Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALTY01000014 Streptococcus agalactiae GB00679 ctg7180000005692, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALTY01000032 Streptococcus agalactiae GB00679 ctg7180000005710, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALTY01000010 Streptococcus agalactiae GB00679 ctg7180000005688, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000007 Streptococcus agalactiae GB00679 ctg7180000005685, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000002 Streptococcus agalactiae GB00679 ctg7180000005680, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000022 Streptococcus agalactiae GB00679 ctg7180000005700, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALTY01000018 Streptococcus agalactiae GB00679 ctg7180000005696, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 0 6 0 0
NZ_ALTY01000036 Streptococcus agalactiae GB00679 ctg7180000005714, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALTY01000034 Streptococcus agalactiae GB00679 ctg7180000005712, whole genome shotgun sequence 0 crisprs cas3 0 0 2 0
NZ_ALTY01000019 Streptococcus agalactiae GB00679 ctg7180000005697, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000037 Streptococcus agalactiae GB00679 ctg7180000005715, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000040 Streptococcus agalactiae GB00679 ctg7180000005718, whole genome shotgun sequence 0 crisprs csm6 0 0 0 0
NZ_ALTY01000003 Streptococcus agalactiae GB00679 ctg7180000005681, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000001 Streptococcus agalactiae GB00679 ctg7180000005679, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000006 Streptococcus agalactiae GB00679 ctg7180000005684, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000027 Streptococcus agalactiae GB00679 ctg7180000005705, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_ALTY01000026 Streptococcus agalactiae GB00679 ctg7180000005704, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALTY01000021 Streptococcus agalactiae GB00679 ctg7180000005699, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000025 Streptococcus agalactiae GB00679 ctg7180000005703, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000004 Streptococcus agalactiae GB00679 ctg7180000005682, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000008 Streptococcus agalactiae GB00679 ctg7180000005686, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000013 Streptococcus agalactiae GB00679 ctg7180000005691, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000011 Streptococcus agalactiae GB00679 ctg7180000005689, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000033 Streptococcus agalactiae GB00679 ctg7180000005711, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000015 Streptococcus agalactiae GB00679 ctg7180000005693, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000005 Streptococcus agalactiae GB00679 ctg7180000005683, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000038 Streptococcus agalactiae GB00679 ctg7180000005716, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALTY01000035 Streptococcus agalactiae GB00679 ctg7180000005713, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000017 Streptococcus agalactiae GB00679 ctg7180000005695, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000028 Streptococcus agalactiae GB00679 ctg7180000005706, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_ALTY01000020 Streptococcus agalactiae GB00679 ctg7180000005698, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000029 Streptococcus agalactiae GB00679 ctg7180000005707, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_ALTY01000016 Streptococcus agalactiae GB00679 ctg7180000005694, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000023 Streptococcus agalactiae GB00679 ctg7180000005701, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000031 Streptococcus agalactiae GB00679 ctg7180000005709, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000039 Streptococcus agalactiae GB00679 ctg7180000005717, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000012 Streptococcus agalactiae GB00679 ctg7180000005690, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000030 Streptococcus agalactiae GB00679 ctg7180000005708, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000009 Streptococcus agalactiae GB00679 ctg7180000005687, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTY01000024 Streptococcus agalactiae GB00679 ctg7180000005702, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ALTY01000028
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 66625 : 75618 8 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_2 128119 : 137502 9 uncultured_Caudovirales_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALTY01000032
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 23483 : 35548 8 Synechococcus_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALTY01000018
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALTY01000018_1 43765-44394 TypeII II-A
9 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALTY01000018_1 1.2|43867|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 43867-43896 30 NZ_KJ951051 Streptococcus dysgalactiae subsp. equisimilis strain G279 plasmid pG279, complete sequence 1764-1793 0 1.0
NZ_ALTY01000018_1 1.4|43999|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 43999-44028 30 KY065486 Streptococcus phage IPP46, complete genome 7129-7158 0 1.0
NZ_ALTY01000018_1 1.4|43999|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 43999-44028 30 FR671411 Streptococcus phage 2167 29060-29089 0 1.0
NZ_ALTY01000018_1 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44065-44094 30 MK448742 Streptococcus phage Javan37, complete genome 15382-15411 0 1.0
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 JX409894 Streptococcus phage LYGO9, complete genome 38216-38245 0 1.0
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 MH853356 Streptococcus phage LF2, partial genome 7600-7629 0 1.0
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 MK448837 Streptococcus phage Javan10, complete genome 7942-7971 0 1.0
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 MK448742 Streptococcus phage Javan37, complete genome 8431-8460 0 1.0
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 MK448851 Streptococcus phage Javan14, complete genome 11606-11635 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 JX409894 Streptococcus phage LYGO9, complete genome 31161-31190 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448971 Streptococcus phage Javan52, complete genome 17509-17538 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448829 Streptococcus phage Javan7, complete genome 14358-14387 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448736 Streptococcus phage Javan35, complete genome 14828-14857 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448956 Streptococcus phage Javan48, complete genome 16397-16426 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448781 Streptococcus phage Javan5, complete genome 16850-16879 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448749 Streptococcus phage Javan39, complete genome 16483-16512 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MH853355 Streptococcus phage LF1, complete genome 5215-5244 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448938 Streptococcus phage Javan44, complete genome 14829-14858 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MH853356 Streptococcus phage LF2, partial genome 1515-1544 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448911 Streptococcus phage Javan34, complete genome 14828-14857 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448837 Streptococcus phage Javan10, complete genome 12886-12915 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448742 Streptococcus phage Javan37, complete genome 14664-14693 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MH853358 Streptococcus phage LF4, complete genome 5215-5244 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448851 Streptococcus phage Javan14, complete genome 16770-16799 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448916 Streptococcus phage Javan36, complete genome 14828-14857 0 1.0
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448673 Streptococcus phage Javan119, complete genome 16121-16150 0 1.0
NZ_ALTY01000018_1 1.4|43999|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 43999-44028 30 KY065465 Streptococcus phage IPP24, complete genome 6277-6306 1 0.967
NZ_ALTY01000018_1 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44065-44094 30 MK448837 Streptococcus phage Javan10, complete genome 13592-13621 1 0.967
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 MK449010 Streptococcus phage Javan90, complete genome 8833-8862 1 0.967
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 MK448833 Streptococcus phage Javan87, complete genome 8833-8862 1 0.967
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448796 Streptococcus phage Javan53, complete genome 19246-19275 1 0.967
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448859 Streptococcus phage Javan170, complete genome 17030-17059 1 0.967
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448672 Streptococcus phage Javan117, complete genome 12142-12171 1 0.967
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448686 Streptococcus phage Javan157, complete genome 16294-16323 1 0.967
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448854 Streptococcus phage Javan146, complete genome 17049-17078 1 0.967
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448676 Streptococcus phage Javan131, complete genome 19550-19579 1 0.967
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 MK448688 Streptococcus phage Javan161, complete genome 16983-17012 1 0.967
NZ_ALTY01000018_1 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44065-44094 30 MK448829 Streptococcus phage Javan7, complete genome 15064-15093 2 0.933
NZ_ALTY01000018_1 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44065-44094 30 MK448736 Streptococcus phage Javan35, complete genome 15546-15575 2 0.933
NZ_ALTY01000018_1 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44065-44094 30 MK448781 Streptococcus phage Javan5, complete genome 17568-17597 2 0.933
NZ_ALTY01000018_1 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44065-44094 30 MH853355 Streptococcus phage LF1, complete genome 5921-5950 2 0.933
NZ_ALTY01000018_1 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44065-44094 30 MK448938 Streptococcus phage Javan44, complete genome 15547-15576 2 0.933
NZ_ALTY01000018_1 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44065-44094 30 MK448911 Streptococcus phage Javan34, complete genome 15546-15575 2 0.933
NZ_ALTY01000018_1 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44065-44094 30 MH853358 Streptococcus phage LF4, complete genome 5921-5950 2 0.933
NZ_ALTY01000018_1 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44065-44094 30 MK448916 Streptococcus phage Javan36, complete genome 15546-15575 2 0.933
NZ_ALTY01000018_1 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44065-44094 30 MK448755 Streptococcus phage Javan423, complete genome 15837-15866 3 0.9
NZ_ALTY01000018_1 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44065-44094 30 MK448756 Streptococcus phage Javan425, complete genome 15837-15866 3 0.9
NZ_ALTY01000018_1 1.4|43999|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 43999-44028 30 MK448763 Streptococcus phage Javan451, complete genome 6861-6890 6 0.8
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 NZ_KM521836 Staphylococcus epidermidis strain 12-00322 plasmid p12-00322, complete sequence 11677-11706 6 0.8
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 CP030483 Staphylococcus aureus strain ER03913.3 plasmid unnamed2, complete sequence 31342-31371 6 0.8
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 668902-668931 6 0.8
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 NZ_CP032752 Lactobacillus plantarum subsp. argentoratensis strain DSM 16365 plasmid unnamed1, complete sequence 30229-30258 7 0.767
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 NZ_CP035135 Lactobacillus plantarum strain SRCM103311 plasmid unnamed4 69444-69473 7 0.767
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 MN693208 Marine virus AFVG_25M383, complete genome 16271-16300 7 0.767
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 MN101223 Klebsiella phage KOX10, complete genome 13181-13210 7 0.767
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 MN693725 Marine virus AFVG_250M494, complete genome 42590-42619 7 0.767
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 MN101224 Klebsiella phage KOX11, complete genome 3699-3728 7 0.767
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 KT001919 Klebsiella phage Miro, complete genome 138215-138244 7 0.767
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 HQ918180 Klebsiella phage KP27, complete genome 135038-135067 7 0.767
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 KT001918 Klebsiella phage Matisse, complete genome 138027-138056 7 0.767
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 LT607758 Klebsiella phage PMBT1 genome assembly, complete genome: monopartite 136600-136629 7 0.767
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 KX130727 Escherichia phage phT4A, partial genome 131133-131162 7 0.767
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 KT321315 Enterobacter phage phiEap-3, complete genome 136043-136072 7 0.767
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 MN101221 Klebsiella phage KOX8, complete genome 12515-12544 7 0.767
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 GU295964 Klebsiella phage KP15, complete genome 136387-136416 7 0.767
NZ_ALTY01000018_1 1.6|44131|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44131-44160 30 MN043730 Bacillus phage vB_BveM-Goe7, complete genome 133347-133376 8 0.733
NZ_ALTY01000018_1 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44263-44292 30 NZ_CP040856 Lactobacillus johnsonii strain G2A plasmid unnamed2, complete sequence 11100-11129 8 0.733
NZ_ALTY01000018_1 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder 44329-44358 30 JX409895 Streptococcus phage JX01, complete genome 43007-43028 8 0.733

1. spacer 1.2|43867|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ951051 (Streptococcus dysgalactiae subsp. equisimilis strain G279 plasmid pG279, complete sequence) position: , mismatch: 0, identity: 1.0

agggtttagggggcacaaacaggctcattt	CRISPR spacer
agggtttagggggcacaaacaggctcattt	Protospacer
******************************

2. spacer 1.4|43999|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to KY065486 (Streptococcus phage IPP46, complete genome) position: , mismatch: 0, identity: 1.0

acaaggaaaagctagtgatgaggagcttgc	CRISPR spacer
acaaggaaaagctagtgatgaggagcttgc	Protospacer
******************************

3. spacer 1.4|43999|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to FR671411 (Streptococcus phage 2167) position: , mismatch: 0, identity: 1.0

acaaggaaaagctagtgatgaggagcttgc	CRISPR spacer
acaaggaaaagctagtgatgaggagcttgc	Protospacer
******************************

4. spacer 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 0, identity: 1.0

atcgggtctatatgccccctaaaatcaatt	CRISPR spacer
atcgggtctatatgccccctaaaatcaatt	Protospacer
******************************

5. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 0, identity: 1.0

tcattacttgtatttataaatgatttagca	CRISPR spacer
tcattacttgtatttataaatgatttagca	Protospacer
******************************

6. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 0, identity: 1.0

tcattacttgtatttataaatgatttagca	CRISPR spacer
tcattacttgtatttataaatgatttagca	Protospacer
******************************

7. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 0, identity: 1.0

tcattacttgtatttataaatgatttagca	CRISPR spacer
tcattacttgtatttataaatgatttagca	Protospacer
******************************

8. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 0, identity: 1.0

tcattacttgtatttataaatgatttagca	CRISPR spacer
tcattacttgtatttataaatgatttagca	Protospacer
******************************

9. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 0, identity: 1.0

tcattacttgtatttataaatgatttagca	CRISPR spacer
tcattacttgtatttataaatgatttagca	Protospacer
******************************

10. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

11. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

12. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448829 (Streptococcus phage Javan7, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

13. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

14. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

15. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

16. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

17. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MH853355 (Streptococcus phage LF1, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

18. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

19. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

20. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

21. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

22. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

23. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MH853358 (Streptococcus phage LF4, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

24. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

25. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

26. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 0, identity: 1.0

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattaa	Protospacer
******************************

27. spacer 1.4|43999|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to KY065465 (Streptococcus phage IPP24, complete genome) position: , mismatch: 1, identity: 0.967

acaaggaaaagctagtgatgaggagcttgc	CRISPR spacer
gcaaggaaaagctagtgatgaggagcttgc	Protospacer
.*****************************

28. spacer 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 1, identity: 0.967

atcgggtctatatgccccctaaaatcaatt	CRISPR spacer
atcgggtctatatgcctcctaaaatcaatt	Protospacer
****************.*************

29. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK449010 (Streptococcus phage Javan90, complete genome) position: , mismatch: 1, identity: 0.967

tcattacttgtatttataaatgatttagca	CRISPR spacer
tcattacttgtatttataaataatttagca	Protospacer
*********************.********

30. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448833 (Streptococcus phage Javan87, complete genome) position: , mismatch: 1, identity: 0.967

tcattacttgtatttataaatgatttagca	CRISPR spacer
tcattacttgtatttataaataatttagca	Protospacer
*********************.********

31. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 1, identity: 0.967

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgtgattga	Protospacer
****************************.*

32. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448859 (Streptococcus phage Javan170, complete genome) position: , mismatch: 1, identity: 0.967

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgcgattaa	Protospacer
***********************.******

33. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448672 (Streptococcus phage Javan117, complete genome) position: , mismatch: 1, identity: 0.967

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgcgattaa	Protospacer
***********************.******

34. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448686 (Streptococcus phage Javan157, complete genome) position: , mismatch: 1, identity: 0.967

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgcgattaa	Protospacer
***********************.******

35. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448854 (Streptococcus phage Javan146, complete genome) position: , mismatch: 1, identity: 0.967

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgcgattaa	Protospacer
***********************.******

36. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448676 (Streptococcus phage Javan131, complete genome) position: , mismatch: 1, identity: 0.967

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgcgattaa	Protospacer
***********************.******

37. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448688 (Streptococcus phage Javan161, complete genome) position: , mismatch: 1, identity: 0.967

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaacgcgattaa	Protospacer
***********************.******

38. spacer 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448829 (Streptococcus phage Javan7, complete genome) position: , mismatch: 2, identity: 0.933

atcgggtctatatgccccctaaaatcaatt	CRISPR spacer
atagggtctatatgccccttaaaatcaatt	Protospacer
** ***************.***********

39. spacer 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 2, identity: 0.933

atcgggtctatatgccccctaaaatcaatt	CRISPR spacer
atagggtctatatgccccttaaaatcaatt	Protospacer
** ***************.***********

40. spacer 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 2, identity: 0.933

atcgggtctatatgccccctaaaatcaatt	CRISPR spacer
atagggtctatatgccccttaaaatcaatt	Protospacer
** ***************.***********

41. spacer 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MH853355 (Streptococcus phage LF1, complete genome) position: , mismatch: 2, identity: 0.933

atcgggtctatatgccccctaaaatcaatt	CRISPR spacer
atagggtctatatgccccttaaaatcaatt	Protospacer
** ***************.***********

42. spacer 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 2, identity: 0.933

atcgggtctatatgccccctaaaatcaatt	CRISPR spacer
atagggtctatatgccccttaaaatcaatt	Protospacer
** ***************.***********

43. spacer 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 2, identity: 0.933

atcgggtctatatgccccctaaaatcaatt	CRISPR spacer
atagggtctatatgccccttaaaatcaatt	Protospacer
** ***************.***********

44. spacer 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MH853358 (Streptococcus phage LF4, complete genome) position: , mismatch: 2, identity: 0.933

atcgggtctatatgccccctaaaatcaatt	CRISPR spacer
atagggtctatatgccccttaaaatcaatt	Protospacer
** ***************.***********

45. spacer 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 2, identity: 0.933

atcgggtctatatgccccctaaaatcaatt	CRISPR spacer
atagggtctatatgccccttaaaatcaatt	Protospacer
** ***************.***********

46. spacer 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448755 (Streptococcus phage Javan423, complete genome) position: , mismatch: 3, identity: 0.9

atcgggtctatatgccccctaaaatcaatt	CRISPR spacer
gctgggtctatatgccccctaaaatcaatt	Protospacer
...***************************

47. spacer 1.5|44065|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448756 (Streptococcus phage Javan425, complete genome) position: , mismatch: 3, identity: 0.9

atcgggtctatatgccccctaaaatcaatt	CRISPR spacer
gctgggtctatatgccccctaaaatcaatt	Protospacer
...***************************

48. spacer 1.4|43999|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK448763 (Streptococcus phage Javan451, complete genome) position: , mismatch: 6, identity: 0.8

acaaggaaaagctagtgatgaggagcttgc	CRISPR spacer
tcaaggtaaagcaagtgatgaggaattagc	Protospacer
 ***** ***** ***********..* **

49. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KM521836 (Staphylococcus epidermidis strain 12-00322 plasmid p12-00322, complete sequence) position: , mismatch: 6, identity: 0.8

tcattacttgtatttataaatgatttagca	CRISPR spacer
tcattaatggtatttataaatgaatcatcg	Protospacer
****** * ************** *.* *.

50. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to CP030483 (Staphylococcus aureus strain ER03913.3 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

tcattacttgtatttataaatgatttagca	CRISPR spacer
tcattaatggtatttataaatgaatcatcg	Protospacer
****** * ************** *.* *.

51. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.8

tcattacttgtatttataaatgatttagca	CRISPR spacer
tcattatttttatttataaatgaaatatta	Protospacer
******.** *************  ** .*

52. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032752 (Lactobacillus plantarum subsp. argentoratensis strain DSM 16365 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tcattacttgtatttataaatgatttagca	CRISPR spacer
tatatctttgtatttagaaatgatttagcc	Protospacer
*   * .********* ************ 

53. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035135 (Lactobacillus plantarum strain SRCM103311 plasmid unnamed4) position: , mismatch: 7, identity: 0.767

tcattacttgtatttataaatgatttagca	CRISPR spacer
tatatttttgtatttagaaatgatttagcc	Protospacer
*   * .********* ************ 

54. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MN693208 (Marine virus AFVG_25M383, complete genome) position: , mismatch: 7, identity: 0.767

tcattacttgtatttataaatgatttagca	CRISPR spacer
gaagcatttgaattaataaatgatttagca	Protospacer
  * .*.*** *** ***************

55. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MN101223 (Klebsiella phage KOX10, complete genome) position: , mismatch: 7, identity: 0.767

tcattacttgtatttataaatgatttagca	CRISPR spacer
ttagatcttgaatttataaatgatttatga	Protospacer
*.*   **** ****************  *

56. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MN693725 (Marine virus AFVG_250M494, complete genome) position: , mismatch: 7, identity: 0.767

tcattacttgtatttataaatgatttagca	CRISPR spacer
tctgccattgtatttataaatgctttacca	Protospacer
**  .  *************** **** **

57. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MN101224 (Klebsiella phage KOX11, complete genome) position: , mismatch: 7, identity: 0.767

tcattacttgtatttataaatgatttagca	CRISPR spacer
ttagatcttgaatttataaatgatttatga	Protospacer
*.*   **** ****************  *

58. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to KT001919 (Klebsiella phage Miro, complete genome) position: , mismatch: 7, identity: 0.767

tcattacttgtatttataaatgatttagca	CRISPR spacer
ttagatcttgaatttataaatgatttatga	Protospacer
*.*   **** ****************  *

59. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to HQ918180 (Klebsiella phage KP27, complete genome) position: , mismatch: 7, identity: 0.767

tcattacttgtatttataaatgatttagca	CRISPR spacer
ttagatcttgaatttataaatgatttatga	Protospacer
*.*   **** ****************  *

60. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to KT001918 (Klebsiella phage Matisse, complete genome) position: , mismatch: 7, identity: 0.767

tcattacttgtatttataaatgatttagca	CRISPR spacer
ttagatcttgaatttataaatgatttatga	Protospacer
*.*   **** ****************  *

61. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to LT607758 (Klebsiella phage PMBT1 genome assembly, complete genome: monopartite) position: , mismatch: 7, identity: 0.767

tcattacttgtatttataaatgatttagca	CRISPR spacer
ttagatcttgaatttataaatgatttatga	Protospacer
*.*   **** ****************  *

62. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to KX130727 (Escherichia phage phT4A, partial genome) position: , mismatch: 7, identity: 0.767

tcattacttgtatttataaatgatttagca	CRISPR spacer
ttagatcttgaatttataaatgatttatga	Protospacer
*.*   **** ****************  *

63. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to KT321315 (Enterobacter phage phiEap-3, complete genome) position: , mismatch: 7, identity: 0.767

tcattacttgtatttataaatgatttagca	CRISPR spacer
ttagatcttgaatttataaatgatttatga	Protospacer
*.*   **** ****************  *

64. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MN101221 (Klebsiella phage KOX8, complete genome) position: , mismatch: 7, identity: 0.767

tcattacttgtatttataaatgatttagca	CRISPR spacer
ttagatcttgaatttataaatgatttatga	Protospacer
*.*   **** ****************  *

65. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to GU295964 (Klebsiella phage KP15, complete genome) position: , mismatch: 7, identity: 0.767

tcattacttgtatttataaatgatttagca	CRISPR spacer
ttagatcttgaatttataaatgatttatga	Protospacer
*.*   **** ****************  *

66. spacer 1.6|44131|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to MN043730 (Bacillus phage vB_BveM-Goe7, complete genome) position: , mismatch: 8, identity: 0.733

agtctaatcgcctattattatccagataaa---	CRISPR spacer
agtctaagcgcctattattat---agcatagtc	Protospacer
******* *************   ...* *   

67. spacer 1.8|44263|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040856 (Lactobacillus johnsonii strain G2A plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

tcattacttgtatttataaatgatttagca	CRISPR spacer
gttgcatttgtatttataaaggatttagcg	Protospacer
 .  .*.************* ********.

68. spacer 1.9|44329|30|NZ_ALTY01000018|CRT,PILER-CR,CRISPRCasFinder matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 8, identity: 0.733

atagacccatcacgaatcgaacgtgattaa	CRISPR spacer
atagacccatcacgaatcgaac--------	Protospacer
**********************        

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ALTY01000022
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 71513 : 81786 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALTY01000038
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALTY01000038.1|WP_000384271.1|65514_65841_+|hypothetical-protein 65514_65841_+ 108 aa aa AcrIIA21 NA NA No NA
6. NZ_ALTY01000026
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 58508 : 69242 16 Streptococcus_phage(84.62%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALTY01000034
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 26679 : 31723 8 Streptococcus_phage(85.71%) NA NA
DBSCAN-SWA_2 50806 : 57980 8 Staphylococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage