Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALUI01000090 Streptococcus agalactiae GB00897 ctg7180000002909, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000188 Streptococcus agalactiae GB00897 ctg7180000003007, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000253 Streptococcus agalactiae GB00897 ctg7180000003072, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000034 Streptococcus agalactiae GB00897 ctg7180000002653, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000219 Streptococcus agalactiae GB00897 ctg7180000003038, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000031 Streptococcus agalactiae GB00897 ctg7180000002640, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000092 Streptococcus agalactiae GB00897 ctg7180000002911, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000062 Streptococcus agalactiae GB00897 ctg7180000002881, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000107 Streptococcus agalactiae GB00897 ctg7180000002926, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000173 Streptococcus agalactiae GB00897 ctg7180000002992, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000166 Streptococcus agalactiae GB00897 ctg7180000002985, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000209 Streptococcus agalactiae GB00897 ctg7180000003028, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000161 Streptococcus agalactiae GB00897 ctg7180000002980, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000027 Streptococcus agalactiae GB00897 ctg7180000002623, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000168 Streptococcus agalactiae GB00897 ctg7180000002987, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000057 Streptococcus agalactiae GB00897 ctg7180000002876, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000156 Streptococcus agalactiae GB00897 ctg7180000002975, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000079 Streptococcus agalactiae GB00897 ctg7180000002898, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000252 Streptococcus agalactiae GB00897 ctg7180000003071, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000058 Streptococcus agalactiae GB00897 ctg7180000002877, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000131 Streptococcus agalactiae GB00897 ctg7180000002950, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000277 Streptococcus agalactiae GB00897 ctg7180000003096, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000255 Streptococcus agalactiae GB00897 ctg7180000003074, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000064 Streptococcus agalactiae GB00897 ctg7180000002883, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000101 Streptococcus agalactiae GB00897 ctg7180000002920, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000227 Streptococcus agalactiae GB00897 ctg7180000003046, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000153 Streptococcus agalactiae GB00897 ctg7180000002972, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000229 Streptococcus agalactiae GB00897 ctg7180000003048, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000216 Streptococcus agalactiae GB00897 ctg7180000003035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000185 Streptococcus agalactiae GB00897 ctg7180000003004, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000046 Streptococcus agalactiae GB00897 ctg7180000002865, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000076 Streptococcus agalactiae GB00897 ctg7180000002895, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000102 Streptococcus agalactiae GB00897 ctg7180000002921, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000280 Streptococcus agalactiae GB00897 ctg7180000003099, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000008 Streptococcus agalactiae GB00897 ctg7180000002590, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000041 Streptococcus agalactiae GB00897 ctg7180000002860, whole genome shotgun sequence 1 crisprs cas1,cas2 0 0 0 0
NZ_ALUI01000223 Streptococcus agalactiae GB00897 ctg7180000003042, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000126 Streptococcus agalactiae GB00897 ctg7180000002945, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000279 Streptococcus agalactiae GB00897 ctg7180000003098, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000180 Streptococcus agalactiae GB00897 ctg7180000002999, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000049 Streptococcus agalactiae GB00897 ctg7180000002868, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALUI01000033 Streptococcus agalactiae GB00897 ctg7180000002650, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000234 Streptococcus agalactiae GB00897 ctg7180000003053, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000249 Streptococcus agalactiae GB00897 ctg7180000003068, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000239 Streptococcus agalactiae GB00897 ctg7180000003058, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000225 Streptococcus agalactiae GB00897 ctg7180000003044, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000117 Streptococcus agalactiae GB00897 ctg7180000002936, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000228 Streptococcus agalactiae GB00897 ctg7180000003047, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000274 Streptococcus agalactiae GB00897 ctg7180000003093, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000050 Streptococcus agalactiae GB00897 ctg7180000002869, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000139 Streptococcus agalactiae GB00897 ctg7180000002958, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000172 Streptococcus agalactiae GB00897 ctg7180000002991, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000044 Streptococcus agalactiae GB00897 ctg7180000002863, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000250 Streptococcus agalactiae GB00897 ctg7180000003069, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000081 Streptococcus agalactiae GB00897 ctg7180000002900, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000001 Streptococcus agalactiae GB00897 ctg7180000002575, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000137 Streptococcus agalactiae GB00897 ctg7180000002956, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000204 Streptococcus agalactiae GB00897 ctg7180000003023, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000002 Streptococcus agalactiae GB00897 ctg7180000002579, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000194 Streptococcus agalactiae GB00897 ctg7180000003013, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000246 Streptococcus agalactiae GB00897 ctg7180000003065, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000118 Streptococcus agalactiae GB00897 ctg7180000002937, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000140 Streptococcus agalactiae GB00897 ctg7180000002959, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000198 Streptococcus agalactiae GB00897 ctg7180000003017, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000276 Streptococcus agalactiae GB00897 ctg7180000003095, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000206 Streptococcus agalactiae GB00897 ctg7180000003025, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000010 Streptococcus agalactiae GB00897 ctg7180000002592, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000196 Streptococcus agalactiae GB00897 ctg7180000003015, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000247 Streptococcus agalactiae GB00897 ctg7180000003066, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000241 Streptococcus agalactiae GB00897 ctg7180000003060, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALUI01000251 Streptococcus agalactiae GB00897 ctg7180000003070, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000085 Streptococcus agalactiae GB00897 ctg7180000002904, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000098 Streptococcus agalactiae GB00897 ctg7180000002917, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000182 Streptococcus agalactiae GB00897 ctg7180000003001, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_ALUI01000167 Streptococcus agalactiae GB00897 ctg7180000002986, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000130 Streptococcus agalactiae GB00897 ctg7180000002949, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000028 Streptococcus agalactiae GB00897 ctg7180000002625, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000254 Streptococcus agalactiae GB00897 ctg7180000003073, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000242 Streptococcus agalactiae GB00897 ctg7180000003061, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALUI01000110 Streptococcus agalactiae GB00897 ctg7180000002929, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000236 Streptococcus agalactiae GB00897 ctg7180000003055, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000019 Streptococcus agalactiae GB00897 ctg7180000002608, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000149 Streptococcus agalactiae GB00897 ctg7180000002968, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000077 Streptococcus agalactiae GB00897 ctg7180000002896, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000169 Streptococcus agalactiae GB00897 ctg7180000002988, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000037 Streptococcus agalactiae GB00897 ctg7180000002832, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000024 Streptococcus agalactiae GB00897 ctg7180000002616, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000177 Streptococcus agalactiae GB00897 ctg7180000002996, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000189 Streptococcus agalactiae GB00897 ctg7180000003008, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000208 Streptococcus agalactiae GB00897 ctg7180000003027, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000020 Streptococcus agalactiae GB00897 ctg7180000002610, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000074 Streptococcus agalactiae GB00897 ctg7180000002893, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000030 Streptococcus agalactiae GB00897 ctg7180000002632, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000201 Streptococcus agalactiae GB00897 ctg7180000003020, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000143 Streptococcus agalactiae GB00897 ctg7180000002962, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALUI01000174 Streptococcus agalactiae GB00897 ctg7180000002993, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000199 Streptococcus agalactiae GB00897 ctg7180000003018, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000089 Streptococcus agalactiae GB00897 ctg7180000002908, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000136 Streptococcus agalactiae GB00897 ctg7180000002955, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000066 Streptococcus agalactiae GB00897 ctg7180000002885, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000205 Streptococcus agalactiae GB00897 ctg7180000003024, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000134 Streptococcus agalactiae GB00897 ctg7180000002953, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000114 Streptococcus agalactiae GB00897 ctg7180000002933, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000082 Streptococcus agalactiae GB00897 ctg7180000002901, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000186 Streptococcus agalactiae GB00897 ctg7180000003005, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000071 Streptococcus agalactiae GB00897 ctg7180000002890, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000059 Streptococcus agalactiae GB00897 ctg7180000002878, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000054 Streptococcus agalactiae GB00897 ctg7180000002873, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000100 Streptococcus agalactiae GB00897 ctg7180000002919, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000080 Streptococcus agalactiae GB00897 ctg7180000002899, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000266 Streptococcus agalactiae GB00897 ctg7180000003085, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000238 Streptococcus agalactiae GB00897 ctg7180000003057, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000045 Streptococcus agalactiae GB00897 ctg7180000002864, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALUI01000124 Streptococcus agalactiae GB00897 ctg7180000002943, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000088 Streptococcus agalactiae GB00897 ctg7180000002907, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000207 Streptococcus agalactiae GB00897 ctg7180000003026, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000151 Streptococcus agalactiae GB00897 ctg7180000002970, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000195 Streptococcus agalactiae GB00897 ctg7180000003014, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000273 Streptococcus agalactiae GB00897 ctg7180000003092, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000043 Streptococcus agalactiae GB00897 ctg7180000002862, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000067 Streptococcus agalactiae GB00897 ctg7180000002886, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000164 Streptococcus agalactiae GB00897 ctg7180000002983, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000265 Streptococcus agalactiae GB00897 ctg7180000003084, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000218 Streptococcus agalactiae GB00897 ctg7180000003037, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000145 Streptococcus agalactiae GB00897 ctg7180000002964, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000230 Streptococcus agalactiae GB00897 ctg7180000003049, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000221 Streptococcus agalactiae GB00897 ctg7180000003040, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000154 Streptococcus agalactiae GB00897 ctg7180000002973, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000232 Streptococcus agalactiae GB00897 ctg7180000003051, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000065 Streptococcus agalactiae GB00897 ctg7180000002884, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000105 Streptococcus agalactiae GB00897 ctg7180000002924, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000016 Streptococcus agalactiae GB00897 ctg7180000002602, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000048 Streptococcus agalactiae GB00897 ctg7180000002867, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000160 Streptococcus agalactiae GB00897 ctg7180000002979, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000021 Streptococcus agalactiae GB00897 ctg7180000002611, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000222 Streptococcus agalactiae GB00897 ctg7180000003041, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000032 Streptococcus agalactiae GB00897 ctg7180000002647, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000157 Streptococcus agalactiae GB00897 ctg7180000002976, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000026 Streptococcus agalactiae GB00897 ctg7180000002620, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000006 Streptococcus agalactiae GB00897 ctg7180000002587, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000226 Streptococcus agalactiae GB00897 ctg7180000003045, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000270 Streptococcus agalactiae GB00897 ctg7180000003089, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000269 Streptococcus agalactiae GB00897 ctg7180000003088, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000022 Streptococcus agalactiae GB00897 ctg7180000002614, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000211 Streptococcus agalactiae GB00897 ctg7180000003030, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000175 Streptococcus agalactiae GB00897 ctg7180000002994, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000244 Streptococcus agalactiae GB00897 ctg7180000003063, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000283 Streptococcus agalactiae GB00897 ctg7180000003102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000119 Streptococcus agalactiae GB00897 ctg7180000002938, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000075 Streptococcus agalactiae GB00897 ctg7180000002894, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALUI01000095 Streptococcus agalactiae GB00897 ctg7180000002914, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000055 Streptococcus agalactiae GB00897 ctg7180000002874, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALUI01000017 Streptococcus agalactiae GB00897 ctg7180000002603, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000258 Streptococcus agalactiae GB00897 ctg7180000003077, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000183 Streptococcus agalactiae GB00897 ctg7180000003002, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000224 Streptococcus agalactiae GB00897 ctg7180000003043, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000282 Streptococcus agalactiae GB00897 ctg7180000003101, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000171 Streptococcus agalactiae GB00897 ctg7180000002990, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000007 Streptococcus agalactiae GB00897 ctg7180000002589, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000106 Streptococcus agalactiae GB00897 ctg7180000002925, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000210 Streptococcus agalactiae GB00897 ctg7180000003029, whole genome shotgun sequence 1 crisprs NA 3 1 0 0
NZ_ALUI01000155 Streptococcus agalactiae GB00897 ctg7180000002974, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000035 Streptococcus agalactiae GB00897 ctg7180000002665, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000084 Streptococcus agalactiae GB00897 ctg7180000002903, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000281 Streptococcus agalactiae GB00897 ctg7180000003100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000284 Streptococcus agalactiae GB00897 ctg7180000003103, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000104 Streptococcus agalactiae GB00897 ctg7180000002923, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000132 Streptococcus agalactiae GB00897 ctg7180000002951, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000013 Streptococcus agalactiae GB00897 ctg7180000002597, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000091 Streptococcus agalactiae GB00897 ctg7180000002910, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000096 Streptococcus agalactiae GB00897 ctg7180000002915, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000086 Streptococcus agalactiae GB00897 ctg7180000002905, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000248 Streptococcus agalactiae GB00897 ctg7180000003067, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000003 Streptococcus agalactiae GB00897 ctg7180000002582, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000179 Streptococcus agalactiae GB00897 ctg7180000002998, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000159 Streptococcus agalactiae GB00897 ctg7180000002978, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000115 Streptococcus agalactiae GB00897 ctg7180000002934, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000190 Streptococcus agalactiae GB00897 ctg7180000003009, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000009 Streptococcus agalactiae GB00897 ctg7180000002591, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000187 Streptococcus agalactiae GB00897 ctg7180000003006, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000245 Streptococcus agalactiae GB00897 ctg7180000003064, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000116 Streptococcus agalactiae GB00897 ctg7180000002935, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000070 Streptococcus agalactiae GB00897 ctg7180000002889, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000072 Streptococcus agalactiae GB00897 ctg7180000002891, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000040 Streptococcus agalactiae GB00897 ctg7180000002859, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000005 Streptococcus agalactiae GB00897 ctg7180000002585, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000052 Streptococcus agalactiae GB00897 ctg7180000002871, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALUI01000144 Streptococcus agalactiae GB00897 ctg7180000002963, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000128 Streptococcus agalactiae GB00897 ctg7180000002947, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000029 Streptococcus agalactiae GB00897 ctg7180000002631, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000018 Streptococcus agalactiae GB00897 ctg7180000002605, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALUI01000257 Streptococcus agalactiae GB00897 ctg7180000003076, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000025 Streptococcus agalactiae GB00897 ctg7180000002617, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000113 Streptococcus agalactiae GB00897 ctg7180000002932, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000112 Streptococcus agalactiae GB00897 ctg7180000002931, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000004 Streptococcus agalactiae GB00897 ctg7180000002583, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000147 Streptococcus agalactiae GB00897 ctg7180000002966, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000262 Streptococcus agalactiae GB00897 ctg7180000003081, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000051 Streptococcus agalactiae GB00897 ctg7180000002870, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000142 Streptococcus agalactiae GB00897 ctg7180000002961, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000271 Streptococcus agalactiae GB00897 ctg7180000003090, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000197 Streptococcus agalactiae GB00897 ctg7180000003016, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000078 Streptococcus agalactiae GB00897 ctg7180000002897, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000069 Streptococcus agalactiae GB00897 ctg7180000002888, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000184 Streptococcus agalactiae GB00897 ctg7180000003003, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000060 Streptococcus agalactiae GB00897 ctg7180000002879, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000061 Streptococcus agalactiae GB00897 ctg7180000002880, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000141 Streptococcus agalactiae GB00897 ctg7180000002960, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000146 Streptococcus agalactiae GB00897 ctg7180000002965, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000217 Streptococcus agalactiae GB00897 ctg7180000003036, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000121 Streptococcus agalactiae GB00897 ctg7180000002940, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000138 Streptococcus agalactiae GB00897 ctg7180000002957, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000150 Streptococcus agalactiae GB00897 ctg7180000002969, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000233 Streptococcus agalactiae GB00897 ctg7180000003052, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000259 Streptococcus agalactiae GB00897 ctg7180000003078, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000083 Streptococcus agalactiae GB00897 ctg7180000002902, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000047 Streptococcus agalactiae GB00897 ctg7180000002866, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000097 Streptococcus agalactiae GB00897 ctg7180000002916, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000202 Streptococcus agalactiae GB00897 ctg7180000003021, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000120 Streptococcus agalactiae GB00897 ctg7180000002939, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000111 Streptococcus agalactiae GB00897 ctg7180000002930, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000038 Streptococcus agalactiae GB00897 ctg7180000002857, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000162 Streptococcus agalactiae GB00897 ctg7180000002981, whole genome shotgun sequence 0 crisprs cas8c,cas7,cas4 0 0 0 0
NZ_ALUI01000015 Streptococcus agalactiae GB00897 ctg7180000002601, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000178 Streptococcus agalactiae GB00897 ctg7180000002997, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000267 Streptococcus agalactiae GB00897 ctg7180000003086, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000158 Streptococcus agalactiae GB00897 ctg7180000002977, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000122 Streptococcus agalactiae GB00897 ctg7180000002941, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000056 Streptococcus agalactiae GB00897 ctg7180000002875, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALUI01000212 Streptococcus agalactiae GB00897 ctg7180000003031, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000264 Streptococcus agalactiae GB00897 ctg7180000003083, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000256 Streptococcus agalactiae GB00897 ctg7180000003075, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000073 Streptococcus agalactiae GB00897 ctg7180000002892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000123 Streptococcus agalactiae GB00897 ctg7180000002942, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000068 Streptococcus agalactiae GB00897 ctg7180000002887, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000099 Streptococcus agalactiae GB00897 ctg7180000002918, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_ALUI01000103 Streptococcus agalactiae GB00897 ctg7180000002922, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000278 Streptococcus agalactiae GB00897 ctg7180000003097, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000240 Streptococcus agalactiae GB00897 ctg7180000003059, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000053 Streptococcus agalactiae GB00897 ctg7180000002872, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000237 Streptococcus agalactiae GB00897 ctg7180000003056, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000176 Streptococcus agalactiae GB00897 ctg7180000002995, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000087 Streptococcus agalactiae GB00897 ctg7180000002906, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000094 Streptococcus agalactiae GB00897 ctg7180000002913, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000268 Streptococcus agalactiae GB00897 ctg7180000003087, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALUI01000011 Streptococcus agalactiae GB00897 ctg7180000002595, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000203 Streptococcus agalactiae GB00897 ctg7180000003022, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000263 Streptococcus agalactiae GB00897 ctg7180000003082, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000260 Streptococcus agalactiae GB00897 ctg7180000003079, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000125 Streptococcus agalactiae GB00897 ctg7180000002944, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000181 Streptococcus agalactiae GB00897 ctg7180000003000, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000213 Streptococcus agalactiae GB00897 ctg7180000003032, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000039 Streptococcus agalactiae GB00897 ctg7180000002858, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000014 Streptococcus agalactiae GB00897 ctg7180000002600, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000220 Streptococcus agalactiae GB00897 ctg7180000003039, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000215 Streptococcus agalactiae GB00897 ctg7180000003034, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000148 Streptococcus agalactiae GB00897 ctg7180000002967, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALUI01000165 Streptococcus agalactiae GB00897 ctg7180000002984, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000192 Streptococcus agalactiae GB00897 ctg7180000003011, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000261 Streptococcus agalactiae GB00897 ctg7180000003080, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000272 Streptococcus agalactiae GB00897 ctg7180000003091, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000063 Streptococcus agalactiae GB00897 ctg7180000002882, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000023 Streptococcus agalactiae GB00897 ctg7180000002615, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000191 Streptococcus agalactiae GB00897 ctg7180000003010, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000152 Streptococcus agalactiae GB00897 ctg7180000002971, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000127 Streptococcus agalactiae GB00897 ctg7180000002946, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000135 Streptococcus agalactiae GB00897 ctg7180000002954, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000042 Streptococcus agalactiae GB00897 ctg7180000002861, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000235 Streptococcus agalactiae GB00897 ctg7180000003054, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000170 Streptococcus agalactiae GB00897 ctg7180000002989, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000108 Streptococcus agalactiae GB00897 ctg7180000002927, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000133 Streptococcus agalactiae GB00897 ctg7180000002952, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000193 Streptococcus agalactiae GB00897 ctg7180000003012, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000109 Streptococcus agalactiae GB00897 ctg7180000002928, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000036 Streptococcus agalactiae GB00897 ctg7180000002697, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000093 Streptococcus agalactiae GB00897 ctg7180000002912, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_ALUI01000129 Streptococcus agalactiae GB00897 ctg7180000002948, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000163 Streptococcus agalactiae GB00897 ctg7180000002982, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000012 Streptococcus agalactiae GB00897 ctg7180000002596, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000231 Streptococcus agalactiae GB00897 ctg7180000003050, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000243 Streptococcus agalactiae GB00897 ctg7180000003062, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 2 0 0 0
NZ_ALUI01000214 Streptococcus agalactiae GB00897 ctg7180000003033, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000275 Streptococcus agalactiae GB00897 ctg7180000003094, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUI01000200 Streptococcus agalactiae GB00897 ctg7180000003019, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ALUI01000280
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALUI01000045
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12456 : 24521 8 Gordonia_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALUI01000041
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALUI01000041_1 1283-1380 Unclear I-C
1 spacers
cas2,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ALUI01000210
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALUI01000210_1 3282-3731 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ALUI01000210_1 1.7|3672|42|NZ_ALUI01000210|CRT 3672-3713 42 NZ_ALUI01000116.1 2869-2910 0 1.0
NZ_ALUI01000210_1 1.5|3588|30|NZ_ALUI01000210|CRT 3588-3617 30 NZ_ALUI01000116.1 2485-2514 2 0.933
NZ_ALUI01000210_1 1.6|3636|18|NZ_ALUI01000210|CRT 3636-3653 18 NZ_ALUI01000116.1 2581-2598 2 0.889
NZ_ALUI01000210_1 1.6|3636|18|NZ_ALUI01000210|CRT 3636-3653 18 NZ_ALUI01000116.1 2629-2646 2 0.889
NZ_ALUI01000210_1 1.6|3636|18|NZ_ALUI01000210|CRT 3636-3653 18 NZ_ALUI01000116.1 2653-2670 2 0.889
NZ_ALUI01000210_1 1.6|3636|18|NZ_ALUI01000210|CRT 3636-3653 18 NZ_ALUI01000210.1 3264-3281 2 0.889

1. spacer 1.7|3672|42|NZ_ALUI01000210|CRT matches to position: 2869-2910, mismatch: 0, identity: 1.0

agcactggtgctggctgacgtcgaggcactcattgaggcgct	CRISPR spacer
agcactggtgctggctgacgtcgaggcactcattgaggcgct	Protospacer
******************************************

2. spacer 1.5|3588|30|NZ_ALUI01000210|CRT matches to position: 2485-2514, mismatch: 2, identity: 0.933

agcactcgtacttgcacttgttgaagcgct	CRISPR spacer
agcactcatacttgcacttgttgaagcact	Protospacer
*******.*******************.**

3. spacer 1.6|3636|18|NZ_ALUI01000210|CRT matches to position: 2581-2598, mismatch: 2, identity: 0.889

tgcactcattgaggcgct	CRISPR spacer
tgcacttgttgaggcgct	Protospacer
******..**********

4. spacer 1.6|3636|18|NZ_ALUI01000210|CRT matches to position: 2629-2646, mismatch: 2, identity: 0.889

tgcactcattgaggcgct	CRISPR spacer
tgcactggttgaggcgct	Protospacer
****** .**********

5. spacer 1.6|3636|18|NZ_ALUI01000210|CRT matches to position: 2653-2670, mismatch: 2, identity: 0.889

tgcactcattgaggcgct	CRISPR spacer
tgcactggttgaggcgct	Protospacer
****** .**********

6. spacer 1.6|3636|18|NZ_ALUI01000210|CRT matches to position: 3264-3281, mismatch: 2, identity: 0.889

tgcactcattgaggcgct	CRISPR spacer
tgcactcgttgagacgct	Protospacer
*******.*****.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALUI01000210_1 1.5|3588|30|NZ_ALUI01000210|CRT 3588-3617 30 NZ_CP052067 Lactobacillus paracasei strain 347-16 plasmid unnamed2, complete sequence 25769-25798 8 0.733
NZ_ALUI01000210_1 1.5|3588|30|NZ_ALUI01000210|CRT 3588-3617 30 NZ_CP048005 Lactobacillus paracasei strain CACC 566 plasmid p2CACC566, complete sequence 14616-14645 8 0.733
NZ_ALUI01000210_1 1.5|3588|30|NZ_ALUI01000210|CRT 3588-3617 30 NZ_CP044365 Lactobacillus paracasei strain TD 062 plasmid unnamed4, complete sequence 43709-43738 8 0.733

1. spacer 1.5|3588|30|NZ_ALUI01000210|CRT matches to NZ_CP052067 (Lactobacillus paracasei strain 347-16 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

-agcactcgtacttgcacttgttgaagcgct	CRISPR spacer
taacg-gcgtacttgcagttgttgaagccga	Protospacer
 *.*.  ********** **********   

2. spacer 1.5|3588|30|NZ_ALUI01000210|CRT matches to NZ_CP048005 (Lactobacillus paracasei strain CACC 566 plasmid p2CACC566, complete sequence) position: , mismatch: 8, identity: 0.733

-agcactcgtacttgcacttgttgaagcgct	CRISPR spacer
taacg-gcgtacttgcagttgttgaagccga	Protospacer
 *.*.  ********** **********   

3. spacer 1.5|3588|30|NZ_ALUI01000210|CRT matches to NZ_CP044365 (Lactobacillus paracasei strain TD 062 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

-agcactcgtacttgcacttgttgaagcgct	CRISPR spacer
taacg-acgtacttgcagttgttgaagccga	Protospacer
 *.*.  ********** **********   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALUI01000243
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALUI01000243_1 2929-3079 TypeII II-A
2 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ALUI01000243_1 1.2|3050|21|NZ_ALUI01000243|PILER-CR 3050-3070 21 NZ_ALUI01000280.1 23827-23847 0 1.0
NZ_ALUI01000243_1 1.3|3014|29|NZ_ALUI01000243|CRISPRCasFinder 3014-3042 29 NZ_ALUI01000280.1 23819-23847 0 1.0

1. spacer 1.2|3050|21|NZ_ALUI01000243|PILER-CR matches to position: 23827-23847, mismatch: 0, identity: 1.0

aagaatgaggtctatgctgat	CRISPR spacer
aagaatgaggtctatgctgat	Protospacer
*********************

2. spacer 1.3|3014|29|NZ_ALUI01000243|CRISPRCasFinder matches to position: 23819-23847, mismatch: 0, identity: 1.0

acgtcataaagaatgaggtctatgctgat	CRISPR spacer
acgtcataaagaatgaggtctatgctgat	Protospacer
*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALUI01000052
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5765 : 13782 14 Streptococcus_phage(62.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALUI01000242
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7445 : 15438 8 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ALUI01000241
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 330 : 11314 10 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ALUI01000018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALUI01000018.1|WP_000384271.1|846_1173_-|hypothetical-protein 846_1173_- 108 aa aa AcrIIA21 NA NA No NA
10. NZ_ALUI01000055
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 9897 : 17101 8 uncultured_Caudovirales_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_ALUI01000116
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage