Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALTZ01000017 Streptococcus agalactiae GB00864 ctg7180000005681, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000031 Streptococcus agalactiae GB00864 ctg7180000005695, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000038 Streptococcus agalactiae GB00864 ctg7180000005702, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000022 Streptococcus agalactiae GB00864 ctg7180000005686, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALTZ01000007 Streptococcus agalactiae GB00864 ctg7180000005671, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000005 Streptococcus agalactiae GB00864 ctg7180000005669, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000015 Streptococcus agalactiae GB00864 ctg7180000005679, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000034 Streptococcus agalactiae GB00864 ctg7180000005698, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000006 Streptococcus agalactiae GB00864 ctg7180000005670, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000027 Streptococcus agalactiae GB00864 ctg7180000005691, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000004 Streptococcus agalactiae GB00864 ctg7180000005668, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALTZ01000003 Streptococcus agalactiae GB00864 ctg7180000005667, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000030 Streptococcus agalactiae GB00864 ctg7180000005694, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000018 Streptococcus agalactiae GB00864 ctg7180000005682, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALTZ01000008 Streptococcus agalactiae GB00864 ctg7180000005672, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALTZ01000033 Streptococcus agalactiae GB00864 ctg7180000005697, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALTZ01000028 Streptococcus agalactiae GB00864 ctg7180000005692, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALTZ01000025 Streptococcus agalactiae GB00864 ctg7180000005689, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000012 Streptococcus agalactiae GB00864 ctg7180000005676, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000019 Streptococcus agalactiae GB00864 ctg7180000005683, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALTZ01000020 Streptococcus agalactiae GB00864 ctg7180000005684, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000009 Streptococcus agalactiae GB00864 ctg7180000005673, whole genome shotgun sequence 1 crisprs cas2,cas1,cas4,cas7,cas8c,cas3 0 0 0 0
NZ_ALTZ01000016 Streptococcus agalactiae GB00864 ctg7180000005680, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALTZ01000002 Streptococcus agalactiae GB00864 ctg7180000005666, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000011 Streptococcus agalactiae GB00864 ctg7180000005675, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000035 Streptococcus agalactiae GB00864 ctg7180000005699, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000001 Streptococcus agalactiae GB00864 ctg7180000005665, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000023 Streptococcus agalactiae GB00864 ctg7180000005687, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 0 6 0 0
NZ_ALTZ01000037 Streptococcus agalactiae GB00864 ctg7180000005701, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000032 Streptococcus agalactiae GB00864 ctg7180000005696, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000024 Streptococcus agalactiae GB00864 ctg7180000005688, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALTZ01000021 Streptococcus agalactiae GB00864 ctg7180000005685, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000026 Streptococcus agalactiae GB00864 ctg7180000005690, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000013 Streptococcus agalactiae GB00864 ctg7180000005677, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000039 Streptococcus agalactiae GB00864 ctg7180000005703, whole genome shotgun sequence 0 crisprs csm6 0 0 1 0
NZ_ALTZ01000029 Streptococcus agalactiae GB00864 ctg7180000005693, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTZ01000036 Streptococcus agalactiae GB00864 ctg7180000005700, whole genome shotgun sequence 0 crisprs DEDDh,WYL 0 0 0 0
NZ_ALTZ01000014 Streptococcus agalactiae GB00864 ctg7180000005678, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALTZ01000010 Streptococcus agalactiae GB00864 ctg7180000005674, whole genome shotgun sequence 0 crisprs DinG 0 0 1 0

Results visualization

1. NZ_ALTZ01000018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1635 : 10125 12 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALTZ01000009
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALTZ01000009_1 62258-62355 TypeI I-C
1 spacers
cas2,cas1,cas4,cas7,cas8c,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALTZ01000016
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALTZ01000016.1|WP_000384271.1|15282_15609_-|hypothetical-protein 15282_15609_- 108 aa aa AcrIIA21 NA NA No NA
4. NZ_ALTZ01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1075 : 14051 20 Streptococcus_phage(58.33%) integrase attL 952:971|attR 14886:14905
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALTZ01000033
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11613 : 18817 8 uncultured_Caudovirales_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALTZ01000028
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 44357 : 56422 8 Gordonia_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALTZ01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3733 : 11287 11 Streptococcus_phage(50.0%) integrase,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ALTZ01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 61969 : 72241 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ALTZ01000023
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALTZ01000023_1 21870-22367 TypeII II-A
7 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 MK448790 Streptococcus phage Javan515, complete genome 1780-1809 0 1.0
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 MK448957 Streptococcus phage Javan484, complete genome 1776-1805 0 1.0
NZ_ALTZ01000023_1 1.3|22039|29|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22039-22067 29 MK448865 Streptococcus phage Javan182, complete genome 3299-3327 0 1.0
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 MK448829 Streptococcus phage Javan7, complete genome 23760-23789 0 1.0
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 MK448736 Streptococcus phage Javan35, complete genome 24243-24272 0 1.0
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 MK448781 Streptococcus phage Javan5, complete genome 26265-26294 0 1.0
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 MH853355 Streptococcus phage LF1, complete genome 14617-14646 0 1.0
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 MK448938 Streptococcus phage Javan44, complete genome 24244-24273 0 1.0
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 MK448911 Streptococcus phage Javan34, complete genome 24243-24272 0 1.0
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 MK448837 Streptococcus phage Javan10, complete genome 22289-22318 0 1.0
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 MK448742 Streptococcus phage Javan37, complete genome 24080-24109 0 1.0
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 MH853358 Streptococcus phage LF4, complete genome 14617-14646 0 1.0
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 MK448916 Streptococcus phage Javan36, complete genome 24243-24272 0 1.0
NZ_ALTZ01000023_1 1.3|22039|29|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22039-22067 29 MK448795 Streptococcus phage Javan527, complete genome 5598-5626 1 0.966
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 NC_031245 Bacillus phage SP-15, complete genome 4409-4438 5 0.833
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NZ_CP021887 Helicobacter apodemus strain SCJK1 plasmid unnamed, complete sequence 23990-24019 6 0.8
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_042112 Campylobacter phage CP81, complete genome 65375-65404 6 0.8
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_015464 Campylobacter phage NCTC12673, complete genome 110180-110209 6 0.8
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 KF148616 Campylobacter phage CP8, complete genome 63306-63335 6 0.8
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_016562 Campylobacter phage CPX, complete genome 63073-63102 6 0.8
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 KX236333 Campylobacter phage PC14, complete genome 10137-10166 6 0.8
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 JX569801 Campylobacter phage CP30A, complete genome 110808-110837 6 0.8
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 MG029511 Staphylococcus phage phiSa2wa_st30, complete genome 21095-21124 6 0.8
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 NC_009751 Lactococcus lactis subsp. lactis K214 plasmid pK214, complete sequence 18502-18531 6 0.8
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 NC_020237 Staphylococcus hyicus plasmid pSTE1 complete sequence 1253-1282 6 0.8
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 NZ_CP047431 Spiroplasma citri strain BLH-13 plasmid pSciBLH13-3, complete sequence 29055-29084 6 0.8
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 NZ_CP046369 Spiroplasma citri strain BR12 plasmid pScpBR12-1, complete sequence 48911-48940 6 0.8
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 NZ_CP046372 Spiroplasma citri strain LB 319 plasmid pScpLB319-1, complete sequence 2789-2818 6 0.8
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 NZ_CP047439 Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-2, complete sequence 18123-18152 6 0.8
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 NZ_CP047440 Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-3, complete sequence 27483-27512 6 0.8
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 NZ_CP047427 Spiroplasma citri strain C189 plasmid pScpC189-1, complete sequence 19427-19456 6 0.8
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 NZ_CP053310 Spiroplasma citri strain C5 plasmid pScpC5-6, complete sequence 37167-37196 6 0.8
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 NZ_CP042474 Spiroplasma citri strain CC-2 plasmid pScpCC2-2, complete sequence 9361-9390 6 0.8
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NZ_CP009254 Buchnera aphidicola (Aphis glycines) strain BAg plasmid pLeu clone SA-pLeu, complete sequence 4131-4160 7 0.767
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 NC_011256 Borrelia duttonii Ly plasmid pl70, complete sequence 14901-14930 7 0.767
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 JN638751 Bacillus phage G, complete genome 84396-84425 7 0.767
NZ_ALTZ01000023_1 1.5|22170|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22170-22199 30 NZ_CP034165 Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-1, complete sequence 25871-25900 7 0.767
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 NC_007930 Lactobacillus salivarius UCC118 plasmid pMP118, complete sequence 34134-34163 7 0.767
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 CP002037 Lactobacillus salivarius CECT 5713 plasmid pHN3, complete sequence 34348-34377 7 0.767
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 KT878766 Staphylococcus phage P1105, complete genome 41667-41696 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 AY508486 Bacteriophage 77, complete genome 41191-41220 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_005356 Staphylococcus phage 77, complete genome 41191-41220 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_048681 Staphylococcus phage phiSa2wa_st22, complete genome 14704-14733 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 MG029512 Staphylococcus phage phiSa2wa_st59, complete genome 18085-18114 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 GQ398772 Staphylococcus phage P954, complete genome 18200-18229 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 KF831354 Staphylococcus phage phiBU01, complete genome 26094-26123 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_048710 Staphylococcus phage SA1014ruMSSAST7, complete genome 17264-17293 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 AP011955 Staphylococcus phage phi5967PVL DNA, complete genome 18239-18268 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 DQ530361 Staphylococcus aureus phage phiNM3, complete genome 17178-17207 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_025460 Staphylococcus phage phiSa119, complete genome 16878-16907 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 KJ452292 Staphylococcus phage 23MRA, complete genome 457-486 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_023499 Staphylococcus phage StauST398-4, complete genome 18298-18327 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_048635 Staphylococcus phage P630, complete genome 39833-39862 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_048713 Staphylococcus aureus phage SA345ruMSSAST8, complete genome 17809-17838 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_048634 Staphylococcus phage P282, complete genome 41390-41419 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 AP011956 Staphylococcus phage phi7247PVL DNA, complete genome 18239-18268 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_008617 Staphylococcus phage phiNM3, complete genome 17178-17207 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_048657 Staphylococcus phage IME1361_01, complete genome 17840-17869 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 MK496812 Capybara microvirus Cap3_SP_554, complete genome 2252-2281 8 0.733
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 FM164764 Stygiolobus rod-shaped virus, complete genome 71-100 8 0.733
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 FM164764 Stygiolobus rod-shaped virus, complete genome 27997-28026 8 0.733
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 KP869105 Escherichia coli O157 typing phage 7, partial genome 90193-90222 8 0.733
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 MN693395 Marine virus AFVG_25M229, complete genome 14721-14750 8 0.733
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 MK327936 Escherichia phage vB_EcoM_G2540, complete genome 72227-72256 8 0.733
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 MF001360 Escherichia phage ECO4, partial genome 82983-83012 8 0.733
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 HM997020 Escherichia phage wV7, complete genome 71500-71529 8 0.733
NZ_ALTZ01000023_1 1.7|22302|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22302-22331 30 NZ_CP013941 Cronobacter malonaticus LMG 23826 plasmid pCMA1, complete sequence 118622-118651 8 0.733
NZ_ALTZ01000023_1 1.7|22302|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22302-22331 30 NC_023024 Cronobacter malonaticus plasmid p1, complete sequence 113254-113283 8 0.733
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NZ_CP028891 Borrelia turcica IST7 plasmid lp27, complete sequence 9397-9426 9 0.7
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_004740 Staphylococcus prophage phiN315, complete genome 17243-17272 9 0.7
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 MK448824 Streptococcus phage Javan637, complete genome 5457-5486 9 0.7
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 MK449002 Streptococcus phage Javan642, complete genome 5457-5486 9 0.7
NZ_ALTZ01000023_1 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22104-22133 30 MK449003 Streptococcus phage Javan648, complete genome 5457-5486 9 0.7
NZ_ALTZ01000023_1 1.5|22170|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22170-22199 30 NZ_LR214999 Mycoplasma conjunctivae strain NCTC10147 plasmid 3 80176-80205 9 0.7
NZ_ALTZ01000023_1 1.5|22170|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22170-22199 30 LR214965 Mycoplasma fermentans strain NCTC10117 genome assembly, plasmid: 11 69768-69797 9 0.7
NZ_ALTZ01000023_1 1.5|22170|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22170-22199 30 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 389408-389437 9 0.7
NZ_ALTZ01000023_1 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder 22236-22265 30 AJ344259 Sulfolobus virus SIRV-2 genomic DNA 26220-26249 9 0.7
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 NC_004758 Neisseria meningitidis plasmid pJS-B, complete sequence 4552-4581 10 0.667
NZ_ALTZ01000023_1 1.1|21906|30|NZ_ALTZ01000023|CRT 21906-21935 30 ADWM02000138 Neisseria meningitidis K1207 plasmid, complete sequence, whole genome shotgun sequence 3014-3043 10 0.667

1. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to MK448790 (Streptococcus phage Javan515, complete genome) position: , mismatch: 0, identity: 1.0

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ctagtatcagatttatatttaaaagctaga	Protospacer
******************************

2. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to MK448957 (Streptococcus phage Javan484, complete genome) position: , mismatch: 0, identity: 1.0

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ctagtatcagatttatatttaaaagctaga	Protospacer
******************************

3. spacer 1.3|22039|29|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MK448865 (Streptococcus phage Javan182, complete genome) position: , mismatch: 0, identity: 1.0

ttagaccttgtaaaaagttccctaacgca	CRISPR spacer
ttagaccttgtaaaaagttccctaacgca	Protospacer
*****************************

4. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MK448829 (Streptococcus phage Javan7, complete genome) position: , mismatch: 0, identity: 1.0

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
gaaatggtttcaacaatgtttgataatcaa	Protospacer
******************************

5. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 0, identity: 1.0

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
gaaatggtttcaacaatgtttgataatcaa	Protospacer
******************************

6. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 0, identity: 1.0

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
gaaatggtttcaacaatgtttgataatcaa	Protospacer
******************************

7. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MH853355 (Streptococcus phage LF1, complete genome) position: , mismatch: 0, identity: 1.0

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
gaaatggtttcaacaatgtttgataatcaa	Protospacer
******************************

8. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 0, identity: 1.0

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
gaaatggtttcaacaatgtttgataatcaa	Protospacer
******************************

9. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 0, identity: 1.0

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
gaaatggtttcaacaatgtttgataatcaa	Protospacer
******************************

10. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 0, identity: 1.0

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
gaaatggtttcaacaatgtttgataatcaa	Protospacer
******************************

11. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 0, identity: 1.0

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
gaaatggtttcaacaatgtttgataatcaa	Protospacer
******************************

12. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MH853358 (Streptococcus phage LF4, complete genome) position: , mismatch: 0, identity: 1.0

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
gaaatggtttcaacaatgtttgataatcaa	Protospacer
******************************

13. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 0, identity: 1.0

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
gaaatggtttcaacaatgtttgataatcaa	Protospacer
******************************

14. spacer 1.3|22039|29|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MK448795 (Streptococcus phage Javan527, complete genome) position: , mismatch: 1, identity: 0.966

ttagaccttgtaaaaagttccctaacgca	CRISPR spacer
ttagaccttgtaaaaagttccctaatgca	Protospacer
*************************.***

15. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NC_031245 (Bacillus phage SP-15, complete genome) position: , mismatch: 5, identity: 0.833

acaagataatttagtaatttaggaaaatat	CRISPR spacer
tcaagatactttagtaatttagaaaataat	Protospacer
 ******* *************.***  **

16. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NZ_CP021887 (Helicobacter apodemus strain SCJK1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
gaattttcagattcatttttaaaagctaga	Protospacer
  * * *******.** *************

17. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_042112 (Campylobacter phage CP81, complete genome) position: , mismatch: 6, identity: 0.8

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
aaattatcagatttatatttaaatcctaaa	Protospacer
  * *******************  ***.*

18. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_015464 (Campylobacter phage NCTC12673, complete genome) position: , mismatch: 6, identity: 0.8

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
aaattatcagatttatatttaaatcctaaa	Protospacer
  * *******************  ***.*

19. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to KF148616 (Campylobacter phage CP8, complete genome) position: , mismatch: 6, identity: 0.8

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
aaattatcagatttatatttaaatcctaaa	Protospacer
  * *******************  ***.*

20. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_016562 (Campylobacter phage CPX, complete genome) position: , mismatch: 6, identity: 0.8

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
aaattatcagatttatatttaaatcctaaa	Protospacer
  * *******************  ***.*

21. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to KX236333 (Campylobacter phage PC14, complete genome) position: , mismatch: 6, identity: 0.8

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
aaattatcagatttatatttaaatcctaaa	Protospacer
  * *******************  ***.*

22. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to JX569801 (Campylobacter phage CP30A, complete genome) position: , mismatch: 6, identity: 0.8

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
aaattatcagatttatatttaaatcctaaa	Protospacer
  * *******************  ***.*

23. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MG029511 (Staphylococcus phage phiSa2wa_st30, complete genome) position: , mismatch: 6, identity: 0.8

-gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
cgttat-ttttctgcaatgtttgataatcaa	Protospacer
 *  **  **** .*****************

24. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NC_009751 (Lactococcus lactis subsp. lactis K214 plasmid pK214, complete sequence) position: , mismatch: 6, identity: 0.8

acaagataatttagtaatttaggaaaatat	CRISPR spacer
taaagataatttagtaattcaagaaattgt	Protospacer
  *****************.*.**** *.*

25. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NC_020237 (Staphylococcus hyicus plasmid pSTE1 complete sequence) position: , mismatch: 6, identity: 0.8

acaagataatttagtaatttaggaaaatat	CRISPR spacer
taaagataatttagtaattcaagaaattgt	Protospacer
  *****************.*.**** *.*

26. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047431 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-3, complete sequence) position: , mismatch: 6, identity: 0.8

acaagataatttagtaatttaggaaaatat	CRISPR spacer
aaataaaaatttaataattttggaaaatat	Protospacer
* * .* ******.****** *********

27. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046369 (Spiroplasma citri strain BR12 plasmid pScpBR12-1, complete sequence) position: , mismatch: 6, identity: 0.8

acaagataatttagtaatttaggaaaatat	CRISPR spacer
aaataaaaatttaataattttggaaaatat	Protospacer
* * .* ******.****** *********

28. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046372 (Spiroplasma citri strain LB 319 plasmid pScpLB319-1, complete sequence) position: , mismatch: 6, identity: 0.8

acaagataatttagtaatttaggaaaatat	CRISPR spacer
aaataaaaatttaataattttggaaaatat	Protospacer
* * .* ******.****** *********

29. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047439 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-2, complete sequence) position: , mismatch: 6, identity: 0.8

acaagataatttagtaatttaggaaaatat	CRISPR spacer
aaataaaaatttaataattttggaaaatat	Protospacer
* * .* ******.****** *********

30. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047440 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-3, complete sequence) position: , mismatch: 6, identity: 0.8

acaagataatttagtaatttaggaaaatat	CRISPR spacer
aaataaaaatttaataattttggaaaatat	Protospacer
* * .* ******.****** *********

31. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047427 (Spiroplasma citri strain C189 plasmid pScpC189-1, complete sequence) position: , mismatch: 6, identity: 0.8

acaagataatttagtaatttaggaaaatat	CRISPR spacer
aaataaaaatttaataattttggaaaatat	Protospacer
* * .* ******.****** *********

32. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053310 (Spiroplasma citri strain C5 plasmid pScpC5-6, complete sequence) position: , mismatch: 6, identity: 0.8

acaagataatttagtaatttaggaaaatat	CRISPR spacer
aaataaaaatttaataattttggaaaatat	Protospacer
* * .* ******.****** *********

33. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042474 (Spiroplasma citri strain CC-2 plasmid pScpCC2-2, complete sequence) position: , mismatch: 6, identity: 0.8

acaagataatttagtaatttaggaaaatat	CRISPR spacer
aaataaaaatttaataattttggaaaatat	Protospacer
* * .* ******.****** *********

34. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NZ_CP009254 (Buchnera aphidicola (Aphis glycines) strain BAg plasmid pLeu clone SA-pLeu, complete sequence) position: , mismatch: 7, identity: 0.767

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
gaagtaacatatttatatttaaaaggaaaa	Protospacer
  **** ** ***************  *.*

35. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NC_011256 (Borrelia duttonii Ly plasmid pl70, complete sequence) position: , mismatch: 7, identity: 0.767

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
cagcttctttcaacaattttttataatcaa	Protospacer
 *. *  ********** *** ********

36. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to JN638751 (Bacillus phage G, complete genome) position: , mismatch: 7, identity: 0.767

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
gaaaaggtttcaacaatggttgaagaaaag	Protospacer
**** ************* **** .*  *.

37. spacer 1.5|22170|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034165 (Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-1, complete sequence) position: , mismatch: 7, identity: 0.767

ggatttttattgtcgactgctttattaaaa	CRISPR spacer
ggttttttattgtcgacggctttttgtgca	Protospacer
** ************** ***** *  . *

38. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NC_007930 (Lactobacillus salivarius UCC118 plasmid pMP118, complete sequence) position: , mismatch: 7, identity: 0.767

acaagataatttagtaatttaggaaaatat	CRISPR spacer
tgatgataatttagtaattaagggaaacaa	Protospacer
  * *************** ***.***.* 

39. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to CP002037 (Lactobacillus salivarius CECT 5713 plasmid pHN3, complete sequence) position: , mismatch: 7, identity: 0.767

acaagataatttagtaatttaggaaaatat	CRISPR spacer
tgatgataatttagtaattaagggaaacaa	Protospacer
  * *************** ***.***.* 

40. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to KT878766 (Staphylococcus phage P1105, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

41. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to AY508486 (Bacteriophage 77, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

42. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_005356 (Staphylococcus phage 77, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

43. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_048681 (Staphylococcus phage phiSa2wa_st22, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

44. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to MG029512 (Staphylococcus phage phiSa2wa_st59, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

45. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to GQ398772 (Staphylococcus phage P954, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

46. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to KF831354 (Staphylococcus phage phiBU01, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

47. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_048710 (Staphylococcus phage SA1014ruMSSAST7, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

48. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to AP011955 (Staphylococcus phage phi5967PVL DNA, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

49. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to DQ530361 (Staphylococcus aureus phage phiNM3, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

50. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_025460 (Staphylococcus phage phiSa119, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

51. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to KJ452292 (Staphylococcus phage 23MRA, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

52. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_023499 (Staphylococcus phage StauST398-4, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

53. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_048635 (Staphylococcus phage P630, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

54. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_048713 (Staphylococcus aureus phage SA345ruMSSAST8, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

55. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_048634 (Staphylococcus phage P282, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

56. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to AP011956 (Staphylococcus phage phi7247PVL DNA, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

57. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_008617 (Staphylococcus phage phiNM3, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

58. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_048657 (Staphylococcus phage IME1361_01, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaagttatta	Protospacer
.************ *********. .   *

59. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to MK496812 (Capybara microvirus Cap3_SP_554, complete genome) position: , mismatch: 8, identity: 0.733

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagaatcagatttatatctaaaattagca	Protospacer
.*** *************.***** . . *

60. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to FM164764 (Stygiolobus rod-shaped virus, complete genome) position: , mismatch: 8, identity: 0.733

acaagataatttagtaatttaggaaaatat	CRISPR spacer
atttcctaatttaggaatttaggaaattag	Protospacer
*.    ******** *********** ** 

61. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to FM164764 (Stygiolobus rod-shaped virus, complete genome) position: , mismatch: 8, identity: 0.733

acaagataatttagtaatttaggaaaatat	CRISPR spacer
atttcctaatttaggaatttaggaaattag	Protospacer
*.    ******** *********** ** 

62. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to KP869105 (Escherichia coli O157 typing phage 7, partial genome) position: , mismatch: 8, identity: 0.733

acaagataatttagtaatttaggaaaatat	CRISPR spacer
atcaacacatttattaatttaggaaaataa	Protospacer
*. *.   ***** *************** 

63. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MN693395 (Marine virus AFVG_25M229, complete genome) position: , mismatch: 8, identity: 0.733

acaagataatttagtaatttaggaaaatat	CRISPR spacer
cagaccaaatttattaatttatgaaaatat	Protospacer
  .*   ****** ******* ********

64. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MK327936 (Escherichia phage vB_EcoM_G2540, complete genome) position: , mismatch: 8, identity: 0.733

acaagataatttagtaatttaggaaaatat	CRISPR spacer
atcaacacatttattaatttaggaaaataa	Protospacer
*. *.   ***** *************** 

65. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MF001360 (Escherichia phage ECO4, partial genome) position: , mismatch: 8, identity: 0.733

acaagataatttagtaatttaggaaaatat	CRISPR spacer
atcaacacatttattaatttaggaaaataa	Protospacer
*. *.   ***** *************** 

66. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to HM997020 (Escherichia phage wV7, complete genome) position: , mismatch: 8, identity: 0.733

acaagataatttagtaatttaggaaaatat	CRISPR spacer
atcaacacatttattaatttaggaaaataa	Protospacer
*. *.   ***** *************** 

67. spacer 1.7|22302|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013941 (Cronobacter malonaticus LMG 23826 plasmid pCMA1, complete sequence) position: , mismatch: 8, identity: 0.733

tcctcacgacggataaagcgtaaaagatct	CRISPR spacer
agttcacgacggataaaacgtaaataaacg	Protospacer
  .**************.****** .* * 

68. spacer 1.7|22302|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NC_023024 (Cronobacter malonaticus plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

tcctcacgacggataaagcgtaaaagatct	CRISPR spacer
agttcacgacggataaaacgtaaataaacg	Protospacer
  .**************.****** .* * 

69. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NZ_CP028891 (Borrelia turcica IST7 plasmid lp27, complete sequence) position: , mismatch: 9, identity: 0.7

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
tcagtatcagatttatctttaaataattcc	Protospacer
..************** ****** . *   

70. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_004740 (Staphylococcus prophage phiN315, complete genome) position: , mismatch: 9, identity: 0.7

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
ttagtatcagattaatatttaaggttatta	Protospacer
.************ ********.. .   *

71. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MK448824 (Streptococcus phage Javan637, complete genome) position: , mismatch: 9, identity: 0.7

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
tttcatatttcaacaaagtttgataatgaa	Protospacer
      .********* ********** **

72. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MK449002 (Streptococcus phage Javan642, complete genome) position: , mismatch: 9, identity: 0.7

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
tttcatatttcaacaaagtttgataatgaa	Protospacer
      .********* ********** **

73. spacer 1.4|22104|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to MK449003 (Streptococcus phage Javan648, complete genome) position: , mismatch: 9, identity: 0.7

gaaatggtttcaacaatgtttgataatcaa	CRISPR spacer
tttcatatttcaacaaagtttgataatgaa	Protospacer
      .********* ********** **

74. spacer 1.5|22170|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR214999 (Mycoplasma conjunctivae strain NCTC10147 plasmid 3) position: , mismatch: 9, identity: 0.7

ggatttttattgtcgactgctttattaaaa	CRISPR spacer
taggttttattgttgacggctttattagtg	Protospacer
 .. *********.*** *********. .

75. spacer 1.5|22170|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to LR214965 (Mycoplasma fermentans strain NCTC10117 genome assembly, plasmid: 11) position: , mismatch: 9, identity: 0.7

ggatttttattgtcgactgctttattaaaa	CRISPR spacer
taggttttattgttgacggctttattagtg	Protospacer
 .. *********.*** *********. .

76. spacer 1.5|22170|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.7

ggatttttattgtcgactgctttattaaaa	CRISPR spacer
ccattattattgccgactgctttatgtggt	Protospacer
  *** ******.************  .. 

77. spacer 1.6|22236|30|NZ_ALTZ01000023|CRT,PILER-CR,CRISPRCasFinder matches to AJ344259 (Sulfolobus virus SIRV-2 genomic DNA) position: , mismatch: 9, identity: 0.7

acaagataatttagtaatttaggaaaatat	CRISPR spacer
tatcaataatttaataatttatgaaaatta	Protospacer
    .********.******* ******  

78. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to NC_004758 (Neisseria meningitidis plasmid pJS-B, complete sequence) position: , mismatch: 10, identity: 0.667

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
gacatatcagatttaaatttaaaagaccct	Protospacer
   .*********** ********* .   

79. spacer 1.1|21906|30|NZ_ALTZ01000023|CRT matches to ADWM02000138 (Neisseria meningitidis K1207 plasmid, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.667

ctagtatcagatttatatttaaaagctaga	CRISPR spacer
gacatatcagatttaaatttaaaagaccct	Protospacer
   .*********** ********* .   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_ALTZ01000039
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 97983 : 106971 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage