Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALUH01000020 Streptococcus agalactiae GB00893 ctg7180000005163, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000031 Streptococcus agalactiae GB00893 ctg7180000005174, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000004 Streptococcus agalactiae GB00893 ctg7180000005147, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000017 Streptococcus agalactiae GB00893 ctg7180000005160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000014 Streptococcus agalactiae GB00893 ctg7180000005157, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALUH01000010 Streptococcus agalactiae GB00893 ctg7180000005153, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALUH01000001 Streptococcus agalactiae GB00893 ctg7180000005144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000030 Streptococcus agalactiae GB00893 ctg7180000005173, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000006 Streptococcus agalactiae GB00893 ctg7180000005149, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000007 Streptococcus agalactiae GB00893 ctg7180000005150, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000029 Streptococcus agalactiae GB00893 ctg7180000005172, whole genome shotgun sequence 0 crisprs csm6 0 0 1 0
NZ_ALUH01000025 Streptococcus agalactiae GB00893 ctg7180000005168, whole genome shotgun sequence 1 crisprs DinG 0 7 1 0
NZ_ALUH01000015 Streptococcus agalactiae GB00893 ctg7180000005158, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000023 Streptococcus agalactiae GB00893 ctg7180000005166, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000018 Streptococcus agalactiae GB00893 ctg7180000005161, whole genome shotgun sequence 1 crisprs cas2,cas1,cas4,cas7,cas8c,cas5,cas3 0 0 0 0
NZ_ALUH01000009 Streptococcus agalactiae GB00893 ctg7180000005152, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000012 Streptococcus agalactiae GB00893 ctg7180000005155, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000011 Streptococcus agalactiae GB00893 ctg7180000005154, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000003 Streptococcus agalactiae GB00893 ctg7180000005146, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALUH01000026 Streptococcus agalactiae GB00893 ctg7180000005169, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000024 Streptococcus agalactiae GB00893 ctg7180000005167, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALUH01000016 Streptococcus agalactiae GB00893 ctg7180000005159, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000013 Streptococcus agalactiae GB00893 ctg7180000005156, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALUH01000028 Streptococcus agalactiae GB00893 ctg7180000005171, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000027 Streptococcus agalactiae GB00893 ctg7180000005170, whole genome shotgun sequence 0 crisprs DEDDh,WYL 0 0 0 0
NZ_ALUH01000005 Streptococcus agalactiae GB00893 ctg7180000005148, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000002 Streptococcus agalactiae GB00893 ctg7180000005145, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000008 Streptococcus agalactiae GB00893 ctg7180000005151, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000021 Streptococcus agalactiae GB00893 ctg7180000005164, whole genome shotgun sequence 0 crisprs cas3,csa3 0 0 2 0
NZ_ALUH01000022 Streptococcus agalactiae GB00893 ctg7180000005165, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUH01000019 Streptococcus agalactiae GB00893 ctg7180000005162, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 0 10 1 0

Results visualization

1. NZ_ALUH01000003
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1613 : 10103 12 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALUH01000025
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALUH01000025_1 104210-104570 Orphan I-C
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALUH01000025_1 1.2|104306|35|NZ_ALUH01000025|CRT,CRISPRCasFinder 104306-104340 35 MK448768 Streptococcus phage Javan47, complete genome 34297-34331 0 1.0
NZ_ALUH01000025_1 1.3|104373|34|NZ_ALUH01000025|CRT,CRISPRCasFinder 104373-104406 34 MK448932 Streptococcus phage Javan42, complete genome 35042-35075 0 1.0
NZ_ALUH01000025_1 1.6|104306|33|NZ_ALUH01000025|PILER-CR 104306-104338 33 MK448768 Streptococcus phage Javan47, complete genome 34297-34329 0 1.0
NZ_ALUH01000025_1 1.7|104373|32|NZ_ALUH01000025|PILER-CR 104373-104404 32 MK448932 Streptococcus phage Javan42, complete genome 35044-35075 0 1.0
NZ_ALUH01000025_1 1.7|104373|32|NZ_ALUH01000025|PILER-CR 104373-104404 32 MK449012 Streptococcus phage Javan94, complete genome 33619-33650 2 0.938
NZ_ALUH01000025_1 1.3|104373|34|NZ_ALUH01000025|CRT,CRISPRCasFinder 104373-104406 34 MK449012 Streptococcus phage Javan94, complete genome 33617-33650 3 0.912
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_MG205643 Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence 72996-73027 5 0.844
NZ_ALUH01000025_1 1.8|104439|32|NZ_ALUH01000025|PILER-CR 104439-104470 32 MH622943 Myoviridae sp. isolate ctbc_4, complete genome 180180-180211 5 0.844
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 548430-548461 6 0.812
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP038623 Arsenophonus nasoniae strain FIN plasmid pArsFIN11, complete sequence 39364-39395 6 0.812
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NC_017421 Borreliella burgdorferi N40 plasmid N40_lp38, complete sequence 28345-28376 6 0.812
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NC_001856 Borreliella burgdorferi B31 plasmid lp38, complete sequence 28055-28086 6 0.812
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP019853 Borreliella burgdorferi plasmid lp38, complete sequence 28068-28099 6 0.812
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP019764 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp38, complete sequence 28061-28092 6 0.812
NZ_ALUH01000025_1 1.4|104439|34|NZ_ALUH01000025|CRT,CRISPRCasFinder 104439-104472 34 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 606095-606128 6 0.824
NZ_ALUH01000025_1 1.8|104439|32|NZ_ALUH01000025|PILER-CR 104439-104470 32 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 617393-617424 6 0.812
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 484591-484622 7 0.781
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 AP014284 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C63, *** SEQUENCING IN PROGRESS *** 9262-9293 7 0.781
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP014152 Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence 46517-46548 7 0.781
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP006909 Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence 131643-131674 7 0.781
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP013684 Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence 15273-15304 7 0.781
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP013710 Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence 232837-232868 7 0.781
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NC_010379 Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence 25057-25088 7 0.781
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 158727-158758 7 0.781
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP013700 Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence 158558-158589 7 0.781
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NC_025146 Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111 1638-1669 7 0.781
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NC_020380 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-16, complete sequence 13185-13216 7 0.781
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 MH517022 Acinetobacter phage SH-Ab 15599, complete genome 51037-51068 7 0.781
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 MK496784 Capybara microvirus Cap3_SP_414, complete genome 2372-2403 7 0.781
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 U72945 Virus-like particle CAK1 of Clostridium beijerinckii origin of replication region 829-860 7 0.781
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP029456 Bacillus cereus strain FORC087 plasmid pFORC087.2, complete sequence 61423-61454 8 0.75
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 70696-70727 8 0.75
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 CP016196 Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-2, complete sequence 62259-62290 8 0.75
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP045061 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence 70700-70731 8 0.75
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP045054 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence 70707-70738 8 0.75
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP045058 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence 70706-70737 8 0.75
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 MH830339 Proteus phage Stubb, complete genome 26806-26837 8 0.75
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 MG030347 Proteus phage PM135, complete genome 76557-76588 8 0.75
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 MN935203 UNVERIFIED: Proteus phage VTCCBPA139, partial genome 26007-26038 8 0.75
NZ_ALUH01000025_1 1.4|104439|34|NZ_ALUH01000025|CRT,CRISPRCasFinder 104439-104472 34 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 617393-617426 8 0.765
NZ_ALUH01000025_1 1.4|104439|34|NZ_ALUH01000025|CRT,CRISPRCasFinder 104439-104472 34 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 378878-378911 8 0.765
NZ_ALUH01000025_1 1.4|104439|34|NZ_ALUH01000025|CRT,CRISPRCasFinder 104439-104472 34 NC_015901 Lactococcus lactis subsp. lactis bv. diacetylactis plasmid pVF22, complete sequence 18325-18358 8 0.765
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 93170-93201 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 228972-229003 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_MG205643 Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence 9883-9914 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_AP017932 Lactobacillus sakei strain LK-145 plasmid pLs145-a, complete sequence 5632-5663 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP025208 Lactobacillus sakei strain WiKim0074 plasmid pLSW74_2, complete sequence 12385-12416 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP021933 Lactobacillus plantarum strain TMW 1.1478 plasmid pL11478-1, complete sequence 57054-57085 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP017376 Lactobacillus plantarum strain TMW 1.708 plasmid pL1708-2, complete sequence 17183-17214 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP021472 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-2, complete sequence 18052-18083 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP052067 Lactobacillus paracasei strain 347-16 plasmid unnamed2, complete sequence 1046-1077 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP031209 Lactobacillus brevis strain UCCLB521 plasmid pUCCLB521_A, complete sequence 42073-42104 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP035015 Lactobacillus plantarum strain 12_3 plasmid pldC, complete sequence 24116-24147 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NC_003383 Listeria innocua Clip11262 plasmid pLI100, complete sequence 34563-34594 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP048005 Lactobacillus paracasei strain CACC 566 plasmid p2CACC566, complete sequence 41814-41845 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP046038 Lactobacillus sakei strain CBA3614 plasmid unnamed1, complete sequence 31384-31415 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP017410 Lactobacillus plantarum strain RI-113 plasmid pRI113_4, complete sequence 12201-12232 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NC_016608 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-5, complete sequence 15266-15297 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP029967 Lactobacillus curvatus strain ZJUNIT8 plasmid pnunamed1, complete sequence 42716-42747 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP028336 Lactobacillus plantarum strain SRCM101167 plasmid unnamed2, complete sequence 38185-38216 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP028231 Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence 3683-3714 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP018183 Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-3, complete sequence 17219-17250 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 MH937473 Streptococcus phage CHPC929, complete genome 34811-34842 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NC_010353 Streptococcus phage 858, complete genome 33013-33044 9 0.719
NZ_ALUH01000025_1 1.4|104439|34|NZ_ALUH01000025|CRT,CRISPRCasFinder 104439-104472 34 NZ_CP013615 Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence 243737-243770 9 0.735
NZ_ALUH01000025_1 1.8|104439|32|NZ_ALUH01000025|PILER-CR 104439-104470 32 NZ_CP013615 Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence 243737-243768 9 0.719
NZ_ALUH01000025_1 1.8|104439|32|NZ_ALUH01000025|PILER-CR 104439-104470 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 378880-378911 9 0.719
NZ_ALUH01000025_1 1.8|104439|32|NZ_ALUH01000025|PILER-CR 104439-104470 32 MG945889 UNVERIFIED: Microviridae sp. isolate 1554-1801, partial genome 4926-4957 9 0.719
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP015507 Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence 161310-161341 10 0.688
NZ_ALUH01000025_1 1.1|104242|32|NZ_ALUH01000025|CRT 104242-104273 32 NZ_CP031220 Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence 90370-90401 11 0.656
NZ_ALUH01000025_1 1.4|104439|34|NZ_ALUH01000025|CRT,CRISPRCasFinder 104439-104472 34 NC_013792 Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence 238853-238886 11 0.676

1. spacer 1.2|104306|35|NZ_ALUH01000025|CRT,CRISPRCasFinder matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

aaaacggatggttgtatattgcaggctatcagcta	CRISPR spacer
aaaacggatggttgtatattgcaggctatcagcta	Protospacer
***********************************

2. spacer 1.3|104373|34|NZ_ALUH01000025|CRT,CRISPRCasFinder matches to MK448932 (Streptococcus phage Javan42, complete genome) position: , mismatch: 0, identity: 1.0

tttggctgtttgagtagctcgttgacttttgcct	CRISPR spacer
tttggctgtttgagtagctcgttgacttttgcct	Protospacer
**********************************

3. spacer 1.6|104306|33|NZ_ALUH01000025|PILER-CR matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

aaaacggatggttgtatattgcaggctatcagc	CRISPR spacer
aaaacggatggttgtatattgcaggctatcagc	Protospacer
*********************************

4. spacer 1.7|104373|32|NZ_ALUH01000025|PILER-CR matches to MK448932 (Streptococcus phage Javan42, complete genome) position: , mismatch: 0, identity: 1.0

tttggctgtttgagtagctcgttgacttttgc	CRISPR spacer
tttggctgtttgagtagctcgttgacttttgc	Protospacer
********************************

5. spacer 1.7|104373|32|NZ_ALUH01000025|PILER-CR matches to MK449012 (Streptococcus phage Javan94, complete genome) position: , mismatch: 2, identity: 0.938

tttggctgtttgagtagctcgttgacttttgc	CRISPR spacer
tgtggttgtttgagtagctcgttgacttttgc	Protospacer
* ***.**************************

6. spacer 1.3|104373|34|NZ_ALUH01000025|CRT,CRISPRCasFinder matches to MK449012 (Streptococcus phage Javan94, complete genome) position: , mismatch: 3, identity: 0.912

tttggctgtttgagtagctcgttgacttttgcct	CRISPR spacer
tgtggttgtttgagtagctcgttgacttttgctt	Protospacer
* ***.**************************.*

7. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 5, identity: 0.844

ataatgaattaataaaaaaataat-cattatta	CRISPR spacer
ataatgaatttatataaaaataatacagtttt-	Protospacer
********** *** ********* ** * ** 

8. spacer 1.8|104439|32|NZ_ALUH01000025|PILER-CR matches to MH622943 (Myoviridae sp. isolate ctbc_4, complete genome) position: , mismatch: 5, identity: 0.844

ataattatggtagtctta-tttttaatataaaa	CRISPR spacer
ataattatggttgtattattttttcatataat-	Protospacer
*********** ** *** ***** ******  

9. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aaaatttgctaataaaaaaataatcattaata	Protospacer
* ***  ..******************** **

10. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP038623 (Arsenophonus nasoniae strain FIN plasmid pArsFIN11, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
attatatgttaataactaaataatcattatta	Protospacer
** **. .*******  ***************

11. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NC_017421 (Borreliella burgdorferi N40 plasmid N40_lp38, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatca-ttatta	CRISPR spacer
ataatgaataactaaaaaaataaggaggtatt-	Protospacer
********* * ***********  *  **** 

12. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NC_001856 (Borreliella burgdorferi B31 plasmid lp38, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatca-ttatta	CRISPR spacer
ataatgaataactaaaaaaataaggaggtatt-	Protospacer
********* * ***********  *  **** 

13. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP019853 (Borreliella burgdorferi plasmid lp38, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatca-ttatta	CRISPR spacer
ataatgaataactaaaaaaataaggaggtatt-	Protospacer
********* * ***********  *  **** 

14. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP019764 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp38, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatca-ttatta	CRISPR spacer
ataatgaataactaaaaaaataaggaggtatt-	Protospacer
********* * ***********  *  **** 

15. spacer 1.4|104439|34|NZ_ALUH01000025|CRT,CRISPRCasFinder matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.824

-ataattatggtagtcttatttttaatataaaata	CRISPR spacer
cattcttat-ttattcttattttcaatataaaata	Protospacer
 **  ****  ** *********.***********

16. spacer 1.8|104439|32|NZ_ALUH01000025|PILER-CR matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 6, identity: 0.812

ataattatggtagtcttatttttaatataaaa	CRISPR spacer
acaaaaatgttagtcttatgtttaatataaac	Protospacer
*.**  *** ********* *********** 

17. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 7, identity: 0.781

-ataatgaattaataaaaaaataatcattatta	CRISPR spacer
tataa-atattaataaaaaacaaatcattatct	Protospacer
 **** . ************  *********. 

18. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to AP014284 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C63, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
atccagaattaataaaaaaaaaattattagaa	Protospacer
**   *************** ***.****  *

19. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP014152 (Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

20. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP006909 (Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

21. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP013684 (Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaagaaattttatact-	Protospacer
 ******************. ***. * **.* 

22. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP013710 (Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

23. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

24. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

25. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP013700 (Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaagaaattttatact-	Protospacer
 ******************. ***. * **.* 

26. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

27. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NC_020380 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-16, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcattatta--	CRISPR spacer
ataaataattaataaaaaaataa--aacactacg	Protospacer
****  *****************  * .*.**  

28. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to MH517022 (Acinetobacter phage SH-Ab 15599, complete genome) position: , mismatch: 7, identity: 0.781

ataatgaat--taataaaaaaataatcattatta	CRISPR spacer
--gacgtattataatagaaaaataatcactatta	Protospacer
  .*.* **  *****.***********.*****

29. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to MK496784 (Capybara microvirus Cap3_SP_414, complete genome) position: , mismatch: 7, identity: 0.781

ataatg-aattaataaaaaaataatcattatta	CRISPR spacer
-tatcgtaattaataaaaaaatcattattacga	Protospacer
 ** .* *************** **.****. *

30. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to U72945 (Virus-like particle CAK1 of Clostridium beijerinckii origin of replication region) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcattatta-	CRISPR spacer
ttaaacaattaataaaaaaataatt-ttatgga	Protospacer
 ***  ******************. **** . 

31. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP029456 (Bacillus cereus strain FORC087 plasmid pFORC087.2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataat-cattatta	CRISPR spacer
gaaattaattaatagaaaaataatccaatgct-	Protospacer
. *** ********.********* ** *..* 

32. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaattaatgaaaaaataatattaacaa	Protospacer
 ****.*******.**********  * *. *

33. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to CP016196 (Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaactaataaaaaaataataaaatata	Protospacer
 ****.**.*************** *    **

34. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP045061 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaattaatgaaaaaataatattaacaa	Protospacer
 ****.*******.**********  * *. *

35. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP045054 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaattaatgaaaaaataatattaacaa	Protospacer
 ****.*******.**********  * *. *

36. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP045058 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaattaatgaaaaaataatattaacaa	Protospacer
 ****.*******.**********  * *. *

37. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to MH830339 (Proteus phage Stubb, complete genome) position: , mismatch: 8, identity: 0.75

ataatga-----attaataaaaaaataatcattatta	CRISPR spacer
-----gagcattattaataaataaataatcataataa	Protospacer
     **     ********* ********** ** *

38. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to MG030347 (Proteus phage PM135, complete genome) position: , mismatch: 8, identity: 0.75

ataatga-----attaataaaaaaataatcattatta	CRISPR spacer
-----gagcattattaataaataaataatcataataa	Protospacer
     **     ********* ********** ** *

39. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to MN935203 (UNVERIFIED: Proteus phage VTCCBPA139, partial genome) position: , mismatch: 8, identity: 0.75

ataatga-----attaataaaaaaataatcattatta	CRISPR spacer
-----gagcattattaataaataaataatcataataa	Protospacer
     **     ********* ********** ** *

40. spacer 1.4|104439|34|NZ_ALUH01000025|CRT,CRISPRCasFinder matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.765

ataattatggtagtcttatttttaatataaaata	CRISPR spacer
acaaaaatgttagtcttatgtttaatataaacac	Protospacer
*.**  *** ********* ***********   

41. spacer 1.4|104439|34|NZ_ALUH01000025|CRT,CRISPRCasFinder matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 8, identity: 0.765

ataattatggtagtcttatttttaatataaaata-	CRISPR spacer
aaaattaaagtagtcttatttttaat-cattttac	Protospacer
* ***** .***************** .*   ** 

42. spacer 1.4|104439|34|NZ_ALUH01000025|CRT,CRISPRCasFinder matches to NC_015901 (Lactococcus lactis subsp. lactis bv. diacetylactis plasmid pVF22, complete sequence) position: , mismatch: 8, identity: 0.765

ataattatggtagtcttatttttaatataaaata	CRISPR spacer
taatttctattattctaatttttaatataaaata	Protospacer
  * ** *. ** *** *****************

43. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ataatgaatttataaaaaaataaatttaggag	Protospacer
********** ************ . * .  .

44. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ataatgaatttataaaaaaataaatttaggag	Protospacer
********** ************ . * .  .

45. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
caaaactattaatataaaagtaatcattatct	Protospacer
  **   ******* ****.**********. 

46. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_AP017932 (Lactobacillus sakei strain LK-145 plasmid pLs145-a, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

47. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP025208 (Lactobacillus sakei strain WiKim0074 plasmid pLSW74_2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

48. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP021933 (Lactobacillus plantarum strain TMW 1.1478 plasmid pL11478-1, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

49. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP017376 (Lactobacillus plantarum strain TMW 1.708 plasmid pL1708-2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

50. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP021472 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

51. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP052067 (Lactobacillus paracasei strain 347-16 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

52. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP031209 (Lactobacillus brevis strain UCCLB521 plasmid pUCCLB521_A, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

53. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP035015 (Lactobacillus plantarum strain 12_3 plasmid pldC, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

54. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NC_003383 (Listeria innocua Clip11262 plasmid pLI100, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaat-taataaaaaaataatcattatta	CRISPR spacer
-tggcaggtgtaacaaaaaaattatcattatta	Protospacer
 *......* ***.******** **********

55. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP048005 (Lactobacillus paracasei strain CACC 566 plasmid p2CACC566, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

56. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP046038 (Lactobacillus sakei strain CBA3614 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

57. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP017410 (Lactobacillus plantarum strain RI-113 plasmid pRI113_4, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

58. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NC_016608 (Pediococcus claussenii ATCC BAA-344 plasmid pPECL-5, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

59. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP029967 (Lactobacillus curvatus strain ZJUNIT8 plasmid pnunamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

60. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP028336 (Lactobacillus plantarum strain SRCM101167 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

61. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP028231 (Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

62. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP018183 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-3, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

63. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to MH937473 (Streptococcus phage CHPC929, complete genome) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
atattgaattaataaaaaagtaagtaagtaaa	Protospacer
*** ***************.*** .*     *

64. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NC_010353 (Streptococcus phage 858, complete genome) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
atattgaattaataaaaaagtaagtaagtaaa	Protospacer
*** ***************.*** .*     *

65. spacer 1.4|104439|34|NZ_ALUH01000025|CRT,CRISPRCasFinder matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 9, identity: 0.735

ataattatggtagtcttatttttaa------tataaaata	CRISPR spacer
ttaattattgtagtattatttttaaagtgtttat------	Protospacer
 ******* ***** **********      ***      

66. spacer 1.8|104439|32|NZ_ALUH01000025|PILER-CR matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 9, identity: 0.719

ataattatggtagtcttatttttaatataaaa	CRISPR spacer
ttaattattgtagtattatttttaaagtgttt	Protospacer
 ******* ***** ********** .*.   

67. spacer 1.8|104439|32|NZ_ALUH01000025|PILER-CR matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 9, identity: 0.719

ataattatggtagtcttatttttaatataaaa	CRISPR spacer
aaaattaaagtagtcttatttttaatcatttt	Protospacer
* ***** .*****************      

68. spacer 1.8|104439|32|NZ_ALUH01000025|PILER-CR matches to MG945889 (UNVERIFIED: Microviridae sp. isolate 1554-1801, partial genome) position: , mismatch: 9, identity: 0.719

ataattatggtagtcttatttttaatataaaa	CRISPR spacer
atgggccgggtacacttatttttaatataaat	Protospacer
**.. .  ****  ***************** 

69. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 10, identity: 0.688

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
gaaatgaataaatgaaaaaataatctaccctt	Protospacer
. ******* ***.***********  . .* 

70. spacer 1.1|104242|32|NZ_ALUH01000025|CRT matches to NZ_CP031220 (Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence) position: , mismatch: 11, identity: 0.656

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
tagatgaattaataaataaatattcaaatggg	Protospacer
  .************* ***** ***     .

71. spacer 1.4|104439|34|NZ_ALUH01000025|CRT,CRISPRCasFinder matches to NC_013792 (Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence) position: , mismatch: 11, identity: 0.676

ataattatggtagtcttatttttaatataaaata	CRISPR spacer
ttttcaccactaattttatttttaatataaaata	Protospacer
 *  .  .. **.*.*******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3547 : 11101 11 Streptococcus_phage(50.0%) integrase,transposase attL 6477:6490|attR 11969:11982
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALUH01000024
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 42504 : 54569 8 Gordonia_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ALUH01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 62004 : 72276 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALUH01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALUH01000010.1|WP_000384271.1|63545_63872_+|hypothetical-protein 63545_63872_+ 108 aa aa AcrIIA21 NA NA No NA
6. NZ_ALUH01000021
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 40068 : 47272 8 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_2 58294 : 72342 20 Streptococcus_phage(50.0%) integrase attL 58171:58190|attR 72544:72563
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALUH01000029
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 103318 : 112306 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ALUH01000018
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALUH01000018_1 53-150 TypeI I-C
1 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ALUH01000019
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALUH01000019_1 44451-44882 TypeII II-A
6 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 MK448790 Streptococcus phage Javan515, complete genome 1426-1455 0 1.0
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 MK448957 Streptococcus phage Javan484, complete genome 1422-1451 0 1.0
NZ_ALUH01000019_1 1.4|44685|30|NZ_ALUH01000019|CRT 44685-44714 30 MK448971 Streptococcus phage Javan52, complete genome 25506-25535 0 1.0
NZ_ALUH01000019_1 1.4|44685|30|NZ_ALUH01000019|CRT 44685-44714 30 MK448956 Streptococcus phage Javan48, complete genome 23825-23854 0 1.0
NZ_ALUH01000019_1 1.5|44751|30|NZ_ALUH01000019|CRT 44751-44780 30 MK448729 Streptococcus phage Javan31, complete genome 12725-12754 0 1.0
NZ_ALUH01000019_1 1.5|44751|30|NZ_ALUH01000019|CRT 44751-44780 30 MK448691 Streptococcus phage Javan17, complete genome 12725-12754 0 1.0
NZ_ALUH01000019_1 1.5|44751|30|NZ_ALUH01000019|CRT 44751-44780 30 MK448948 Streptococcus phage Javan46, complete genome 12725-12754 0 1.0
NZ_ALUH01000019_1 1.5|44751|30|NZ_ALUH01000019|CRT 44751-44780 30 MK448768 Streptococcus phage Javan47, complete genome 13870-13899 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448871 Streptococcus phage Javan196, complete genome 2167-2196 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448976 Streptococcus phage Javan528, complete genome 2167-2196 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448961 Streptococcus phage Javan494, complete genome 2167-2196 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448697 Streptococcus phage Javan185, complete genome 2167-2196 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448693 Streptococcus phage Javan177, complete genome 2167-2196 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448855 Streptococcus phage Javan150, complete genome 2131-2160 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448729 Streptococcus phage Javan31, complete genome 2446-2475 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448696 Streptococcus phage Javan183, complete genome 2167-2196 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448837 Streptococcus phage Javan10, complete genome 2446-2475 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448868 Streptococcus phage Javan188, complete genome 2167-2196 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448691 Streptococcus phage Javan17, complete genome 2446-2475 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448866 Streptococcus phage Javan184, complete genome 2167-2196 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448699 Streptococcus phage Javan189, complete genome 2167-2196 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448867 Streptococcus phage Javan186, complete genome 2167-2196 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448948 Streptococcus phage Javan46, complete genome 2446-2475 0 1.0
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448768 Streptococcus phage Javan47, complete genome 2446-2475 0 1.0
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 MK448790 Streptococcus phage Javan515, complete genome 1427-1455 0 1.0
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 MK448957 Streptococcus phage Javan484, complete genome 1423-1451 0 1.0
NZ_ALUH01000019_1 1.9|44685|29|NZ_ALUH01000019|CRISPRCasFinder 44685-44713 29 MK448971 Streptococcus phage Javan52, complete genome 25506-25534 0 1.0
NZ_ALUH01000019_1 1.9|44685|29|NZ_ALUH01000019|CRISPRCasFinder 44685-44713 29 MK448956 Streptococcus phage Javan48, complete genome 23825-23853 0 1.0
NZ_ALUH01000019_1 1.10|44751|29|NZ_ALUH01000019|CRISPRCasFinder 44751-44779 29 MK448729 Streptococcus phage Javan31, complete genome 12726-12754 0 1.0
NZ_ALUH01000019_1 1.10|44751|29|NZ_ALUH01000019|CRISPRCasFinder 44751-44779 29 MK448691 Streptococcus phage Javan17, complete genome 12726-12754 0 1.0
NZ_ALUH01000019_1 1.10|44751|29|NZ_ALUH01000019|CRISPRCasFinder 44751-44779 29 MK448948 Streptococcus phage Javan46, complete genome 12726-12754 0 1.0
NZ_ALUH01000019_1 1.10|44751|29|NZ_ALUH01000019|CRISPRCasFinder 44751-44779 29 MK448768 Streptococcus phage Javan47, complete genome 13871-13899 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448871 Streptococcus phage Javan196, complete genome 2168-2196 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448976 Streptococcus phage Javan528, complete genome 2168-2196 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448961 Streptococcus phage Javan494, complete genome 2168-2196 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448697 Streptococcus phage Javan185, complete genome 2168-2196 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448693 Streptococcus phage Javan177, complete genome 2168-2196 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448855 Streptococcus phage Javan150, complete genome 2132-2160 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448729 Streptococcus phage Javan31, complete genome 2447-2475 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448696 Streptococcus phage Javan183, complete genome 2168-2196 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448837 Streptococcus phage Javan10, complete genome 2447-2475 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448868 Streptococcus phage Javan188, complete genome 2168-2196 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448691 Streptococcus phage Javan17, complete genome 2447-2475 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448866 Streptococcus phage Javan184, complete genome 2168-2196 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448699 Streptococcus phage Javan189, complete genome 2168-2196 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448867 Streptococcus phage Javan186, complete genome 2168-2196 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448948 Streptococcus phage Javan46, complete genome 2447-2475 0 1.0
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448768 Streptococcus phage Javan47, complete genome 2447-2475 0 1.0
NZ_ALUH01000019_1 1.3|44619|30|NZ_ALUH01000019|CRT 44619-44648 30 MK448742 Streptococcus phage Javan37, complete genome 12323-12352 1 0.967
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448919 Streptococcus phage Javan370, complete genome 1833-1862 1 0.967
NZ_ALUH01000019_1 1.8|44619|29|NZ_ALUH01000019|CRISPRCasFinder 44619-44647 29 MK448742 Streptococcus phage Javan37, complete genome 12324-12352 1 0.966
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448919 Streptococcus phage Javan370, complete genome 1834-1862 1 0.966
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448808 Streptococcus phage Javan569, complete genome 3315-3344 2 0.933
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448807 Streptococcus phage Javan567, complete genome 3312-3341 2 0.933
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448991 Streptococcus phage Javan590, complete genome 3312-3341 2 0.933
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448805 Streptococcus phage Javan563, complete genome 3312-3341 2 0.933
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 NC_022791 Streptococcus phage phiBHN167 complete genome 29442-29471 2 0.933
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448808 Streptococcus phage Javan569, complete genome 3316-3344 2 0.931
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448807 Streptococcus phage Javan567, complete genome 3313-3341 2 0.931
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448991 Streptococcus phage Javan590, complete genome 3313-3341 2 0.931
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448805 Streptococcus phage Javan563, complete genome 3313-3341 2 0.931
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 NC_022791 Streptococcus phage phiBHN167 complete genome 29442-29470 2 0.931
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 MK448806 Streptococcus phage Javan565, complete genome 3052-3081 3 0.9
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 MK448806 Streptococcus phage Javan565, complete genome 3053-3081 3 0.897
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 NC_018685 Bacillus thuringiensis MC28 plasmid pMC95, complete sequence 82838-82866 5 0.828
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 NZ_CP004876 Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence 223176-223204 5 0.828
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 NC_017203 Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence 254256-254284 5 0.828
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 NC_020384 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence 258485-258513 5 0.828
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 NZ_CP011350 Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence 624118-624146 5 0.828
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 NZ_CP015177 Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence 216308-216336 5 0.828
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 NZ_CP004861 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence 221613-221641 5 0.828
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 NZ_CP010091 Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence 235805-235833 5 0.828
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NC_018685 Bacillus thuringiensis MC28 plasmid pMC95, complete sequence 82837-82866 6 0.8
NZ_ALUH01000019_1 1.3|44619|30|NZ_ALUH01000019|CRT 44619-44648 30 NZ_CP021671 Bacillus licheniformis strain SRCM100141 plasmid pBL141-1 sequence sequence 17860-17889 6 0.8
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 NZ_CP004876 Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence 223175-223204 6 0.8
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 NC_017203 Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence 254255-254284 6 0.8
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 NC_020384 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence 258484-258513 6 0.8
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 NZ_CP011350 Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence 624118-624147 6 0.8
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 NZ_CP015177 Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence 216307-216336 6 0.8
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 NZ_CP004861 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence 221612-221641 6 0.8
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 NZ_CP010091 Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence 235804-235833 6 0.8
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 NZ_CP034168 Enterococcus avium strain 352 plasmid unnamed, complete sequence 14260-14288 6 0.793
NZ_ALUH01000019_1 1.8|44619|29|NZ_ALUH01000019|CRISPRCasFinder 44619-44647 29 NZ_CP021671 Bacillus licheniformis strain SRCM100141 plasmid pBL141-1 sequence sequence 17860-17888 6 0.793
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 KY065473 Streptococcus phage IPP32, complete genome 3562-3590 6 0.793
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NZ_CP034168 Enterococcus avium strain 352 plasmid unnamed, complete sequence 14259-14288 7 0.767
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NZ_CP053971 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence 180131-180160 7 0.767
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NZ_CP013278 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence 130740-130769 7 0.767
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NC_018509 Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence 124624-124653 7 0.767
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NZ_CP039724 Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence 2565-2594 7 0.767
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NZ_CP051859 Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence 1843-1872 7 0.767
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NZ_CP009347 Bacillus thuringiensis HD1002 plasmid 3, complete sequence 40599-40628 7 0.767
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NC_015417 Clostridium botulinum BKT015925 plasmid p1BKT015925, complete sequence 153049-153078 7 0.767
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NZ_CP045025 Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence 130740-130769 7 0.767
NZ_ALUH01000019_1 1.3|44619|30|NZ_ALUH01000019|CRT 44619-44648 30 NZ_CP045267 Bacillus megaterium strain FDU301 plasmid pFDU301E, complete sequence 6410-6439 7 0.767
NZ_ALUH01000019_1 1.5|44751|30|NZ_ALUH01000019|CRT 44751-44780 30 NZ_CP022992 Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence 348631-348660 7 0.767
NZ_ALUH01000019_1 1.5|44751|30|NZ_ALUH01000019|CRT 44751-44780 30 NZ_CP022993 Paraburkholderia aromaticivorans strain BN5 plasmid pBN3, complete sequence 81984-82013 7 0.767
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 KY065473 Streptococcus phage IPP32, complete genome 3561-3590 7 0.767
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 NC_018878 Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence 27063-27091 7 0.759
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 NC_015417 Clostridium botulinum BKT015925 plasmid p1BKT015925, complete sequence 153050-153078 7 0.759
NZ_ALUH01000019_1 1.8|44619|29|NZ_ALUH01000019|CRISPRCasFinder 44619-44647 29 NZ_CP045267 Bacillus megaterium strain FDU301 plasmid pFDU301E, complete sequence 6411-6439 7 0.759
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NC_018878 Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence 27063-27092 8 0.733
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NC_048665 Clostridium phage phiCDHM14, complete genome 22262-22291 8 0.733
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 KU057941 Clostridium phage CDSH1, complete genome 28658-28687 8 0.733
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 MK473382 Clostridium phage JD032, complete genome 12174-12203 8 0.733
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 LN881738 Escherichia phage slur17, complete genome 33369-33398 8 0.733
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NC_028905 Clostridium phage phiCD111, complete genome 28432-28461 8 0.733
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 HG796225 Clostridium phage phiCDHM13 complete genome 21762-21791 8 0.733
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 LN681538 Clostridium phage phiCD481-1, complete genome 21502-21531 8 0.733
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 HG798901 Clostridium phage phiCDHM11 complete genome 21762-21791 8 0.733
NZ_ALUH01000019_1 1.3|44619|30|NZ_ALUH01000019|CRT 44619-44648 30 MN693975 Marine virus AFVG_250M1117, complete genome 25102-25131 8 0.733
NZ_ALUH01000019_1 1.6|44817|30|NZ_ALUH01000019|CRT 44817-44846 30 NZ_CP021785 Acinetobacter baumannii strain A85 plasmid pA85-1b, complete sequence 891-920 8 0.733
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 NC_048665 Clostridium phage phiCDHM14, complete genome 22263-22291 8 0.724
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 KU057941 Clostridium phage CDSH1, complete genome 28659-28687 8 0.724
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 MK473382 Clostridium phage JD032, complete genome 12174-12202 8 0.724
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 LN881738 Escherichia phage slur17, complete genome 33369-33397 8 0.724
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 NC_028905 Clostridium phage phiCD111, complete genome 28433-28461 8 0.724
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 NC_028838 Clostridium phage phiCD506, complete genome 22084-22112 8 0.724
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 HM568888 Clostridium phage phiCD38-2, complete genome 28155-28183 8 0.724
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 HG796225 Clostridium phage phiCDHM13 complete genome 21763-21791 8 0.724
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 NC_028958 Clostridium phage phiCD146, complete genome 27717-27745 8 0.724
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 LN681538 Clostridium phage phiCD481-1, complete genome 21503-21531 8 0.724
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 HG798901 Clostridium phage phiCDHM11 complete genome 21763-21791 8 0.724
NZ_ALUH01000019_1 1.8|44619|29|NZ_ALUH01000019|CRISPRCasFinder 44619-44647 29 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1200387-1200415 8 0.724
NZ_ALUH01000019_1 1.8|44619|29|NZ_ALUH01000019|CRISPRCasFinder 44619-44647 29 MH319731 Marine virus AG-345-E02 Ga0172268_11 genomic sequence 82457-82485 8 0.724
NZ_ALUH01000019_1 1.8|44619|29|NZ_ALUH01000019|CRISPRCasFinder 44619-44647 29 GU071094 Synechococcus phage S-SM1, complete genome 171169-171197 8 0.724
NZ_ALUH01000019_1 1.10|44751|29|NZ_ALUH01000019|CRISPRCasFinder 44751-44779 29 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 81105-81133 8 0.724
NZ_ALUH01000019_1 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder 44817-44845 29 NZ_CP021785 Acinetobacter baumannii strain A85 plasmid pA85-1b, complete sequence 892-920 8 0.724
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NC_028838 Clostridium phage phiCD506, complete genome 22083-22112 9 0.7
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 HM568888 Clostridium phage phiCD38-2, complete genome 28154-28183 9 0.7
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NC_028958 Clostridium phage phiCD146, complete genome 27716-27745 9 0.7
NZ_ALUH01000019_1 1.3|44619|30|NZ_ALUH01000019|CRT 44619-44648 30 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1200386-1200415 9 0.7
NZ_ALUH01000019_1 1.3|44619|30|NZ_ALUH01000019|CRT 44619-44648 30 MH319731 Marine virus AG-345-E02 Ga0172268_11 genomic sequence 82456-82485 9 0.7
NZ_ALUH01000019_1 1.3|44619|30|NZ_ALUH01000019|CRT 44619-44648 30 GU071094 Synechococcus phage S-SM1, complete genome 171168-171197 9 0.7
NZ_ALUH01000019_1 1.5|44751|30|NZ_ALUH01000019|CRT 44751-44780 30 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 81105-81134 9 0.7
NZ_ALUH01000019_1 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder 44553-44581 29 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 640927-640955 9 0.69
NZ_ALUH01000019_1 1.2|44553|30|NZ_ALUH01000019|CRT 44553-44582 30 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 640927-640956 10 0.667

1. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to MK448790 (Streptococcus phage Javan515, complete genome) position: , mismatch: 0, identity: 1.0

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
gatggagtgttagaagaattaaaaagaaga	Protospacer
******************************

2. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to MK448957 (Streptococcus phage Javan484, complete genome) position: , mismatch: 0, identity: 1.0

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
gatggagtgttagaagaattaaaaagaaga	Protospacer
******************************

3. spacer 1.4|44685|30|NZ_ALUH01000019|CRT matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 0, identity: 1.0

aagaagcggagagacggttaaaagtgccgt	CRISPR spacer
aagaagcggagagacggttaaaagtgccgt	Protospacer
******************************

4. spacer 1.4|44685|30|NZ_ALUH01000019|CRT matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 0, identity: 1.0

aagaagcggagagacggttaaaagtgccgt	CRISPR spacer
aagaagcggagagacggttaaaagtgccgt	Protospacer
******************************

5. spacer 1.5|44751|30|NZ_ALUH01000019|CRT matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0

catactgggctttcttgaccgcttccagat	CRISPR spacer
catactgggctttcttgaccgcttccagat	Protospacer
******************************

6. spacer 1.5|44751|30|NZ_ALUH01000019|CRT matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0

catactgggctttcttgaccgcttccagat	CRISPR spacer
catactgggctttcttgaccgcttccagat	Protospacer
******************************

7. spacer 1.5|44751|30|NZ_ALUH01000019|CRT matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0

catactgggctttcttgaccgcttccagat	CRISPR spacer
catactgggctttcttgaccgcttccagat	Protospacer
******************************

8. spacer 1.5|44751|30|NZ_ALUH01000019|CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

catactgggctttcttgaccgcttccagat	CRISPR spacer
catactgggctttcttgaccgcttccagat	Protospacer
******************************

9. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448871 (Streptococcus phage Javan196, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

10. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448976 (Streptococcus phage Javan528, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

11. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448961 (Streptococcus phage Javan494, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

12. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448697 (Streptococcus phage Javan185, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

13. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448693 (Streptococcus phage Javan177, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

14. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448855 (Streptococcus phage Javan150, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

15. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

16. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448696 (Streptococcus phage Javan183, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

17. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

18. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448868 (Streptococcus phage Javan188, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

19. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

20. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448866 (Streptococcus phage Javan184, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

21. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448699 (Streptococcus phage Javan189, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

22. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448867 (Streptococcus phage Javan186, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

23. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

24. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaaa	Protospacer
******************************

25. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448790 (Streptococcus phage Javan515, complete genome) position: , mismatch: 0, identity: 1.0

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
gatggagtgttagaagaattaaaaagaag	Protospacer
*****************************

26. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448957 (Streptococcus phage Javan484, complete genome) position: , mismatch: 0, identity: 1.0

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
gatggagtgttagaagaattaaaaagaag	Protospacer
*****************************

27. spacer 1.9|44685|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 0, identity: 1.0

aagaagcggagagacggttaaaagtgccg	CRISPR spacer
aagaagcggagagacggttaaaagtgccg	Protospacer
*****************************

28. spacer 1.9|44685|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 0, identity: 1.0

aagaagcggagagacggttaaaagtgccg	CRISPR spacer
aagaagcggagagacggttaaaagtgccg	Protospacer
*****************************

29. spacer 1.10|44751|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0

catactgggctttcttgaccgcttccaga	CRISPR spacer
catactgggctttcttgaccgcttccaga	Protospacer
*****************************

30. spacer 1.10|44751|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0

catactgggctttcttgaccgcttccaga	CRISPR spacer
catactgggctttcttgaccgcttccaga	Protospacer
*****************************

31. spacer 1.10|44751|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0

catactgggctttcttgaccgcttccaga	CRISPR spacer
catactgggctttcttgaccgcttccaga	Protospacer
*****************************

32. spacer 1.10|44751|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

catactgggctttcttgaccgcttccaga	CRISPR spacer
catactgggctttcttgaccgcttccaga	Protospacer
*****************************

33. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448871 (Streptococcus phage Javan196, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

34. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448976 (Streptococcus phage Javan528, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

35. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448961 (Streptococcus phage Javan494, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

36. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448697 (Streptococcus phage Javan185, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

37. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448693 (Streptococcus phage Javan177, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

38. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448855 (Streptococcus phage Javan150, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

39. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

40. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448696 (Streptococcus phage Javan183, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

41. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

42. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448868 (Streptococcus phage Javan188, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

43. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

44. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448866 (Streptococcus phage Javan184, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

45. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448699 (Streptococcus phage Javan189, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

46. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448867 (Streptococcus phage Javan186, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

47. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

48. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaactcaaa	Protospacer
*****************************

49. spacer 1.3|44619|30|NZ_ALUH01000019|CRT matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 1, identity: 0.967

acgacttcgttttcttcgatttctgaccat	CRISPR spacer
atgacttcgttttcttcgatttctgaccat	Protospacer
*.****************************

50. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448919 (Streptococcus phage Javan370, complete genome) position: , mismatch: 1, identity: 0.967

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaatctcaaaa	Protospacer
********************** *******

51. spacer 1.8|44619|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 1, identity: 0.966

acgacttcgttttcttcgatttctgacca	CRISPR spacer
atgacttcgttttcttcgatttctgacca	Protospacer
*.***************************

52. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448919 (Streptococcus phage Javan370, complete genome) position: , mismatch: 1, identity: 0.966

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaatctcaaa	Protospacer
********************** ******

53. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448808 (Streptococcus phage Javan569, complete genome) position: , mismatch: 2, identity: 0.933

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatgcactctataagttaaaaactcaaaa	Protospacer
****.*************.***********

54. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448807 (Streptococcus phage Javan567, complete genome) position: , mismatch: 2, identity: 0.933

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatgcactctataagttaaaaactcaaaa	Protospacer
****.*************.***********

55. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448991 (Streptococcus phage Javan590, complete genome) position: , mismatch: 2, identity: 0.933

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatgcactctataagttaaaaactcaaaa	Protospacer
****.*************.***********

56. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448805 (Streptococcus phage Javan563, complete genome) position: , mismatch: 2, identity: 0.933

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatgcactctataagttaaaaactcaaaa	Protospacer
****.*************.***********

57. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to NC_022791 (Streptococcus phage phiBHN167 complete genome) position: , mismatch: 2, identity: 0.933

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaatcacaaaa	Protospacer
********************** * *****

58. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448808 (Streptococcus phage Javan569, complete genome) position: , mismatch: 2, identity: 0.931

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatgcactctataagttaaaaactcaaa	Protospacer
****.*************.**********

59. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448807 (Streptococcus phage Javan567, complete genome) position: , mismatch: 2, identity: 0.931

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatgcactctataagttaaaaactcaaa	Protospacer
****.*************.**********

60. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448991 (Streptococcus phage Javan590, complete genome) position: , mismatch: 2, identity: 0.931

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatgcactctataagttaaaaactcaaa	Protospacer
****.*************.**********

61. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448805 (Streptococcus phage Javan563, complete genome) position: , mismatch: 2, identity: 0.931

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatgcactctataagttaaaaactcaaa	Protospacer
****.*************.**********

62. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to NC_022791 (Streptococcus phage phiBHN167 complete genome) position: , mismatch: 2, identity: 0.931

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaatcacaaa	Protospacer
********************** * ****

63. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to MK448806 (Streptococcus phage Javan565, complete genome) position: , mismatch: 3, identity: 0.9

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
gaatacactttataagttgaaaacacaaaa	Protospacer
.********.************** *****

64. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK448806 (Streptococcus phage Javan565, complete genome) position: , mismatch: 3, identity: 0.897

aaatacactctataagttgaaaactcaaa	CRISPR spacer
gaatacactttataagttgaaaacacaaa	Protospacer
.********.************** ****

65. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to NC_018685 (Bacillus thuringiensis MC28 plasmid pMC95, complete sequence) position: , mismatch: 5, identity: 0.828

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
aaaggaatgttagaagaattaaaaaatag	Protospacer
.* ***.******************. **

66. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to NZ_CP004876 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence) position: , mismatch: 5, identity: 0.828

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaaactatc	Protospacer
*********************** ..*  

67. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to NC_017203 (Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence) position: , mismatch: 5, identity: 0.828

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaaactatc	Protospacer
*********************** ..*  

68. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to NC_020384 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence) position: , mismatch: 5, identity: 0.828

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaaactatc	Protospacer
*********************** ..*  

69. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to NZ_CP011350 (Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence) position: , mismatch: 5, identity: 0.828

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaaactatc	Protospacer
*********************** ..*  

70. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to NZ_CP015177 (Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence) position: , mismatch: 5, identity: 0.828

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaaactatc	Protospacer
*********************** ..*  

71. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to NZ_CP004861 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence) position: , mismatch: 5, identity: 0.828

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaaactatc	Protospacer
*********************** ..*  

72. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to NZ_CP010091 (Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence) position: , mismatch: 5, identity: 0.828

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagttgaaaaactatc	Protospacer
*********************** ..*  

73. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NC_018685 (Bacillus thuringiensis MC28 plasmid pMC95, complete sequence) position: , mismatch: 6, identity: 0.8

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
aaaggaatgttagaagaattaaaaaatagt	Protospacer
.* ***.******************. ** 

74. spacer 1.3|44619|30|NZ_ALUH01000019|CRT matches to NZ_CP021671 (Bacillus licheniformis strain SRCM100141 plasmid pBL141-1 sequence sequence) position: , mismatch: 6, identity: 0.8

acgacttcgttttcttcgatttctgaccat	CRISPR spacer
aagacttcgttttcatcgatttctggaatt	Protospacer
* ************ **********.   *

75. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to NZ_CP004876 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence) position: , mismatch: 6, identity: 0.8

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaaactatct	Protospacer
*********************** ..*   

76. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to NC_017203 (Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence) position: , mismatch: 6, identity: 0.8

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaaactatct	Protospacer
*********************** ..*   

77. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to NC_020384 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence) position: , mismatch: 6, identity: 0.8

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaaactatct	Protospacer
*********************** ..*   

78. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to NZ_CP011350 (Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence) position: , mismatch: 6, identity: 0.8

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaaactatct	Protospacer
*********************** ..*   

79. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to NZ_CP015177 (Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence) position: , mismatch: 6, identity: 0.8

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaaactatct	Protospacer
*********************** ..*   

80. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to NZ_CP004861 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence) position: , mismatch: 6, identity: 0.8

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaaactatct	Protospacer
*********************** ..*   

81. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to NZ_CP010091 (Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence) position: , mismatch: 6, identity: 0.8

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagttgaaaaactatct	Protospacer
*********************** ..*   

82. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to NZ_CP034168 (Enterococcus avium strain 352 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
aatgcagtattagaagaattaaaaaccaa	Protospacer
.*** ***.****************  *.

83. spacer 1.8|44619|29|NZ_ALUH01000019|CRISPRCasFinder matches to NZ_CP021671 (Bacillus licheniformis strain SRCM100141 plasmid pBL141-1 sequence sequence) position: , mismatch: 6, identity: 0.793

acgacttcgttttcttcgatttctgacca	CRISPR spacer
aagacttcgttttcatcgatttctggaat	Protospacer
* ************ **********.   

84. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to KY065473 (Streptococcus phage IPP32, complete genome) position: , mismatch: 6, identity: 0.793

aaatacactctataagttgaaaactcaaa	CRISPR spacer
aaatacactctataagataaaaaattcta	Protospacer
**************** *.**** *.  *

85. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NZ_CP034168 (Enterococcus avium strain 352 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
aatgcagtattagaagaattaaaaaccaat	Protospacer
.*** ***.****************  *. 

86. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NZ_CP053971 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
ggcgctttgttagaagagttaaaaacaaga	Protospacer
*..*   **********.******* ****

87. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NZ_CP013278 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
ggcgctttgttagaagagttaaaaacaaga	Protospacer
*..*   **********.******* ****

88. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NC_018509 (Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
ggcgctttgttagaagagttaaaaacaaga	Protospacer
*..*   **********.******* ****

89. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NZ_CP039724 (Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
ggcgctttgttagaagagttaaaaacaaga	Protospacer
*..*   **********.******* ****

90. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NZ_CP051859 (Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
ggcgctttgttagaagagttaaaaacaaga	Protospacer
*..*   **********.******* ****

91. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NZ_CP009347 (Bacillus thuringiensis HD1002 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
ggcgctttgttagaagagttaaaaacaaga	Protospacer
*..*   **********.******* ****

92. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NC_015417 (Clostridium botulinum BKT015925 plasmid p1BKT015925, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
gaacgagtattagaagaattaaaaaaggaa	Protospacer
**  ****.****************....*

93. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NZ_CP045025 (Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
ggcgctttgttagaagagttaaaaacaaga	Protospacer
*..*   **********.******* ****

94. spacer 1.3|44619|30|NZ_ALUH01000019|CRT matches to NZ_CP045267 (Bacillus megaterium strain FDU301 plasmid pFDU301E, complete sequence) position: , mismatch: 7, identity: 0.767

acgacttcgttttcttcgatttctgaccat	CRISPR spacer
aagacttcgttttcattgatttctgggatt	Protospacer
* ************ *.********.   *

95. spacer 1.5|44751|30|NZ_ALUH01000019|CRT matches to NZ_CP022992 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence) position: , mismatch: 7, identity: 0.767

catactgggctttcttgaccgcttccagat	CRISPR spacer
gacgcaaggcttccgtgaccgcttccagat	Protospacer
 *..* .*****.* ***************

96. spacer 1.5|44751|30|NZ_ALUH01000019|CRT matches to NZ_CP022993 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN3, complete sequence) position: , mismatch: 7, identity: 0.767

catactgggctttcttgaccgcttccagat	CRISPR spacer
gacgcaaggcttccgtgaccgcttccagat	Protospacer
 *..* .*****.* ***************

97. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to KY065473 (Streptococcus phage IPP32, complete genome) position: , mismatch: 7, identity: 0.767

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
aaatacactctataagataaaaaattctac	Protospacer
**************** *.**** *.  * 

98. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to NC_018878 (Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence) position: , mismatch: 7, identity: 0.759

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
aatggagtgttagatgaatttaaactaca	Protospacer
.************* ***** ***  * .

99. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to NC_015417 (Clostridium botulinum BKT015925 plasmid p1BKT015925, complete sequence) position: , mismatch: 7, identity: 0.759

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
gaacgagtattagaagaattaaaaaagga	Protospacer
**  ****.****************....

100. spacer 1.8|44619|29|NZ_ALUH01000019|CRISPRCasFinder matches to NZ_CP045267 (Bacillus megaterium strain FDU301 plasmid pFDU301E, complete sequence) position: , mismatch: 7, identity: 0.759

acgacttcgttttcttcgatttctgacca	CRISPR spacer
aagacttcgttttcattgatttctgggat	Protospacer
* ************ *.********.   

101. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NC_018878 (Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
aatggagtgttagatgaatttaaactacag	Protospacer
.************* ***** ***  * ..

102. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NC_048665 (Clostridium phage phiCDHM14, complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

103. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to KU057941 (Clostridium phage CDSH1, complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

104. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to MK473382 (Clostridium phage JD032, complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

105. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to LN881738 (Escherichia phage slur17, complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

106. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NC_028905 (Clostridium phage phiCD111, complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

107. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to HG796225 (Clostridium phage phiCDHM13 complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

108. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to LN681538 (Clostridium phage phiCD481-1, complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

109. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to HG798901 (Clostridium phage phiCDHM11 complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

110. spacer 1.3|44619|30|NZ_ALUH01000019|CRT matches to MN693975 (Marine virus AFVG_250M1117, complete genome) position: , mismatch: 8, identity: 0.733

acgacttcgttttcttcgatttctgaccat	CRISPR spacer
tcatttattttttcttcgatttctaaccat	Protospacer
 *. .* . ***************.*****

111. spacer 1.6|44817|30|NZ_ALUH01000019|CRT matches to NZ_CP021785 (Acinetobacter baumannii strain A85 plasmid pA85-1b, complete sequence) position: , mismatch: 8, identity: 0.733

aaatacactctataagttgaaaactcaaaa	CRISPR spacer
cttcattttctataagttgcaaactcaaaa	Protospacer
   .*. .*********** **********

112. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to NC_048665 (Clostridium phage phiCDHM14, complete genome) position: , mismatch: 8, identity: 0.724

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
actaatatgttagaagaattgaaaagaaa	Protospacer
. *.. .*************.*******.

113. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to KU057941 (Clostridium phage CDSH1, complete genome) position: , mismatch: 8, identity: 0.724

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
actaatatgttagaagaattgaaaagaaa	Protospacer
. *.. .*************.*******.

114. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to MK473382 (Clostridium phage JD032, complete genome) position: , mismatch: 8, identity: 0.724

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
actaatatgttagaagaattgaaaagaaa	Protospacer
. *.. .*************.*******.

115. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to LN881738 (Escherichia phage slur17, complete genome) position: , mismatch: 8, identity: 0.724

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
actaatatgttagaagaattgaaaagaaa	Protospacer
. *.. .*************.*******.

116. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to NC_028905 (Clostridium phage phiCD111, complete genome) position: , mismatch: 8, identity: 0.724

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
actaatatgttagaagaattgaaaagaaa	Protospacer
. *.. .*************.*******.

117. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to NC_028838 (Clostridium phage phiCD506, complete genome) position: , mismatch: 8, identity: 0.724

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
actaatatgttagaagaattgaaaagaaa	Protospacer
. *.. .*************.*******.

118. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to HM568888 (Clostridium phage phiCD38-2, complete genome) position: , mismatch: 8, identity: 0.724

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
actaatatgttagaagaattgaaaagaaa	Protospacer
. *.. .*************.*******.

119. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to HG796225 (Clostridium phage phiCDHM13 complete genome) position: , mismatch: 8, identity: 0.724

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
actaatatgttagaagaattgaaaagaaa	Protospacer
. *.. .*************.*******.

120. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to NC_028958 (Clostridium phage phiCD146, complete genome) position: , mismatch: 8, identity: 0.724

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
actaatatgttagaagaattgaaaagaaa	Protospacer
. *.. .*************.*******.

121. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to LN681538 (Clostridium phage phiCD481-1, complete genome) position: , mismatch: 8, identity: 0.724

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
actaatatgttagaagaattgaaaagaaa	Protospacer
. *.. .*************.*******.

122. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to HG798901 (Clostridium phage phiCDHM11 complete genome) position: , mismatch: 8, identity: 0.724

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
actaatatgttagaagaattgaaaagaaa	Protospacer
. *.. .*************.*******.

123. spacer 1.8|44619|29|NZ_ALUH01000019|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.724

acgacttcgttttcttcgatttctgacca	CRISPR spacer
acgaattcgttgtcttcgatttccagatt	Protospacer
**** ****** ***********... . 

124. spacer 1.8|44619|29|NZ_ALUH01000019|CRISPRCasFinder matches to MH319731 (Marine virus AG-345-E02 Ga0172268_11 genomic sequence) position: , mismatch: 8, identity: 0.724

acgacttcgttttcttcgatttctgacca	CRISPR spacer
aatcgttcgttttcttcgatgtctgatgc	Protospacer
*    *************** *****.  

125. spacer 1.8|44619|29|NZ_ALUH01000019|CRISPRCasFinder matches to GU071094 (Synechococcus phage S-SM1, complete genome) position: , mismatch: 8, identity: 0.724

acgacttcgttttcttcgatttctgacca	CRISPR spacer
gtcattttgttttcttcgatttctgattt	Protospacer
.. *.**.******************.. 

126. spacer 1.10|44751|29|NZ_ALUH01000019|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.724

catactgggctttcttgaccgcttccaga	CRISPR spacer
ttgactgggctttcttgacggcatccttt	Protospacer
.  **************** ** ***   

127. spacer 1.11|44817|29|NZ_ALUH01000019|CRISPRCasFinder matches to NZ_CP021785 (Acinetobacter baumannii strain A85 plasmid pA85-1b, complete sequence) position: , mismatch: 8, identity: 0.724

aaatacactctataagttgaaaactcaaa	CRISPR spacer
cttcattttctataagttgcaaactcaaa	Protospacer
   .*. .*********** *********

128. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NC_028838 (Clostridium phage phiCD506, complete genome) position: , mismatch: 9, identity: 0.7

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaag	Protospacer
. *.. .*************.*******..

129. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to HM568888 (Clostridium phage phiCD38-2, complete genome) position: , mismatch: 9, identity: 0.7

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaag	Protospacer
. *.. .*************.*******..

130. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NC_028958 (Clostridium phage phiCD146, complete genome) position: , mismatch: 9, identity: 0.7

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaag	Protospacer
. *.. .*************.*******..

131. spacer 1.3|44619|30|NZ_ALUH01000019|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.7

acgacttcgttttcttcgatttctgaccat	CRISPR spacer
acgaattcgttgtcttcgatttccagattg	Protospacer
**** ****** ***********... .  

132. spacer 1.3|44619|30|NZ_ALUH01000019|CRT matches to MH319731 (Marine virus AG-345-E02 Ga0172268_11 genomic sequence) position: , mismatch: 9, identity: 0.7

acgacttcgttttcttcgatttctgaccat	CRISPR spacer
aatcgttcgttttcttcgatgtctgatgcg	Protospacer
*    *************** *****.   

133. spacer 1.3|44619|30|NZ_ALUH01000019|CRT matches to GU071094 (Synechococcus phage S-SM1, complete genome) position: , mismatch: 9, identity: 0.7

acgacttcgttttcttcgatttctgaccat	CRISPR spacer
gtcattttgttttcttcgatttctgatttg	Protospacer
.. *.**.******************..  

134. spacer 1.5|44751|30|NZ_ALUH01000019|CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

catactgggctttcttgaccgcttccagat	CRISPR spacer
ttgactgggctttcttgacggcatcctttg	Protospacer
.  **************** ** ***    

135. spacer 1.7|44553|29|NZ_ALUH01000019|CRISPRCasFinder matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 9, identity: 0.69

gatggagtgttagaagaattaaaaagaag	CRISPR spacer
atgagagtcttagaagaattaaaaattct	Protospacer
.  .**** ****************    

136. spacer 1.2|44553|30|NZ_ALUH01000019|CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 10, identity: 0.667

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
atgagagtcttagaagaattaaaaattctt	Protospacer
.  .**** ****************     

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 102112 : 120413 19 Streptococcus_phage(80.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage