Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALQI01000001 Streptococcus agalactiae FSL F2-343 ctg120001034281, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQI01000004 Streptococcus agalactiae FSL F2-343 ctg120001034284, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQI01000017 Streptococcus agalactiae FSL F2-343 ctg120001034297, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 0 3 2 0
NZ_ALQI01000002 Streptococcus agalactiae FSL F2-343 ctg120001034282, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALQI01000006 Streptococcus agalactiae FSL F2-343 ctg120001034286, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALQI01000012 Streptococcus agalactiae FSL F2-343 ctg120001034292, whole genome shotgun sequence 1 crisprs csm6 0 0 0 0
NZ_ALQI01000003 Streptococcus agalactiae FSL F2-343 ctg120001034283, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQI01000005 Streptococcus agalactiae FSL F2-343 ctg120001034285, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQI01000013 Streptococcus agalactiae FSL F2-343 ctg120001034293, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALQI01000014 Streptococcus agalactiae FSL F2-343 ctg120001034294, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQI01000007 Streptococcus agalactiae FSL F2-343 ctg120001034287, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALQI01000015 Streptococcus agalactiae FSL F2-343 ctg120001034295, whole genome shotgun sequence 1 crisprs NA 2 2 1 0
NZ_ALQI01000009 Streptococcus agalactiae FSL F2-343 ctg120001034289, whole genome shotgun sequence 0 crisprs DinG 0 0 1 0
NZ_ALQI01000016 Streptococcus agalactiae FSL F2-343 ctg120001034296, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQI01000010 Streptococcus agalactiae FSL F2-343 ctg120001034290, whole genome shotgun sequence 0 crisprs cas3,csa3 0 0 1 0
NZ_ALQI01000011 Streptococcus agalactiae FSL F2-343 ctg120001034291, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALQI01000008 Streptococcus agalactiae FSL F2-343 ctg120001034288, whole genome shotgun sequence 1 crisprs WYL,DEDDh 3 2 1 0

Results visualization

1. NZ_ALQI01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 45283 : 55555 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALQI01000013
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 24508 : 78609 65 Streptococcus_phage(71.74%) holin,terminase,tRNA,tail,portal,integrase attL 32132:32149|attR 73156:73173
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALQI01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALQI01000002.1|WP_000384271.1|15499_15826_-|hypothetical-protein 15499_15826_- 108 aa aa AcrIIA21 NA NA No NA
4. NZ_ALQI01000017
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALQI01000017_1 187854-188004 TypeII II-A
2 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MK448956 Streptococcus phage Javan48, complete genome 33902-33926 1 0.96
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 JX409894 Streptococcus phage LYGO9, complete genome 13217-13241 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MK448971 Streptococcus phage Javan52, complete genome 35892-35916 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MK448829 Streptococcus phage Javan7, complete genome 30585-30609 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MK448736 Streptococcus phage Javan35, complete genome 31056-31080 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MK448781 Streptococcus phage Javan5, complete genome 33078-33102 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MK448749 Streptococcus phage Javan39, complete genome 35484-35508 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MH853355 Streptococcus phage LF1, complete genome 21442-21466 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 JX409895 Streptococcus phage JX01, complete genome 25064-25088 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MK448938 Streptococcus phage Javan44, complete genome 31057-31081 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MN693096 Marine virus AFVG_25M80, complete genome 24964-24988 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MH853356 Streptococcus phage LF2, partial genome 27499-27523 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MK448911 Streptococcus phage Javan34, complete genome 31056-31080 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MK448837 Streptococcus phage Javan10, complete genome 29114-29138 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MH853358 Streptococcus phage LF4, complete genome 21442-21466 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MK448916 Streptococcus phage Javan36, complete genome 31056-31080 2 0.92
NZ_ALQI01000017_1 1.1|187895|25|NZ_ALQI01000017|PILER-CR 187895-187919 25 MK448851 Streptococcus phage Javan14, complete genome 34852-34876 3 0.88
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP035396 Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence 5261-5287 3 0.889
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP032856 Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence 45544-45570 3 0.889
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_MG557999 Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence 51741-51767 4 0.852
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_MF497781 Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence 51741-51767 4 0.852
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP039703 Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence 73252-73278 4 0.852
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 620825-620851 4 0.852
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 384736-384762 4 0.852
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 384775-384801 4 0.852
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 192959-192985 4 0.852
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_AP019717 Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence 659241-659267 4 0.852
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP035396 Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence 5260-5287 4 0.857
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP032856 Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence 45544-45571 4 0.857
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 KC465899 Pelagibacter phage HTVC008M, complete genome 125204-125231 4 0.857
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_KR091915 Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence 42924-42950 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP012100 Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence 417640-417666 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP025915 Escherichia coli strain 203740 plasmid p203740_35, complete sequence 8596-8622 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_LS999564 Escherichia coli isolate EC-TO143 plasmid 5, complete sequence 684-710 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_LN824136 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671 16676-16702 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP054370 Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence 19259-19285 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP006640 Escherichia coli PCN061 plasmid PCN061p4, complete sequence 5959-5985 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP029801 Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence 7886-7912 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP015505 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence 27843-27869 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP026060 Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence 16878-16904 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP024853 Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence 328-354 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_LT985287 Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence 31255-31281 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP028999 Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence 14731-14757 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP027258 Escherichia coli strain EC11 plasmid unnamed3, complete sequence 21719-21745 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP019200 Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence 31779-31805 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP023823 Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence 16676-16702 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP026025 Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence 33043-33069 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP018988 Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence 684-710 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_MK033500 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence 7493-7519 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_MK033501 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence 55792-55818 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_MK033499 Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence 107900-107926 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 MT074138 Bacteroides phage DAC17, complete genome 95750-95776 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 MT074136 Bacteroides phage DAC15, complete genome 96340-96366 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 MN693256 Marine virus AFVG_25M339, complete genome 27550-27576 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP009352 Francisella tularensis subsp. novicida F6168 plasmid unnamed, complete sequence 2299-2325 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NC_004952 Francisella novicida plasmid pFNL10, complete sequence 111-137 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP031220 Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence 96112-96138 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NC_002109 Francisella tularensis plasmid pOM1, complete sequence 111-137 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 MN855807 Siphoviridae sp. isolate 122, partial genome 13520-13546 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 LC494302 Escherichia phage SP27 DNA, complete genome 245482-245508 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 MK817115 Escherichia phage vB_EcoM_phAPEC6, complete genome 230964-230990 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NC_027364 Escherichia phage PBECO 4, complete genome 39409-39435 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 MH383160 Escherichia phage UB, complete genome 99996-100022 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 MK327931 Escherichia phage vB_EcoM_G17, complete genome 256258-256284 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 LT603033 Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I 187105-187131 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 KM507819 Escherichia phage 121Q, complete genome 246581-246607 5 0.815
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 FJ429185 Lactococcus phage P087, complete genome 18716-18742 5 0.815
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_MG557999 Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence 51740-51767 5 0.821
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_MF497781 Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence 51740-51767 5 0.821
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP012100 Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence 417639-417666 5 0.821
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 MT074138 Bacteroides phage DAC17, complete genome 95749-95776 5 0.821
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 MT074136 Bacteroides phage DAC15, complete genome 96339-96366 5 0.821
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP046030 Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence 15567-15594 5 0.821
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 AP014166 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C61-MedDCM-OCT-S46-C82, *** SEQUENCING IN PROGRESS *** 5438-5465 5 0.821
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP051681 Cohnella sp. MFER-1 plasmid unnamed1 74377-74403 6 0.778
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 HQ683709 Planktothrix phage PaV-LD, complete genome 72164-72190 6 0.778
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 MK448636 Streptococcus satellite phage Javan749, complete genome 10389-10415 6 0.778
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 MN693101 Marine virus AFVG_25M559, complete genome 25634-25660 6 0.778
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 KT725776 Bacillus phage vB_BceS-MY192, partial genome 2351-2377 6 0.778
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_KR091915 Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence 42923-42950 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP025915 Escherichia coli strain 203740 plasmid p203740_35, complete sequence 8596-8623 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_LS999564 Escherichia coli isolate EC-TO143 plasmid 5, complete sequence 684-711 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_LN824136 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671 16675-16702 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP039703 Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence 73251-73278 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 620825-620852 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP054370 Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence 19258-19285 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP006640 Escherichia coli PCN061 plasmid PCN061p4, complete sequence 5959-5986 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP029801 Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence 7886-7913 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP015505 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence 27842-27869 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 384736-384763 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 384775-384802 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP026060 Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence 16877-16904 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP024853 Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence 328-355 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_LT985287 Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence 31255-31282 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP028999 Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence 14730-14757 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP027258 Escherichia coli strain EC11 plasmid unnamed3, complete sequence 21718-21745 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP019200 Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence 31779-31806 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 192958-192985 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP023823 Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence 16675-16702 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_AP019717 Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence 659241-659268 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP026025 Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence 33042-33069 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP018988 Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence 684-711 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_MK033500 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence 7493-7520 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_MK033501 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence 55792-55819 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_MK033499 Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence 107900-107927 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 MN693256 Marine virus AFVG_25M339, complete genome 27550-27577 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP009352 Francisella tularensis subsp. novicida F6168 plasmid unnamed, complete sequence 2299-2326 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_LR215001 Mycoplasma conjunctivae strain NCTC10147 plasmid 5 7235-7262 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP051681 Cohnella sp. MFER-1 plasmid unnamed1 74376-74403 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NC_004952 Francisella novicida plasmid pFNL10, complete sequence 110-137 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP031220 Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence 96111-96138 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NC_002109 Francisella tularensis plasmid pOM1, complete sequence 110-137 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 MN855807 Siphoviridae sp. isolate 122, partial genome 13520-13547 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 LC494302 Escherichia phage SP27 DNA, complete genome 245482-245509 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 MK817115 Escherichia phage vB_EcoM_phAPEC6, complete genome 230963-230990 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NC_027364 Escherichia phage PBECO 4, complete genome 39408-39435 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 MH383160 Escherichia phage UB, complete genome 99995-100022 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 MK327931 Escherichia phage vB_EcoM_G17, complete genome 256257-256284 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 MN871445 UNVERIFIED: Serratia phage KpHz_2, complete genome 75797-75824 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 MN871444 UNVERIFIED: Serratia phage KpGz_1, complete genome 13324-13351 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 LT603033 Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I 187105-187132 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 KM507819 Escherichia phage 121Q, complete genome 246581-246608 6 0.786
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 FJ429185 Lactococcus phage P087, complete genome 18716-18743 6 0.786
NZ_ALQI01000017_1 1.2|187961|27|NZ_ALQI01000017|PILER-CR 187961-187987 27 NZ_CP046030 Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence 15567-15593 7 0.741
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_CP039286 Leptospira interrogans strain FMAS_AW1 plasmid pLiSL3, complete sequence 70941-70968 7 0.75
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 NZ_LR214953 Mycoplasma neurolyticum strain NCTC10166 plasmid 3 5510-5537 7 0.75
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 HQ683709 Planktothrix phage PaV-LD, complete genome 72164-72191 7 0.75
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 MK448636 Streptococcus satellite phage Javan749, complete genome 10389-10416 7 0.75
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 MN693101 Marine virus AFVG_25M559, complete genome 25633-25660 7 0.75
NZ_ALQI01000017_1 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder 187939-187966 28 KT725776 Bacillus phage vB_BceS-MY192, partial genome 2351-2378 7 0.75

1. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 1, identity: 0.96

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaacaaatgattttgtacca	Protospacer
*** *********************

2. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaaaaaatgattttgtacca	Protospacer
*** **** ****************

3. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaaaaaatgattttgtacca	Protospacer
*** **** ****************

4. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MK448829 (Streptococcus phage Javan7, complete genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaaaaaatgattttgtacca	Protospacer
*** **** ****************

5. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaaaaaatgattttgtacca	Protospacer
*** **** ****************

6. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaaaaaatgattttgtacca	Protospacer
*** **** ****************

7. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaaaaaatgattttgtacca	Protospacer
*** **** ****************

8. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MH853355 (Streptococcus phage LF1, complete genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaaaaaatgattttgtacca	Protospacer
*** **** ****************

9. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaaaaaatgattttgtacca	Protospacer
*** **** ****************

10. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaaaaaatgattttgtacca	Protospacer
*** **** ****************

11. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MN693096 (Marine virus AFVG_25M80, complete genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agaaacaacaaatgattttgtacca	Protospacer
** * ********************

12. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaaaaaatgattttgtacca	Protospacer
*** **** ****************

13. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaaaaaatgattttgtacca	Protospacer
*** **** ****************

14. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaaaaaatgattttgtacca	Protospacer
*** **** ****************

15. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MH853358 (Streptococcus phage LF4, complete genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaaaaaatgattttgtacca	Protospacer
*** **** ****************

16. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 2, identity: 0.92

agtaccaacaaatgattttgtacca	CRISPR spacer
agtcccaaaaaatgattttgtacca	Protospacer
*** **** ****************

17. spacer 1.1|187895|25|NZ_ALQI01000017|PILER-CR matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 3, identity: 0.88

agtaccaacaaatgattttgtacca	CRISPR spacer
agaaccaacaaataattttgtaccg	Protospacer
** **********.**********.

18. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP035396 (Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.889

aatgttcttttttaaaatctttcatgt	CRISPR spacer
caagttcttttttaaaatcattcatgt	Protospacer
 * **************** *******

19. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP032856 (Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.889

aatgttcttttttaaaatctttcatgt	CRISPR spacer
caagttcttttttaaaatcattcatgt	Protospacer
 * **************** *******

20. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 4, identity: 0.852

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttaaaatctttcaccc	Protospacer
** *********************. .

21. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 4, identity: 0.852

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttaaaatctttcaccc	Protospacer
** *********************. .

22. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 4, identity: 0.852

-aatgttcttttttaaaatctttcatgt	CRISPR spacer
tagtact-ttttttaaaatctttcatgt	Protospacer
 *.*..* ********************

23. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 4, identity: 0.852

-aatgttcttttttaaaatctttcatgt	CRISPR spacer
tagtact-ttttttaaaatctttcatgt	Protospacer
 *.*..* ********************

24. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 4, identity: 0.852

-aatgttcttttttaaaatctttcatgt	CRISPR spacer
tagtact-ttttttaaaatctttcatgt	Protospacer
 *.*..* ********************

25. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 4, identity: 0.852

-aatgttcttttttaaaatctttcatgt	CRISPR spacer
tagtact-ttttttaaaatctttcatgt	Protospacer
 *.*..* ********************

26. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 4, identity: 0.852

-aatgttcttttttaaaatctttcatgt	CRISPR spacer
tagtact-ttttttaaaatctttcatgt	Protospacer
 *.*..* ********************

27. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 4, identity: 0.852

-aatgttcttttttaaaatctttcatgt	CRISPR spacer
tagtact-ttttttaaaatctttcatgt	Protospacer
 *.*..* ********************

28. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP035396 (Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ccaagttcttttttaaaatcattcatgt	Protospacer
  * **************** *******

29. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP032856 (Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ccaagttcttttttaaaatcattcatgt	Protospacer
  * **************** *******

30. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to KC465899 (Pelagibacter phage HTVC008M, complete genome) position: , mismatch: 4, identity: 0.857

aaatgttcttttttaaaatctttcatgt-	CRISPR spacer
aaatctacttttttaaaatcttt-atatt	Protospacer
**** * **************** **.* 

31. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_KR091915 (Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

32. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP012100 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
taaatgattttttaaaatctttcatgt	Protospacer
 * .*  ********************

33. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP025915 (Escherichia coli strain 203740 plasmid p203740_35, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

34. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_LS999564 (Escherichia coli isolate EC-TO143 plasmid 5, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

35. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_LN824136 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

36. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP054370 (Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

37. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP006640 (Escherichia coli PCN061 plasmid PCN061p4, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

38. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP029801 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

39. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP015505 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

40. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP026060 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

41. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP024853 (Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

42. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

43. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP028999 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

44. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP027258 (Escherichia coli strain EC11 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

45. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP019200 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

46. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP023823 (Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

47. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

48. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP018988 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

49. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_MK033500 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

50. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_MK033501 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

51. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aaggttcttttttgaaatctttcaccc	Protospacer
** **********.**********. .

52. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to MT074138 (Bacteroides phage DAC17, complete genome) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
tatgttcttttttaaagtcttgcattg	Protospacer
 ***************.**** ***  

53. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to MT074136 (Bacteroides phage DAC15, complete genome) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
tatgttcttttttaaagtcttgcattg	Protospacer
 ***************.**** ***  

54. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to MN693256 (Marine virus AFVG_25M339, complete genome) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
cttcttctttttttaaatctttcatgc	Protospacer
  * ********* ************.

55. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP009352 (Francisella tularensis subsp. novicida F6168 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
tattctcttttttaaaatcgttcatgc	Protospacer
 ** .************** ******.

56. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NC_004952 (Francisella novicida plasmid pFNL10, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
tattctcttttttaaaatcgttcatgc	Protospacer
 ** .************** ******.

57. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP031220 (Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
tttgttctgttttaaaatctttaatat	Protospacer
  ****** ************* **.*

58. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NC_002109 (Francisella tularensis plasmid pOM1, complete sequence) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
tattctcttttttaaaatcgttcatgc	Protospacer
 ** .************** ******.

59. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to MN855807 (Siphoviridae sp. isolate 122, partial genome) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
agtaatcttttttaatatctttcatgg	Protospacer
*.*. ********** ********** 

60. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to LC494302 (Escherichia phage SP27 DNA, complete genome) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
tctgttcttttttcaaagctttcatat	Protospacer
  *********** *** *******.*

61. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to MK817115 (Escherichia phage vB_EcoM_phAPEC6, complete genome) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
tctgttcttttttcaaagctttcatat	Protospacer
  *********** *** *******.*

62. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NC_027364 (Escherichia phage PBECO 4, complete genome) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
tctgttcttttttcaaagctttcatat	Protospacer
  *********** *** *******.*

63. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to MH383160 (Escherichia phage UB, complete genome) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
tctgttcttttttcaaagctttcatat	Protospacer
  *********** *** *******.*

64. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to MK327931 (Escherichia phage vB_EcoM_G17, complete genome) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
tctgttcttttttcaaagctttcatat	Protospacer
  *********** *** *******.*

65. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to LT603033 (Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
tctgttcttttttcaaagctttcatat	Protospacer
  *********** *** *******.*

66. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
tctgttcttttttcaaagctttcatat	Protospacer
  *********** *** *******.*

67. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to FJ429185 (Lactococcus phage P087, complete genome) position: , mismatch: 5, identity: 0.815

aatgttcttttttaaaatctttcatgt	CRISPR spacer
agtaatcttttttaatatctttcatgg	Protospacer
*.*. ********** ********** 

68. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 5, identity: 0.821

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttaaaatctttcaccc	Protospacer
.** *********************. .

69. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 5, identity: 0.821

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttaaaatctttcaccc	Protospacer
.** *********************. .

70. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP012100 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence) position: , mismatch: 5, identity: 0.821

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ataaatgattttttaaaatctttcatgt	Protospacer
* * .*  ********************

71. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to MT074138 (Bacteroides phage DAC17, complete genome) position: , mismatch: 5, identity: 0.821

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
atatgttcttttttaaagtcttgcattg	Protospacer
* ***************.**** ***  

72. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to MT074136 (Bacteroides phage DAC15, complete genome) position: , mismatch: 5, identity: 0.821

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
atatgttcttttttaaagtcttgcattg	Protospacer
* ***************.**** ***  

73. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP046030 (Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

---aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gctaaa---tcttttctaaaatctttcatgg	Protospacer
   ***   ******.************** 

74. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to AP014166 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C61-MedDCM-OCT-S46-C82, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 5, identity: 0.821

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
aaatcttcttttttagaatctttaactt	Protospacer
**** **********.******* *. *

75. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP051681 (Cohnella sp. MFER-1 plasmid unnamed1) position: , mismatch: 6, identity: 0.778

aatgttcttttttaaaatctttcatgt	CRISPR spacer
ccgtttctttttcaaaatcgttcatgt	Protospacer
    ********.****** *******

76. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to HQ683709 (Planktothrix phage PaV-LD, complete genome) position: , mismatch: 6, identity: 0.778

aatgttcttttttaaaatctttcatgt	CRISPR spacer
ccaattctttgttaaaatctgtcatgt	Protospacer
   .****** ********* ******

77. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 6, identity: 0.778

aatgttcttttttaaaatctttcatgt	CRISPR spacer
agatttcttttttaaaatcttttataa	Protospacer
*.  ******************.**. 

78. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to MN693101 (Marine virus AFVG_25M559, complete genome) position: , mismatch: 6, identity: 0.778

aatgttcttttttaaaatctttcatgt	CRISPR spacer
aatgttcttttttaaattcttctactc	Protospacer
**************** ****..*. .

79. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to KT725776 (Bacillus phage vB_BceS-MY192, partial genome) position: , mismatch: 6, identity: 0.778

aatgttcttttttaaaatctttcatgt	CRISPR spacer
cttgttcttttttaaaatcaatcatcc	Protospacer
  *****************  **** .

80. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_KR091915 (Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

81. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP025915 (Escherichia coli strain 203740 plasmid p203740_35, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

82. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_LS999564 (Escherichia coli isolate EC-TO143 plasmid 5, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

83. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_LN824136 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

84. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
atagtactttttttaaaatctttcatgt	Protospacer
* *   ..********************

85. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
atagtactttttttaaaatctttcatgt	Protospacer
* *   ..********************

86. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP054370 (Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

87. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP006640 (Escherichia coli PCN061 plasmid PCN061p4, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

88. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP029801 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

89. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP015505 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

90. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
atagtactttttttaaaatctttcatgt	Protospacer
* *   ..********************

91. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
atagtactttttttaaaatctttcatgt	Protospacer
* *   ..********************

92. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP026060 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

93. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP024853 (Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

94. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

95. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP028999 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

96. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP027258 (Escherichia coli strain EC11 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

97. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP019200 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

98. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
atagtactttttttaaaatctttcatgt	Protospacer
* *   ..********************

99. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP023823 (Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

100. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
atagtactttttttaaaatctttcatgt	Protospacer
* *   ..********************

101. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

102. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP018988 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

103. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_MK033500 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

104. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_MK033501 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

105. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gaaggttcttttttgaaatctttcaccc	Protospacer
.** **********.**********. .

106. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to MN693256 (Marine virus AFVG_25M339, complete genome) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
tcttcttctttttttaaatctttcatgc	Protospacer
   * ********* ************.

107. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP009352 (Francisella tularensis subsp. novicida F6168 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ctattctcttttttaaaatcgttcatgc	Protospacer
  ** .************** ******.

108. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_LR215001 (Mycoplasma conjunctivae strain NCTC10147 plasmid 5) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
aaatgctcttttttaaaatttttatctt	Protospacer
*****.*************.***  . *

109. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP051681 (Cohnella sp. MFER-1 plasmid unnamed1) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
accgtttctttttcaaaatcgttcatgt	Protospacer
*    ********.****** *******

110. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NC_004952 (Francisella novicida plasmid pFNL10, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ctattctcttttttaaaatcgttcatgc	Protospacer
  ** .************** ******.

111. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP031220 (Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ttttgttctgttttaaaatctttaatat	Protospacer
   ****** ************* **.*

112. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NC_002109 (Francisella tularensis plasmid pOM1, complete sequence) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ctattctcttttttaaaatcgttcatgc	Protospacer
  ** .************** ******.

113. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to MN855807 (Siphoviridae sp. isolate 122, partial genome) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
tagtaatcttttttaatatctttcatgg	Protospacer
 *.*. ********** ********** 

114. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to LC494302 (Escherichia phage SP27 DNA, complete genome) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ttctgttcttttttcaaagctttcatat	Protospacer
   *********** *** *******.*

115. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to MK817115 (Escherichia phage vB_EcoM_phAPEC6, complete genome) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ttctgttcttttttcaaagctttcatat	Protospacer
   *********** *** *******.*

116. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NC_027364 (Escherichia phage PBECO 4, complete genome) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ttctgttcttttttcaaagctttcatat	Protospacer
   *********** *** *******.*

117. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to MH383160 (Escherichia phage UB, complete genome) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ttctgttcttttttcaaagctttcatat	Protospacer
   *********** *** *******.*

118. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to MK327931 (Escherichia phage vB_EcoM_G17, complete genome) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ttctgttcttttttcaaagctttcatat	Protospacer
   *********** *** *******.*

119. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to MN871445 (UNVERIFIED: Serratia phage KpHz_2, complete genome) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
aaatgttctttttttaaatctaagagga	Protospacer
************** ******   * * 

120. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to MN871444 (UNVERIFIED: Serratia phage KpGz_1, complete genome) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
aaatgttctttttttaaatctaagagga	Protospacer
************** ******   * * 

121. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to LT603033 (Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ttctgttcttttttcaaagctttcatat	Protospacer
   *********** *** *******.*

122. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ttctgttcttttttcaaagctttcatat	Protospacer
   *********** *** *******.*

123. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to FJ429185 (Lactococcus phage P087, complete genome) position: , mismatch: 6, identity: 0.786

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
tagtaatcttttttaatatctttcatgg	Protospacer
 *.*. ********** ********** 

124. spacer 1.2|187961|27|NZ_ALQI01000017|PILER-CR matches to NZ_CP046030 (Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.741

aatgttcttttttaaaatctttcatgt	CRISPR spacer
ctaaatcttttctaaaatctttcatgg	Protospacer
   . ******.************** 

125. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_CP039286 (Leptospira interrogans strain FMAS_AW1 plasmid pLiSL3, complete sequence) position: , mismatch: 7, identity: 0.75

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
aaatgttcttttttaaattctactagta	Protospacer
***************** *** ..*   

126. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to NZ_LR214953 (Mycoplasma neurolyticum strain NCTC10166 plasmid 3) position: , mismatch: 7, identity: 0.75

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
aaatgttgttttttaaaatttttatcaa	Protospacer
******* ***********.***  .. 

127. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to HQ683709 (Planktothrix phage PaV-LD, complete genome) position: , mismatch: 7, identity: 0.75

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
gccaattctttgttaaaatctgtcatgt	Protospacer
.   .****** ********* ******

128. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 7, identity: 0.75

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
tagatttcttttttaaaatcttttataa	Protospacer
 *.  ******************.**. 

129. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to MN693101 (Marine virus AFVG_25M559, complete genome) position: , mismatch: 7, identity: 0.75

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
caatgttcttttttaaattcttctactc	Protospacer
 **************** ****..*. .

130. spacer 1.3|187939|28|NZ_ALQI01000017|CRISPRCasFinder matches to KT725776 (Bacillus phage vB_BceS-MY192, partial genome) position: , mismatch: 7, identity: 0.75

aaatgttcttttttaaaatctttcatgt	CRISPR spacer
ccttgttcttttttaaaatcaatcatcc	Protospacer
   *****************  **** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 33678 : 42669 8 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_2 95377 : 104761 9 uncultured_Caudovirales_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALQI01000012
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALQI01000012_1 1529-1604 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALQI01000009
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3829 : 11383 11 Streptococcus_phage(50.0%) transposase,integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALQI01000015
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALQI01000015_1 65028-65741 Orphan NA
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ALQI01000015_1 1.7|65454|18|NZ_ALQI01000015|CRT 65454-65471 18 NZ_ALQI01000015.1 66126-66143 1 0.944
NZ_ALQI01000015_1 1.6|65406|30|NZ_ALQI01000015|CRT 65406-65435 30 NZ_ALQI01000015.1 66294-66323 2 0.933
NZ_ALQI01000015_1 1.7|65454|18|NZ_ALQI01000015|CRT 65454-65471 18 NZ_ALQI01000015.1 66090-66107 2 0.889

1. spacer 1.7|65454|18|NZ_ALQI01000015|CRT matches to position: 66126-66143, mismatch: 1, identity: 0.944

cgatgcactcattgaggc	CRISPR spacer
cgacgcactcattgaggc	Protospacer
***.**************

2. spacer 1.6|65406|30|NZ_ALQI01000015|CRT matches to position: 66294-66323, mismatch: 2, identity: 0.933

ggaagcactcgtacttgcacttgtggaagc	CRISPR spacer
ggatgcactcgtacttgcacttgttgaagc	Protospacer
*** ******************** *****

3. spacer 1.7|65454|18|NZ_ALQI01000015|CRT matches to position: 66090-66107, mismatch: 2, identity: 0.889

cgatgcactcattgaggc	CRISPR spacer
cgaggcactcattgaagc	Protospacer
*** ***********.**

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALQI01000015_1 1.11|65646|30|NZ_ALQI01000015|CRT 65646-65675 30 NC_019418 Streptococcus phage phiNJ2, complete genome 30958-30987 6 0.8
NZ_ALQI01000015_1 1.12|65694|30|NZ_ALQI01000015|CRT 65694-65723 30 NC_019418 Streptococcus phage phiNJ2, complete genome 30958-30987 6 0.8
NZ_ALQI01000015_1 1.11|65646|30|NZ_ALQI01000015|CRT 65646-65675 30 KC171647 Lactobacillus phage PL-1, complete genome 32835-32864 7 0.767
NZ_ALQI01000015_1 1.11|65646|30|NZ_ALQI01000015|CRT 65646-65675 30 NC_022756 Lactobacillus phage J-1, complete genome 34886-34915 7 0.767
NZ_ALQI01000015_1 1.12|65694|30|NZ_ALQI01000015|CRT 65694-65723 30 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 113169-113198 7 0.767
NZ_ALQI01000015_1 1.12|65694|30|NZ_ALQI01000015|CRT 65694-65723 30 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 55316-55345 7 0.767
NZ_ALQI01000015_1 1.12|65694|30|NZ_ALQI01000015|CRT 65694-65723 30 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 63162-63191 7 0.767
NZ_ALQI01000015_1 1.12|65694|30|NZ_ALQI01000015|CRT 65694-65723 30 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 46647-46676 7 0.767
NZ_ALQI01000015_1 1.12|65694|30|NZ_ALQI01000015|CRT 65694-65723 30 NC_019390 Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence 43626-43655 7 0.767
NZ_ALQI01000015_1 1.11|65646|30|NZ_ALQI01000015|CRT 65646-65675 30 KX879752 Halomonas phage QHHSV-1, complete genome 11007-11036 8 0.733
NZ_ALQI01000015_1 1.12|65694|30|NZ_ALQI01000015|CRT 65694-65723 30 KX879752 Halomonas phage QHHSV-1, complete genome 11007-11036 8 0.733

1. spacer 1.11|65646|30|NZ_ALQI01000015|CRT matches to NC_019418 (Streptococcus phage phiNJ2, complete genome) position: , mismatch: 6, identity: 0.8

ggatgcactggtacttgctgacgtggatgc	CRISPR spacer
ggatgcactggtacttgctgaatttgacaa	Protospacer
*********************  * **.. 

2. spacer 1.12|65694|30|NZ_ALQI01000015|CRT matches to NC_019418 (Streptococcus phage phiNJ2, complete genome) position: , mismatch: 6, identity: 0.8

ggatgcactggtacttgctgacgtggaagc	CRISPR spacer
ggatgcactggtacttgctgaatttgacaa	Protospacer
*********************  * ** . 

3. spacer 1.11|65646|30|NZ_ALQI01000015|CRT matches to KC171647 (Lactobacillus phage PL-1, complete genome) position: , mismatch: 7, identity: 0.767

ggatgcactggtacttgctgacgtggatgc	CRISPR spacer
tgatgcactggtaattgctgactatgaaga	Protospacer
 ************ ********   ** * 

4. spacer 1.11|65646|30|NZ_ALQI01000015|CRT matches to NC_022756 (Lactobacillus phage J-1, complete genome) position: , mismatch: 7, identity: 0.767

ggatgcactggtacttgctgacgtggatgc	CRISPR spacer
tgatgcactggtaattgctgactatgaaga	Protospacer
 ************ ********   ** * 

5. spacer 1.12|65694|30|NZ_ALQI01000015|CRT matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ggatgcactggtacttgctgacgtggaagc	CRISPR spacer
gcttgaggcggtacgtgctgacgtggaagc	Protospacer
*  ** . .***** ***************

6. spacer 1.12|65694|30|NZ_ALQI01000015|CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ggatgcactggtacttgctgacgtggaagc	CRISPR spacer
gcttgaggcggtacgtgctgacgtggaagc	Protospacer
*  ** . .***** ***************

7. spacer 1.12|65694|30|NZ_ALQI01000015|CRT matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ggatgcactggtacttgctgacgtggaagc	CRISPR spacer
gcttgaggcggtacgtgctgacgtggaagc	Protospacer
*  ** . .***** ***************

8. spacer 1.12|65694|30|NZ_ALQI01000015|CRT matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

ggatgcactggtacttgctgacgtggaagc	CRISPR spacer
gcttgaggcggtacgtgctgacgtggaagc	Protospacer
*  ** . .***** ***************

9. spacer 1.12|65694|30|NZ_ALQI01000015|CRT matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 7, identity: 0.767

ggatgcactggtacttgctgacgtggaagc	CRISPR spacer
gcttgaggcggtacgtgctgacgtggaagc	Protospacer
*  ** . .***** ***************

10. spacer 1.11|65646|30|NZ_ALQI01000015|CRT matches to KX879752 (Halomonas phage QHHSV-1, complete genome) position: , mismatch: 8, identity: 0.733

ggatgcactggtacttgctgacgtggatgc	CRISPR spacer
ccgggcgctggttcttgctgacgtggacgg	Protospacer
  . **.***** **************.* 

11. spacer 1.12|65694|30|NZ_ALQI01000015|CRT matches to KX879752 (Halomonas phage QHHSV-1, complete genome) position: , mismatch: 8, identity: 0.733

ggatgcactggtacttgctgacgtggaagc	CRISPR spacer
ccgggcgctggttcttgctgacgtggacgg	Protospacer
  . **.***** ************** * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 156412 : 167145 16 Streptococcus_phage(84.62%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ALQI01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 40882 : 48086 8 Streptococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ALQI01000011
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 42708 : 50695 7 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_ALQI01000008
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALQI01000008_1 7894-8115 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ALQI01000008_1 1.1|7912|18|NZ_ALQI01000008|CRT 7912-7929 18 NZ_ALQI01000008.1 7597-7614 0 1.0
NZ_ALQI01000008_1 1.2|7948|18|NZ_ALQI01000008|CRT 7948-7965 18 NZ_ALQI01000008.1 7585-7602 2 0.889
NZ_ALQI01000008_1 1.4|8032|18|NZ_ALQI01000008|CRT 8032-8049 18 NZ_ALQI01000008.1 8104-8121 2 0.889

1. spacer 1.1|7912|18|NZ_ALQI01000008|CRT matches to position: 7597-7614, mismatch: 0, identity: 1.0

caaaccagaggccaaacc	CRISPR spacer
caaaccagaggccaaacc	Protospacer
******************

2. spacer 1.2|7948|18|NZ_ALQI01000008|CRT matches to position: 7585-7602, mismatch: 2, identity: 0.889

taagccagaagctaagcc	CRISPR spacer
taagccagaagccaaacc	Protospacer
************.**.**

3. spacer 1.4|8032|18|NZ_ALQI01000008|CRT matches to position: 8104-8121, mismatch: 2, identity: 0.889

taaaccagaggctaagcc	CRISPR spacer
taaaccagaggccaaacc	Protospacer
************.**.**

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALQI01000008_1 1.5|8068|30|NZ_ALQI01000008|CRT 8068-8097 30 KC206276 Escherichia phage EC1-UPM, complete genome 22910-22939 5 0.833
NZ_ALQI01000008_1 1.5|8068|30|NZ_ALQI01000008|CRT 8068-8097 30 NC_019423 Enterobacter phage IME11, complete genome 38501-38530 5 0.833
NZ_ALQI01000008_1 1.5|8068|30|NZ_ALQI01000008|CRT 8068-8097 30 MN855733 Siphoviridae sp. isolate 355, complete genome 42079-42108 5 0.833
NZ_ALQI01000008_1 1.5|8068|30|NZ_ALQI01000008|CRT 8068-8097 30 KF562340 Escherichia phage vB_EcoP_PhAPEC7, complete genome 23109-23138 5 0.833
NZ_ALQI01000008_1 1.5|8068|30|NZ_ALQI01000008|CRT 8068-8097 30 MH733496 Escherichia phage PGN829.1, complete genome 71459-71488 5 0.833
NZ_ALQI01000008_1 1.5|8068|30|NZ_ALQI01000008|CRT 8068-8097 30 KF192075 Escherichia phage vB_EcoP_PhAPEC5, complete genome 22747-22776 5 0.833
NZ_ALQI01000008_1 1.5|8068|30|NZ_ALQI01000008|CRT 8068-8097 30 MH358458 Escherichia phage phi G17, complete genome 37663-37692 5 0.833
NZ_ALQI01000008_1 1.5|8068|30|NZ_ALQI01000008|CRT 8068-8097 30 MG208881 Escherichia phage St11Ph5, complete genome 24693-24722 5 0.833
NZ_ALQI01000008_1 1.5|8068|30|NZ_ALQI01000008|CRT 8068-8097 30 HQ259105 Escherichia phage vB_EcoP_G7C, complete genome 23927-23956 5 0.833
NZ_ALQI01000008_1 1.5|8068|30|NZ_ALQI01000008|CRT 8068-8097 30 KF620435 Shigella phage pSb-1, complete genome 49000-49029 5 0.833
NZ_ALQI01000008_1 1.3|7984|30|NZ_ALQI01000008|CRT 7984-8013 30 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 468537-468566 6 0.8
NZ_ALQI01000008_1 1.3|7984|30|NZ_ALQI01000008|CRT 7984-8013 30 NC_047926 Lactobacillus phage Semele, complete genome 8768-8797 7 0.767
NZ_ALQI01000008_1 1.3|7984|30|NZ_ALQI01000008|CRT 7984-8013 30 MN694353 Marine virus AFVG_250M583, complete genome 53475-53504 7 0.767
NZ_ALQI01000008_1 1.5|8068|30|NZ_ALQI01000008|CRT 8068-8097 30 MH616814 Microviridae sp. isolate ctjj954, complete genome 2229-2258 9 0.7

1. spacer 1.5|8068|30|NZ_ALQI01000008|CRT matches to KC206276 (Escherichia phage EC1-UPM, complete genome) position: , mismatch: 5, identity: 0.833

---taagtcagaagctaaaccagaggctaagct	CRISPR spacer
gactaa---agaagctaaagcagaggctaacct	Protospacer
   ***   ********** ********** **

2. spacer 1.5|8068|30|NZ_ALQI01000008|CRT matches to NC_019423 (Enterobacter phage IME11, complete genome) position: , mismatch: 5, identity: 0.833

---taagtcagaagctaaaccagaggctaagct	CRISPR spacer
gactaa---agaagctaaagcagaggctaacct	Protospacer
   ***   ********** ********** **

3. spacer 1.5|8068|30|NZ_ALQI01000008|CRT matches to MN855733 (Siphoviridae sp. isolate 355, complete genome) position: , mismatch: 5, identity: 0.833

---taagtcagaagctaaaccagaggctaagct	CRISPR spacer
gactaa---agaagctaaagcagaggctaacct	Protospacer
   ***   ********** ********** **

4. spacer 1.5|8068|30|NZ_ALQI01000008|CRT matches to KF562340 (Escherichia phage vB_EcoP_PhAPEC7, complete genome) position: , mismatch: 5, identity: 0.833

---taagtcagaagctaaaccagaggctaagct	CRISPR spacer
gactaa---agaagctaaagcagaggctaacct	Protospacer
   ***   ********** ********** **

5. spacer 1.5|8068|30|NZ_ALQI01000008|CRT matches to MH733496 (Escherichia phage PGN829.1, complete genome) position: , mismatch: 5, identity: 0.833

---taagtcagaagctaaaccagaggctaagct	CRISPR spacer
gactaa---agaagctaaagcagaggctaacct	Protospacer
   ***   ********** ********** **

6. spacer 1.5|8068|30|NZ_ALQI01000008|CRT matches to KF192075 (Escherichia phage vB_EcoP_PhAPEC5, complete genome) position: , mismatch: 5, identity: 0.833

---taagtcagaagctaaaccagaggctaagct	CRISPR spacer
gactaa---agaagctaaagcagaggctaacct	Protospacer
   ***   ********** ********** **

7. spacer 1.5|8068|30|NZ_ALQI01000008|CRT matches to MH358458 (Escherichia phage phi G17, complete genome) position: , mismatch: 5, identity: 0.833

---taagtcagaagctaaaccagaggctaagct	CRISPR spacer
gactaa---agaagctaaagcagaggctaacct	Protospacer
   ***   ********** ********** **

8. spacer 1.5|8068|30|NZ_ALQI01000008|CRT matches to MG208881 (Escherichia phage St11Ph5, complete genome) position: , mismatch: 5, identity: 0.833

---taagtcagaagctaaaccagaggctaagct	CRISPR spacer
gactaa---agaagctaaagcagaggctaacct	Protospacer
   ***   ********** ********** **

9. spacer 1.5|8068|30|NZ_ALQI01000008|CRT matches to HQ259105 (Escherichia phage vB_EcoP_G7C, complete genome) position: , mismatch: 5, identity: 0.833

---taagtcagaagctaaaccagaggctaagct	CRISPR spacer
gactaa---agaagctaaagcagaggctaacct	Protospacer
   ***   ********** ********** **

10. spacer 1.5|8068|30|NZ_ALQI01000008|CRT matches to KF620435 (Shigella phage pSb-1, complete genome) position: , mismatch: 5, identity: 0.833

---taagtcagaagctaaaccagaggctaagct	CRISPR spacer
gactaa---agaagctaaagcagaggctaacct	Protospacer
   ***   ********** ********** **

11. spacer 1.3|7984|30|NZ_ALQI01000008|CRT matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

caaaccagaagctaagccagacgttaagcc	CRISPR spacer
agaaaaagaagctaagccagaagtgaagcc	Protospacer
 .**  *************** ** *****

12. spacer 1.3|7984|30|NZ_ALQI01000008|CRT matches to NC_047926 (Lactobacillus phage Semele, complete genome) position: , mismatch: 7, identity: 0.767

caaaccagaagctaagccagacgttaagcc	CRISPR spacer
tgaaccagaagctaagccagaagttccagc	Protospacer
..******************* ***  . *

13. spacer 1.3|7984|30|NZ_ALQI01000008|CRT matches to MN694353 (Marine virus AFVG_250M583, complete genome) position: , mismatch: 7, identity: 0.767

caaaccagaagctaagccagacgttaagcc	CRISPR spacer
catgacagaagctaagacagacattaagat	Protospacer
** . *********** *****.***** .

14. spacer 1.5|8068|30|NZ_ALQI01000008|CRT matches to MH616814 (Microviridae sp. isolate ctjj954, complete genome) position: , mismatch: 9, identity: 0.7

taagtcagaagctaaaccagaggctaagct	CRISPR spacer
cagaccagaagcaaaaccagaggctataaa	Protospacer
.*...******* ************* .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 44797 : 66080 27 Streptococcus_phage(95.0%) integrase attL 42427:42447|attR 66962:66982
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage