 . * * ***. ******************

66. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 7, identity: 0.767

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
ccaacttccagaaaatgattttgtaccatc	Protospacer
 . * * ***. ******************

67. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448669 (Streptococcus phage Javan11, complete genome) position: , mismatch: 7, identity: 0.767

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
ccaacttccagaaaatgattttgtaccatc	Protospacer
 . * * ***. ******************

68. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448708 (Streptococcus phage Javan23, complete genome) position: , mismatch: 7, identity: 0.767

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
ccaacttccagaaaatgattttgtaccatc	Protospacer
 . * * ***. ******************

69. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK448897 (Streptococcus phage Javan28, complete genome) position: , mismatch: 7, identity: 0.767

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
ccaacttccagaaaatgattttgtaccatc	Protospacer
 . * * ***. ******************

70. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_KR091915 (Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

71. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP025915 (Escherichia coli strain 203740 plasmid p203740_35, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

72. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_LS999564 (Escherichia coli isolate EC-TO143 plasmid 5, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

73. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_LN824136 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

74. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP054370 (Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

75. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP006640 (Escherichia coli PCN061 plasmid PCN061p4, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

76. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP029801 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

77. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP015505 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

78. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP026060 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

79. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP024853 (Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

80. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

81. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP028999 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

82. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP027258 (Escherichia coli strain EC11 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

83. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP019200 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

84. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP023823 (Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

85. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

86. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP018988 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

87. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_MK033500 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

88. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_MK033501 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

89. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gaaggttcttttttgaaatctttcaccccc	Protospacer
.** **********.**********. ..*

90. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to MN693256 (Marine virus AFVG_25M339, complete genome) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
tcttcttctttttttaaatctttcatgctg	Protospacer
   * ********* ************.* 

91. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_LR215001 (Mycoplasma conjunctivae strain NCTC10147 plasmid 5) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
aaatgctcttttttaaaatttttatcttcc	Protospacer
*****.*************.***  . *.*

92. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to MN855807 (Siphoviridae sp. isolate 122, partial genome) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
tagtaatcttttttaatatctttcatggtg	Protospacer
 *.*. ********** ********** * 

93. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to FJ429185 (Lactococcus phage P087, complete genome) position: , mismatch: 7, identity: 0.767

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
tagtaatcttttttaatatctttcatggtg	Protospacer
 *.*. ********** ********** * 

94. spacer 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MT778840 (Rhizobium phage P11VFA, complete genome) position: , mismatch: 7, identity: 0.767

tacggtggacaagctaacccacaagaaact	CRISPR spacer
caacgtggacaagctcacccacaagaacga	Protospacer
.*  *********** ***********   

95. spacer 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to KF614509 (Rhizobium phage vB_RleS_L338C, complete genome) position: , mismatch: 7, identity: 0.767

tacggtggacaagctaacccacaagaaact	CRISPR spacer
caacgtggacaagctcacccacaagaacga	Protospacer
.*  *********** ***********   

96. spacer 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MF417890 (Uncultured Caudovirales phage clone 7F_15, partial genome) position: , mismatch: 7, identity: 0.767

tacggtggacaagctaacccacaagaaact	CRISPR spacer
caaagtggacaagctaagccacaacaagca	Protospacer
.* .************* ****** **.* 

97. spacer 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MF417953 (Uncultured Caudovirales phage clone 7S_15, partial genome) position: , mismatch: 7, identity: 0.767

tacggtggacaagctaacccacaagaaact	CRISPR spacer
caaagtggacaagctaagccacaacaagca	Protospacer
.* .************* ****** **.* 

98. spacer 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to GU557055 (Puniceispirillum phage HMO-2011, complete genome) position: , mismatch: 7, identity: 0.767

tacggtggacaagctaacccacaagaaact	CRISPR spacer
tacggtggacaatctaacccattggtaaga	Protospacer
************ ********. .* **  

99. spacer 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP044019 (Acinetobacter indicus strain HY20 plasmid pAI01, complete sequence) position: , mismatch: 7, identity: 0.767

gaagtaaaagatatttatgcagaagtgatt	CRISPR spacer
caggtaaatgatatttatgcacaagtagct	Protospacer
 *.***** ************ ****...*

100. spacer 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MN855940 (Myoviridae sp. isolate 64, complete genome) position: , mismatch: 7, identity: 0.767

gaagtaaaagatatttatgcagaagtgatt	CRISPR spacer
gaagtaaaagagatttatggagagtgggct	Protospacer
*********** ******* ***.  *..*

101. spacer 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to CAJCJZ010000002 (Enterococcus phage vB_EfaS_140 genome assembly, contig: phage140-genome, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.767

gaagtaaaagatatttatgcagaagtgatt	CRISPR spacer
aaactaaaagatatttatgcacaattagtc	Protospacer
.** ***************** ** *..*.

102. spacer 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MT119360 (Enterococcus phage nattely, complete genome) position: , mismatch: 7, identity: 0.767

gaagtaaaagatatttatgcagaagtgatt	CRISPR spacer
aaactaaaagatatttatgcacaattagta	Protospacer
.** ***************** ** *..* 

103. spacer 1.7|69970|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP028120 (Escherichia coli O43 str. RM10042 plasmid pRM10042-1, complete sequence) position: , mismatch: 7, identity: 0.767

tccgcaagatgaaacagatatctctttaaa	CRISPR spacer
tccgcaatatgatacagatatctctgcccg	Protospacer
******* **** ************ .  .

104. spacer 1.7|69970|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP033633 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb2, complete sequence) position: , mismatch: 7, identity: 0.767

tccgcaagatgaaacagatatctctttaaa	CRISPR spacer
tccgcaatatgatacagatatctctgcccg	Protospacer
******* **** ************ .  .

105. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to NC_012530 (Lactobacillus phage Lb338-1, complete genome) position: , mismatch: 7, identity: 0.767

agctctaaatcaacatatccatcaacttca	CRISPR spacer
gttcctaaaacaacatatccatcaacctga	Protospacer
. ..***** ****************.* *

106. spacer 1.13|70366|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to NC_004534 (Corynebacterium glutamicum plasmid pCG2, complete sequence) position: , mismatch: 7, identity: 0.767

catacatgtatgtaagtggtaagagttttt	CRISPR spacer
catacatgtatgtaagtggtaaaacaccag	Protospacer
**********************.*  ..  

107. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK250021 (Prevotella phage Lak-B2, complete genome) position: , mismatch: 8, identity: 0.733

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtaacaacaaataattttggagacaa	Protospacer
******* ********.****** *     

108. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK250024 (Prevotella phage Lak-B5, complete genome) position: , mismatch: 8, identity: 0.733

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtaacaacaaataattttggagacaa	Protospacer
******* ********.****** *     

109. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK250028 (Prevotella phage Lak-B9, complete genome) position: , mismatch: 8, identity: 0.733

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtaacaacaaataattttggagacaa	Protospacer
******* ********.****** *     

110. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 8, identity: 0.733

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtaacaacaaataattttggagacaa	Protospacer
******* ********.****** *     

111. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK250025 (Prevotella phage Lak-B6, complete genome) position: , mismatch: 8, identity: 0.733

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtaacaacaaataattttggagacaa	Protospacer
******* ********.****** *     

112. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK250022 (Prevotella phage Lak-B3, complete genome) position: , mismatch: 8, identity: 0.733

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtaacaacaaataattttggagacaa	Protospacer
******* ********.****** *     

113. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 8, identity: 0.733

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtaacaacaaataattttggagacaa	Protospacer
******* ********.****** *     

114. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 8, identity: 0.733

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtaacaacaaataattttggagacaa	Protospacer
******* ********.****** *     

115. spacer 1.1|69574|30|NZ_ANDC01000023|CRT matches to MK250020 (Prevotella phage Lak-B1, complete genome) position: , mismatch: 8, identity: 0.733

atcagtaccaacaaatgattttgtaccatc	CRISPR spacer
atcagtaacaacaaataattttggagacaa	Protospacer
******* ********.****** *     

116. spacer 1.2|69640|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 8, identity: 0.733

tcagcattcggcattgatattttcccctct	CRISPR spacer
cgcgccttcggcattgatattttcatagct	Protospacer
.  ** ****************** .  **

117. spacer 1.2|69640|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 8, identity: 0.733

tcagcattcggcattgatattttcccctct	CRISPR spacer
cgcgccttcggcattgatattttcatagct	Protospacer
.  ** ****************** .  **

118. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP039286 (Leptospira interrogans strain FMAS_AW1 plasmid pLiSL3, complete sequence) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
aaatgttcttttttaaattctactagtata	Protospacer
***************** *** ..*   * 

119. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP012103 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-4, complete sequence) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
cgacctcattttttaaaatctttgatgttt	Protospacer
 .*. *. *************** *****.

120. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_LR214953 (Mycoplasma neurolyticum strain NCTC10166 plasmid 3) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
aaatgttgttttttaaaatttttatcaatt	Protospacer
******* ***********.***  .. *.

121. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP009352 (Francisella tularensis subsp. novicida F6168 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
ctattctcttttttaaaatcgttcatgcaa	Protospacer
  ** .************** ******.  

122. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NZ_CP051681 (Cohnella sp. MFER-1 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
accgtttctttttcaaaatcgttcatgtga	Protospacer
*    ********.****** *******  

123. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NC_004952 (Francisella novicida plasmid pFNL10, complete sequence) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
ctattctcttttttaaaatcgttcatgcaa	Protospacer
  ** .************** ******.  

124. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NC_002109 (Francisella tularensis plasmid pOM1, complete sequence) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
ctattctcttttttaaaatcgttcatgcaa	Protospacer
  ** .************** ******.  

125. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to LC494302 (Escherichia phage SP27 DNA, complete genome) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
ttctgttcttttttcaaagctttcatatga	Protospacer
   *********** *** *******.*  

126. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to MK817115 (Escherichia phage vB_EcoM_phAPEC6, complete genome) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
ttctgttcttttttcaaagctttcatatga	Protospacer
   *********** *** *******.*  

127. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to NC_027364 (Escherichia phage PBECO 4, complete genome) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
ttctgttcttttttcaaagctttcatatga	Protospacer
   *********** *** *******.*  

128. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to MH383160 (Escherichia phage UB, complete genome) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
ttctgttcttttttcaaagctttcatatga	Protospacer
   *********** *** *******.*  

129. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to MK327931 (Escherichia phage vB_EcoM_G17, complete genome) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
ttctgttcttttttcaaagctttcatatga	Protospacer
   *********** *** *******.*  

130. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to MN871445 (UNVERIFIED: Serratia phage KpHz_2, complete genome) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
aaatgttctttttttaaatctaagaggaat	Protospacer
************** ******   * *  .

131. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
tagatttcttttttaaaatcttttataaac	Protospacer
 *.  ******************.**.  *

132. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to MN871444 (UNVERIFIED: Serratia phage KpGz_1, complete genome) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
aaatgttctttttttaaatctaagaggaat	Protospacer
************** ******   * *  .

133. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to MN693101 (Marine virus AFVG_25M559, complete genome) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
caatgttcttttttaaattcttctactctt	Protospacer
 **************** ****..*. .*.

134. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to KT725776 (Bacillus phage vB_BceS-MY192, partial genome) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
ccttgttcttttttaaaatcaatcatccac	Protospacer
   *****************  **** . *

135. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to LT603033 (Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
ttctgttcttttttcaaagctttcatatga	Protospacer
   *********** *** *******.*  

136. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 8, identity: 0.733

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
ttctgttcttttttcaaagctttcatatga	Protospacer
   *********** *** *******.*  

137. spacer 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to NC_008201 (Mannheimia phage phiMHaA1, complete genome) position: , mismatch: 8, identity: 0.733

tacggtggacaagctaacccacaagaaact	CRISPR spacer
cacggtggacgagctaacccacgatggccc	Protospacer
.*********.***********.* .. *.

138. spacer 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to DQ426905 (Bacteriophage phi-MhaA1-BAA410, complete genome) position: , mismatch: 8, identity: 0.733

tacggtggacaagctaacccacaagaaact	CRISPR spacer
cacggtggacgagctaacccacgatggccc	Protospacer
.*********.***********.* .. *.

139. spacer 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to KP137432 (Mannheimia phage vB_MhM_535AP1, complete genome) position: , mismatch: 8, identity: 0.733

tacggtggacaagctaacccacaagaaact	CRISPR spacer
cacggtggacgagctaacccacgatggccc	Protospacer
.*********.***********.* .. *.

140. spacer 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to JN255163 (Mannheimia phage vB_MhM_1152AP, complete genome) position: , mismatch: 8, identity: 0.733

tacggtggacaagctaacccacaagaaact	CRISPR spacer
cacggtggacgagctaacccacgatggccc	Protospacer
.*********.***********.* .. *.

141. spacer 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to KP137438 (Mannheimia phage vB_MhM_2256AP1, complete genome) position: , mismatch: 8, identity: 0.733

tacggtggacaagctaacccacaagaaact	CRISPR spacer
cacggtggacgagctaacccacgatggccc	Protospacer
.*********.***********.* .. *.

142. spacer 1.4|69772|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to DQ426904 (Bacteriophage phi-MhaA1-PHL101, complete genome) position: , mismatch: 8, identity: 0.733

tacggtggacaagctaacccacaagaaact	CRISPR spacer
cacggtggacgagctaacccacgatggccc	Protospacer
.*********.***********.* .. *.

143. spacer 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK448665 (Streptococcus phage Javan1, complete genome) position: , mismatch: 8, identity: 0.733

gaagtaaaagatatttatgcagaagtgatt	CRISPR spacer
gaagtaaaagttatttttgcagaacctgca	Protospacer
********** ***** ******* . .. 

144. spacer 1.6|69904|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP053834 (Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence) position: , mismatch: 8, identity: 0.733

gaagtaaaagatatttatgcagaagtgatt	CRISPR spacer
tatacaaaagatattgatgcagaagttaaa	Protospacer
 * ..********** ********** *  

145. spacer 1.7|69970|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to NC_014502 (Gloeothece verrucosa PCC 7822 plasmid Cy782203, complete sequence) position: , mismatch: 8, identity: 0.733

tccgcaagatgaaacagatatctctttaaa	CRISPR spacer
gtttctcgatgaaaccgatatctttttaaa	Protospacer
 .. *  ******** *******.******

146. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MN871480 (UNVERIFIED: Pseudomonas phage PaSz-1_45_270k, complete genome) position: , mismatch: 8, identity: 0.733

agctctaaatcaacatatccatcaacttca	CRISPR spacer
ttataagaaccaccatatccatcaacttca	Protospacer
   *  .**.** *****************

147. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MT001829 (Salmonella phage SE_PL, complete genome) position: , mismatch: 8, identity: 0.733

agctctaaatcaacatatccatcaacttca	CRISPR spacer
gaatgtaaatcatcatatctatcaactttt	Protospacer
.. * ******* ******.********. 

148. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to DI373487 (KR 1020130142837-A/1: Bacteriophage of Pseudomonas aeruginosa and uses thereof) position: , mismatch: 8, identity: 0.733

agctctaaatcaacatatccatcaacttca	CRISPR spacer
ttataagaaccaccatatccatcaacttca	Protospacer
   *  .**.** *****************

149. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK773491 (Salmonella phage 7t3, complete genome) position: , mismatch: 8, identity: 0.733

agctctaaatcaacatatccatcaacttca	CRISPR spacer
gaatgtaaatcatcatatctatcaactttt	Protospacer
.. * ******* ******.********. 

150. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MN871489 (UNVERIFIED: Pseudomonas phage PaZh_1, complete genome) position: , mismatch: 8, identity: 0.733

agctctaaatcaacatatccatcaacttca	CRISPR spacer
ttataagaaccaccatatccatcaacttca	Protospacer
   *  .**.** *****************

151. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to NC_042081 (Pseudomonas phage SL2, complete genome) position: , mismatch: 8, identity: 0.733

agctctaaatcaacatatccatcaacttca	CRISPR spacer
ttataagaaccaccatatccatcaacttca	Protospacer
   *  .**.** *****************

152. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to MK268344 (Salmonella phage Munch, complete genome) position: , mismatch: 8, identity: 0.733

agctctaaatcaacatatccatcaacttca	CRISPR spacer
gaatgtaaatcatcatatctatcaactttt	Protospacer
.. * ******* ******.********. 

153. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to NC_042060 (Pseudomonas phage PA7, partial genome) position: , mismatch: 8, identity: 0.733

agctctaaatcaacatatccatcaacttca	CRISPR spacer
ttataagaaccaccatatccatcaacttca	Protospacer
   *  .**.** *****************

154. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to NC_004629 (Pseudomonas phage phiKZ, complete genome) position: , mismatch: 8, identity: 0.733

agctctaaatcaacatatccatcaacttca	CRISPR spacer
ttataagaaccaccatatccatcaacttca	Protospacer
   *  .**.** *****************

155. spacer 1.3|69706|30|NZ_ANDC01000023|CRT,CRISPRCasFinder matches to HQ683709 (Planktothrix phage PaV-LD, complete genome) position: , mismatch: 9, identity: 0.7

aaatgttcttttttaaaatctttcatgttc	CRISPR spacer
gccaattctttgttaaaatctgtcatgtgg	Protospacer
.   .****** ********* ******  

156. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP046044 (Acinetobacter towneri strain 19110F47 plasmid p19110F47-2, complete sequence) position: , mismatch: 9, identity: 0.7

agctctaaatcaacatatccatcaacttca	CRISPR spacer
ttgctgaaatcaacatatccatgagcttct	Protospacer
   .. **************** *.**** 

157. spacer 1.9|70102|30|NZ_ANDC01000023|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP048015 (Acinetobacter towneri strain 205 plasmid pAT205, complete sequence) position: , mismatch: 9, identity: 0.7

agctctaaatcaacatatccatcaacttca	CRISPR spacer
ttgctgaaatcaacatatccatgagcttct	Protospacer
   .. **************** *.**** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ANDC01000015
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ANDC01000015_1 196396-197693 Orphan NA
20 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 101169 : 111441 9 Streptococcus_phage(57.14%) NA NA
DBSCAN-SWA_2 287591 : 298324 16 Streptococcus_phage(84.62%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ANDC01000022
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ANDC01000022_1 101121-101196 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ANDC01000018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 42737 : 54802 8 Synechococcus_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ANDC01000021
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 39686 : 46890 8 Streptococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage