Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALTB01000005 Streptococcus agalactiae GB00206 ctg7180000004588, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALTB01000007 Streptococcus agalactiae GB00206 ctg7180000004590, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000024 Streptococcus agalactiae GB00206 ctg7180000004607, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000028 Streptococcus agalactiae GB00206 ctg7180000004611, whole genome shotgun sequence 0 crisprs csm6 0 0 0 0
NZ_ALTB01000021 Streptococcus agalactiae GB00206 ctg7180000004604, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 0
NZ_ALTB01000018 Streptococcus agalactiae GB00206 ctg7180000004601, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALTB01000017 Streptococcus agalactiae GB00206 ctg7180000004600, whole genome shotgun sequence 0 crisprs cas3 0 0 1 0
NZ_ALTB01000026 Streptococcus agalactiae GB00206 ctg7180000004609, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000019 Streptococcus agalactiae GB00206 ctg7180000004602, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALTB01000027 Streptococcus agalactiae GB00206 ctg7180000004610, whole genome shotgun sequence 0 crisprs DinG 0 0 1 0
NZ_ALTB01000020 Streptococcus agalactiae GB00206 ctg7180000004603, whole genome shotgun sequence 1 crisprs NA 0 10 0 0
NZ_ALTB01000003 Streptococcus agalactiae GB00206 ctg7180000004586, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALTB01000004 Streptococcus agalactiae GB00206 ctg7180000004587, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000025 Streptococcus agalactiae GB00206 ctg7180000004608, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
NZ_ALTB01000031 Streptococcus agalactiae GB00206 ctg7180000004614, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000023 Streptococcus agalactiae GB00206 ctg7180000004606, whole genome shotgun sequence 1 crisprs NA 2 3 0 0
NZ_ALTB01000012 Streptococcus agalactiae GB00206 ctg7180000004595, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000010 Streptococcus agalactiae GB00206 ctg7180000004593, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALTB01000001 Streptococcus agalactiae GB00206 ctg7180000004584, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000029 Streptococcus agalactiae GB00206 ctg7180000004612, whole genome shotgun sequence 1 crisprs NA 0 1 0 0
NZ_ALTB01000009 Streptococcus agalactiae GB00206 ctg7180000004592, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000013 Streptococcus agalactiae GB00206 ctg7180000004596, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000002 Streptococcus agalactiae GB00206 ctg7180000004585, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000008 Streptococcus agalactiae GB00206 ctg7180000004591, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000022 Streptococcus agalactiae GB00206 ctg7180000004605, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000033 Streptococcus agalactiae GB00206 ctg7180000004616, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000006 Streptococcus agalactiae GB00206 ctg7180000004589, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_ALTB01000011 Streptococcus agalactiae GB00206 ctg7180000004594, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000030 Streptococcus agalactiae GB00206 ctg7180000004613, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000032 Streptococcus agalactiae GB00206 ctg7180000004615, whole genome shotgun sequence 0 crisprs WYL,RT 0 0 0 0
NZ_ALTB01000016 Streptococcus agalactiae GB00206 ctg7180000004599, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000014 Streptococcus agalactiae GB00206 ctg7180000004597, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALTB01000015 Streptococcus agalactiae GB00206 ctg7180000004598, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0

Results visualization

1. NZ_ALTB01000029
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALTB01000029_1 22102-22193 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALTB01000029_1 1.1|22134|28|NZ_ALTB01000029|CRISPRCasFinder 22134-22161 28 CP016197 Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-3, complete sequence 59657-59684 7 0.75

1. spacer 1.1|22134|28|NZ_ALTB01000029|CRISPRCasFinder matches to CP016197 (Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-3, complete sequence) position: , mismatch: 7, identity: 0.75

gccttctgaatcaagctatccttcacgc	CRISPR spacer
tccatatgaatcaagctatccttctttg	Protospacer
 ** * ****************** .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALTB01000023
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALTB01000023_1 8208-8621 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ALTB01000023_1 1.1|8226|18|NZ_ALTB01000023|CRT 8226-8243 18 NZ_ALTB01000023.1 8610-8627 1 0.944
NZ_ALTB01000023_1 1.8|8538|18|NZ_ALTB01000023|CRT 8538-8555 18 NZ_ALTB01000023.1 8610-8627 2 0.889

1. spacer 1.1|8226|18|NZ_ALTB01000023|CRT matches to position: 8610-8627, mismatch: 1, identity: 0.944

agccaaaccagaggccaa	CRISPR spacer
agctaaaccagaggccaa	Protospacer
***.**************

2. spacer 1.8|8538|18|NZ_ALTB01000023|CRT matches to position: 8610-8627, mismatch: 2, identity: 0.889

agctaagccagaggctaa	CRISPR spacer
agctaaaccagaggccaa	Protospacer
******.********.**

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 KC206276 Escherichia phage EC1-UPM, complete genome 22907-22936 5 0.833
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 NC_019423 Enterobacter phage IME11, complete genome 38504-38533 5 0.833
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 MN855733 Siphoviridae sp. isolate 355, complete genome 42082-42111 5 0.833
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 KF562340 Escherichia phage vB_EcoP_PhAPEC7, complete genome 23106-23135 5 0.833
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 MH733496 Escherichia phage PGN829.1, complete genome 71462-71491 5 0.833
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 KF192075 Escherichia phage vB_EcoP_PhAPEC5, complete genome 22744-22773 5 0.833
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 MH358458 Escherichia phage phi G17, complete genome 37666-37695 5 0.833
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 MG208881 Escherichia phage St11Ph5, complete genome 24690-24719 5 0.833
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 HQ259105 Escherichia phage vB_EcoP_G7C, complete genome 23924-23953 5 0.833
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 KF620435 Shigella phage pSb-1, complete genome 48997-49026 5 0.833
NZ_ALTB01000023_1 1.2|8262|30|NZ_ALTB01000023|CRT 8262-8291 30 LC553736 Salmonella phage SAP012 DNA, complete sequence 29488-29517 6 0.8
NZ_ALTB01000023_1 1.4|8358|30|NZ_ALTB01000023|CRT 8358-8387 30 LC553736 Salmonella phage SAP012 DNA, complete sequence 29488-29517 6 0.8
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 MN693170 Marine virus AFVG_25M480, complete genome 14203-14232 7 0.767
NZ_ALTB01000023_1 1.2|8262|30|NZ_ALTB01000023|CRT 8262-8291 30 NC_019401 Cronobacter phage vB_CsaM_GAP32, complete genome 16599-16628 8 0.733
NZ_ALTB01000023_1 1.4|8358|30|NZ_ALTB01000023|CRT 8358-8387 30 NC_019401 Cronobacter phage vB_CsaM_GAP32, complete genome 16599-16628 8 0.733
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 MH341452 Listeria phage PSU-VKH-LP040, complete genome 30946-30975 8 0.733
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 KP399677 Listeria phage vB_LmoS_188, complete genome 30280-30309 8 0.733
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 KP399678 Listeria phage vB_LmoS_293, complete genome 31517-31546 8 0.733
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 DQ003642 Listeria phage A006, complete genome 29765-29794 8 0.733
NZ_ALTB01000023_1 1.9|8574|30|NZ_ALTB01000023|CRT 8574-8603 30 MH616814 Microviridae sp. isolate ctjj954, complete genome 2232-2261 8 0.733

1. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to KC206276 (Escherichia phage EC1-UPM, complete genome) position: , mismatch: 5, identity: 0.833

---ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
actgactaa---agaagctaaagcagaggctaa	Protospacer
   *.****   ********** **********

2. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to NC_019423 (Enterobacter phage IME11, complete genome) position: , mismatch: 5, identity: 0.833

---ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
actgactaa---agaagctaaagcagaggctaa	Protospacer
   *.****   ********** **********

3. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to MN855733 (Siphoviridae sp. isolate 355, complete genome) position: , mismatch: 5, identity: 0.833

---ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
attgactaa---agaagctaaagcagaggctaa	Protospacer
   *.****   ********** **********

4. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to KF562340 (Escherichia phage vB_EcoP_PhAPEC7, complete genome) position: , mismatch: 5, identity: 0.833

---ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
actgactaa---agaagctaaagcagaggctaa	Protospacer
   *.****   ********** **********

5. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to MH733496 (Escherichia phage PGN829.1, complete genome) position: , mismatch: 5, identity: 0.833

---ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
actgactaa---agaagctaaagcagaggctaa	Protospacer
   *.****   ********** **********

6. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to KF192075 (Escherichia phage vB_EcoP_PhAPEC5, complete genome) position: , mismatch: 5, identity: 0.833

---ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
actgactaa---agaagctaaagcagaggctaa	Protospacer
   *.****   ********** **********

7. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to MH358458 (Escherichia phage phi G17, complete genome) position: , mismatch: 5, identity: 0.833

---ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
actgactaa---agaagctaaagcagaggctaa	Protospacer
   *.****   ********** **********

8. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to MG208881 (Escherichia phage St11Ph5, complete genome) position: , mismatch: 5, identity: 0.833

---ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
actgactaa---agaagctaaagcagaggctaa	Protospacer
   *.****   ********** **********

9. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to HQ259105 (Escherichia phage vB_EcoP_G7C, complete genome) position: , mismatch: 5, identity: 0.833

---ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
actgactaa---agaagctaaagcagaggctaa	Protospacer
   *.****   ********** **********

10. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to KF620435 (Shigella phage pSb-1, complete genome) position: , mismatch: 5, identity: 0.833

---ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
actgactaa---agaagctaaagcagaggctaa	Protospacer
   *.****   ********** **********

11. spacer 1.2|8262|30|NZ_ALTB01000023|CRT matches to LC553736 (Salmonella phage SAP012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8

ggccaaaccagacgttaagccagaagctaa	CRISPR spacer
agtccaaccagacgatcagccagaagctga	Protospacer
.*.* ********* * ***********.*

12. spacer 1.4|8358|30|NZ_ALTB01000023|CRT matches to LC553736 (Salmonella phage SAP012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8

ggccaaaccagacgttaagccagaagctaa	CRISPR spacer
agtccaaccagacgatcagccagaagctga	Protospacer
.*.* ********* * ***********.*

13. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to MN693170 (Marine virus AFVG_25M480, complete genome) position: , mismatch: 7, identity: 0.767

ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
tgctaagtaaaaagctaaaccagataccat	Protospacer
 ******* *.************* .*.* 

14. spacer 1.2|8262|30|NZ_ALTB01000023|CRT matches to NC_019401 (Cronobacter phage vB_CsaM_GAP32, complete genome) position: , mismatch: 8, identity: 0.733

ggccaaaccagacgttaagccagaagctaa	CRISPR spacer
accagaaccagaagttaagccagaacctgc	Protospacer
. * .******* ************ **. 

15. spacer 1.4|8358|30|NZ_ALTB01000023|CRT matches to NC_019401 (Cronobacter phage vB_CsaM_GAP32, complete genome) position: , mismatch: 8, identity: 0.733

ggccaaaccagacgttaagccagaagctaa	CRISPR spacer
accagaaccagaagttaagccagaacctgc	Protospacer
. * .******* ************ **. 

16. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 8, identity: 0.733

ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
tgctaagtcagaagctaaacaagttatttt	Protospacer
 ******************* **  ..*  

17. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 8, identity: 0.733

ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
tgctaagtcagaagctaaacaagttatttt	Protospacer
 ******************* **  ..*  

18. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 8, identity: 0.733

ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
tgctaagtcagaagctaaacaagttatttt	Protospacer
 ******************* **  ..*  

19. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 8, identity: 0.733

ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
tgctaagtcagaagctaaacaagttatttt	Protospacer
 ******************* **  ..*  

20. spacer 1.9|8574|30|NZ_ALTB01000023|CRT matches to MH616814 (Microviridae sp. isolate ctjj954, complete genome) position: , mismatch: 8, identity: 0.733

ggctaagtcagaagctaaaccagaggctaa	CRISPR spacer
gagcagaccagaagcaaaaccagaggctat	Protospacer
*. .*...******* ************* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALTB01000017
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 79323 : 86527 8 uncultured_Caudovirales_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ALTB01000018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 38699 : 47189 12 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALTB01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 48589 : 58861 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALTB01000021
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 92 : 77636 89 Streptococcus_phage(85.96%) integrase,holin,protease,head,transposase,tail,terminase,portal,tRNA attL 45662:45682|attR 77688:77708
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALTB01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 40173 : 49558 9 uncultured_Caudovirales_phage(28.57%) NA NA
DBSCAN-SWA_2 102035 : 111028 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ALTB01000019
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 66596 82 Streptococcus_phage(64.81%) protease,portal,holin,tRNA,integrase,terminase,head,transposase,tail attL 6381:6396|attR 31527:31542
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ALTB01000027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 38487 : 46041 11 Streptococcus_phage(50.0%) integrase,transposase attL 31832:31847|attR 49321:49336
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_ALTB01000020
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALTB01000020_1 120727-121554 Orphan II-A
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALTB01000020_1 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT 120763-120792 30 MK448971 Streptococcus phage Javan52, complete genome 23384-23413 0 1.0
NZ_ALTB01000020_1 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT 120763-120792 30 MK448956 Streptococcus phage Javan48, complete genome 21703-21732 0 1.0
NZ_ALTB01000020_1 1.3|120895|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120895-120924 30 MK448708 Streptococcus phage Javan23, complete genome 18777-18806 0 1.0
NZ_ALTB01000020_1 1.3|120895|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120895-120924 30 MK448897 Streptococcus phage Javan28, complete genome 18777-18806 0 1.0
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 MK448708 Streptococcus phage Javan23, complete genome 19730-19759 0 1.0
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 MK448897 Streptococcus phage Javan28, complete genome 19730-19759 0 1.0
NZ_ALTB01000020_1 1.7|121159|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121159-121188 30 MK448708 Streptococcus phage Javan23, complete genome 20130-20159 1 0.967
NZ_ALTB01000020_1 1.7|121159|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121159-121188 30 MK448897 Streptococcus phage Javan28, complete genome 20130-20159 1 0.967
NZ_ALTB01000020_1 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT 120763-120792 30 MK448851 Streptococcus phage Javan14, complete genome 22357-22386 2 0.933
NZ_ALTB01000020_1 1.8|121225|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121225-121254 30 MK448925 Streptococcus phage Javan386, complete genome 20996-21025 2 0.933
NZ_ALTB01000020_1 1.8|121225|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121225-121254 30 MK448927 Streptococcus phage Javan394, complete genome 21593-21622 2 0.933
NZ_ALTB01000020_1 1.8|121225|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121225-121254 30 MK448905 Streptococcus phage Javan318, complete genome 22917-22946 4 0.867
NZ_ALTB01000020_1 1.6|121093|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121093-121122 30 MK448738 Streptococcus phage Javan355, complete genome 3891-3920 5 0.833
NZ_ALTB01000020_1 1.8|121225|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121225-121254 30 MK448834 Streptococcus phage Javan91, complete genome 21602-21631 5 0.833
NZ_ALTB01000020_1 1.8|121225|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121225-121254 30 MK449009 Streptococcus phage Javan88, complete genome 23306-23335 5 0.833
NZ_ALTB01000020_1 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT 120763-120792 30 MT773557 Myoviridae sp. isolate BML_S_1 genomic sequence 9766-9795 6 0.8
NZ_ALTB01000020_1 1.9|121291|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121291-121320 30 KJ018210 Flavobacterium sp. phage 1/32, complete genome 3123-3152 6 0.8
NZ_ALTB01000020_1 1.9|121291|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121291-121320 30 MN698242 Pelagibacter phage HTVC103P, complete genome 26922-26951 6 0.8
NZ_ALTB01000020_1 1.11|121423|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121423-121452 30 NC_047897 Lactobacillus phage Lenus, complete genome 65427-65456 6 0.8
NZ_ALTB01000020_1 1.11|121423|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121423-121452 30 AP013698 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C55A-MedDCM-OCT-S36-C68, *** SEQUENCING IN PROGRESS *** 17874-17903 6 0.8
NZ_ALTB01000020_1 1.2|120829|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120829-120858 30 NC_015937 Thermus phage TMA, complete genome 108316-108345 7 0.767
NZ_ALTB01000020_1 1.2|120829|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120829-120858 30 MH595538 Vibrio phage BONAISHI, complete genome 251052-251081 7 0.767
NZ_ALTB01000020_1 1.2|120829|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120829-120858 30 AP011617 Thermus phage TMA DNA, complete genome 108316-108345 7 0.767
NZ_ALTB01000020_1 1.5|121027|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121027-121056 30 NZ_CP046475 Janibacter melonis strain M714 plasmid unnamed, complete sequence 43207-43236 7 0.767
NZ_ALTB01000020_1 1.8|121225|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121225-121254 30 MK448878 Streptococcus phage Javan224, complete genome 19710-19739 7 0.767
NZ_ALTB01000020_1 1.9|121291|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121291-121320 30 NZ_CP009417 Jeotgalibacillus malaysiensis strain malaysiensis plasmid unnamed, complete sequence 457990-458019 7 0.767
NZ_ALTB01000020_1 1.11|121423|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121423-121452 30 NC_047925 Lactobacillus phage Nyseid, complete genome 67879-67908 7 0.767
NZ_ALTB01000020_1 1.11|121423|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121423-121452 30 KU052488 Lactobacillus phage SA-C12, complete genome 24549-24578 7 0.767
NZ_ALTB01000020_1 1.11|121423|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121423-121452 30 MN693473 Marine virus AFVG_25M504, complete genome 22237-22266 7 0.767
NZ_ALTB01000020_1 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT 120763-120792 30 MN693770 Marine virus AFVG_250M115, complete genome 119-148 8 0.733
NZ_ALTB01000020_1 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT 120763-120792 30 MN693770 Marine virus AFVG_250M115, complete genome 41262-41291 8 0.733
NZ_ALTB01000020_1 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT 120763-120792 30 NZ_CP021457 Lactobacillus brevis strain ZLB004 plasmid p1, complete sequence 63596-63625 8 0.733
NZ_ALTB01000020_1 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT 120763-120792 30 NZ_CP040048 Acinetobacter baumannii strain VB1190 plasmid unnamed1, complete sequence 276204-276233 8 0.733
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 HG983280 Aliivibrio salmonicida plasmid pVSAL68, strain Vs289, complete sequence 5359-5388 8 0.733
NZ_ALTB01000020_1 1.7|121159|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121159-121188 30 MF042360 Pseudomonas phage Phabio, complete genome 99564-99593 8 0.733
NZ_ALTB01000020_1 1.9|121291|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121291-121320 30 AP014379 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S43-C51, *** SEQUENCING IN PROGRESS *** 12982-13011 8 0.733
NZ_ALTB01000020_1 1.9|121291|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121291-121320 30 MN850656 Flavobacterium phage fF4, complete genome 9934-9963 8 0.733
NZ_ALTB01000020_1 1.11|121423|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121423-121452 30 AP018932 Escherichia phage KIT03 DNA, complete sequence 154828-154857 8 0.733
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 HG983279 Aliivibrio salmonicida plasmid pVSAL111, strain TEO83.001, complete sequence 5373-5402 9 0.7
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 HG983279 Aliivibrio salmonicida plasmid pVSAL111, strain TEO83.001, complete sequence 9700-9729 9 0.7
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 NC_011314 Aliivibrio salmonicida LFI1238 plasmid pVSAL320, complete sequence 12759-12788 9 0.7
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 NC_011314 Aliivibrio salmonicida LFI1238 plasmid pVSAL320, complete sequence 20962-20991 9 0.7
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 NC_011314 Aliivibrio salmonicida LFI1238 plasmid pVSAL320, complete sequence 30723-30752 9 0.7
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 NZ_CP034239 Aliivibrio salmonicida strain VS224 plasmid pVS320-224, complete sequence 5317-5346 9 0.7
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 NZ_CP034239 Aliivibrio salmonicida strain VS224 plasmid pVS320-224, complete sequence 13516-13545 9 0.7
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 NZ_CP034239 Aliivibrio salmonicida strain VS224 plasmid pVS320-224, complete sequence 23069-23098 9 0.7
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 NZ_CP034239 Aliivibrio salmonicida strain VS224 plasmid pVS320-224, complete sequence 29849-29878 9 0.7
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 NZ_CP007625 Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence 213223-213252 9 0.7
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 NZ_CP009650 Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence 14219-14248 9 0.7
NZ_ALTB01000020_1 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 120961-120990 30 NC_011316 Aliivibrio salmonicida LFI1238 plasmid pVSAL43, complete sequence 3491-3520 9 0.7
NZ_ALTB01000020_1 1.9|121291|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR 121291-121320 30 MK249142 Blackfly microvirus SF02 isolate 030, complete genome 4552-4581 9 0.7

1. spacer 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 0, identity: 1.0

taattaaaaacaaaaagccccaaaacctgt	CRISPR spacer
taattaaaaacaaaaagccccaaaacctgt	Protospacer
******************************

2. spacer 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 0, identity: 1.0

taattaaaaacaaaaagccccaaaacctgt	CRISPR spacer
taattaaaaacaaaaagccccaaaacctgt	Protospacer
******************************

3. spacer 1.3|120895|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MK448708 (Streptococcus phage Javan23, complete genome) position: , mismatch: 0, identity: 1.0

tttattacacgcttgttgaatttcacgagt	CRISPR spacer
tttattacacgcttgttgaatttcacgagt	Protospacer
******************************

4. spacer 1.3|120895|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MK448897 (Streptococcus phage Javan28, complete genome) position: , mismatch: 0, identity: 1.0

tttattacacgcttgttgaatttcacgagt	CRISPR spacer
tttattacacgcttgttgaatttcacgagt	Protospacer
******************************

5. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MK448708 (Streptococcus phage Javan23, complete genome) position: , mismatch: 0, identity: 1.0

tccatataatgctaactcagcatcattctc	CRISPR spacer
tccatataatgctaactcagcatcattctc	Protospacer
******************************

6. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MK448897 (Streptococcus phage Javan28, complete genome) position: , mismatch: 0, identity: 1.0

tccatataatgctaactcagcatcattctc	CRISPR spacer
tccatataatgctaactcagcatcattctc	Protospacer
******************************

7. spacer 1.7|121159|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MK448708 (Streptococcus phage Javan23, complete genome) position: , mismatch: 1, identity: 0.967

ggagaaccttgacatcattgctaaacgcac	CRISPR spacer
ggagaaccttgacatcattgctaagcgcac	Protospacer
************************.*****

8. spacer 1.7|121159|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MK448897 (Streptococcus phage Javan28, complete genome) position: , mismatch: 1, identity: 0.967

ggagaaccttgacatcattgctaaacgcac	CRISPR spacer
ggagaaccttgacatcattgctaagcgcac	Protospacer
************************.*****

9. spacer 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 2, identity: 0.933

taattaaaaacaaaaagccccaaaacctgt	CRISPR spacer
taattaaaaacaaaaagccccaaatccttt	Protospacer
************************ *** *

10. spacer 1.8|121225|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MK448925 (Streptococcus phage Javan386, complete genome) position: , mismatch: 2, identity: 0.933

aatcagagctttacaacgcaattgttgata	CRISPR spacer
aatctgagctttacaatgcaattgttgata	Protospacer
**** ***********.*************

11. spacer 1.8|121225|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MK448927 (Streptococcus phage Javan394, complete genome) position: , mismatch: 2, identity: 0.933

aatcagagctttacaacgcaattgttgata	CRISPR spacer
aatctgagctttacaatgcaattgttgata	Protospacer
**** ***********.*************

12. spacer 1.8|121225|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MK448905 (Streptococcus phage Javan318, complete genome) position: , mismatch: 4, identity: 0.867

aatcagagctttacaacgcaattgttgata	CRISPR spacer
gctcagaactttacaacgccattgttgata	Protospacer
. *****.*********** **********

13. spacer 1.6|121093|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MK448738 (Streptococcus phage Javan355, complete genome) position: , mismatch: 5, identity: 0.833

tcgtagtatgtcgcttttggttgcaactcc	CRISPR spacer
tcgtagtatgttgcttttggttgtagttct	Protospacer
***********.***********.*..**.

14. spacer 1.8|121225|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MK448834 (Streptococcus phage Javan91, complete genome) position: , mismatch: 5, identity: 0.833

aatcagagctttacaacgcaattgttgata	CRISPR spacer
gaccagagctttacaatgcaattattgaca	Protospacer
.*.*************.******.****.*

15. spacer 1.8|121225|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MK449009 (Streptococcus phage Javan88, complete genome) position: , mismatch: 5, identity: 0.833

aatcagagctttacaacgcaattgttgata	CRISPR spacer
gaccagagctttacaatgcaattattgaca	Protospacer
.*.*************.******.****.*

16. spacer 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT matches to MT773557 (Myoviridae sp. isolate BML_S_1 genomic sequence) position: , mismatch: 6, identity: 0.8

taattaaaaacaaaaagccccaaaacctgt	CRISPR spacer
taattaaaaacaaaaaggcgcaaaatggct	Protospacer
***************** * *****.   *

17. spacer 1.9|121291|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to KJ018210 (Flavobacterium sp. phage 1/32, complete genome) position: , mismatch: 6, identity: 0.8

gtaaaaacttgtgttttttttgtgtttgaa	CRISPR spacer
aaaaaaacttgtcttttttttgtgttatat	Protospacer
. ********** *************  * 

18. spacer 1.9|121291|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MN698242 (Pelagibacter phage HTVC103P, complete genome) position: , mismatch: 6, identity: 0.8

gtaaaaacttgtgttttttttgtgtttgaa	CRISPR spacer
gttatgccttatgttttttttgtatttgaa	Protospacer
** * . ***.************.******

19. spacer 1.11|121423|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NC_047897 (Lactobacillus phage Lenus, complete genome) position: , mismatch: 6, identity: 0.8

tggttatacatttactaatccatcagcatt	CRISPR spacer
ggatggtactgttactaatccatcagcatt	Protospacer
 *.* .***  *******************

20. spacer 1.11|121423|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to AP013698 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C55A-MedDCM-OCT-S36-C68, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

-tggttatacatttactaatccatcagcatt	CRISPR spacer
ctcagta-acagttactaatacatcagcatt	Protospacer
 * . ** *** ******** **********

21. spacer 1.2|120829|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NC_015937 (Thermus phage TMA, complete genome) position: , mismatch: 7, identity: 0.767

----atttgacaaacattgaacttaaaagaaact	CRISPR spacer
cagaat----aaaacattaaactcaaaagaaact	Protospacer
    **     *******.****.**********

22. spacer 1.2|120829|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MH595538 (Vibrio phage BONAISHI, complete genome) position: , mismatch: 7, identity: 0.767

atttgacaaacattgaacttaaaagaaact	CRISPR spacer
ttaaggcaaacattgaacataaaggaaaca	Protospacer
 *  *.************ ****.***** 

23. spacer 1.2|120829|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to AP011617 (Thermus phage TMA DNA, complete genome) position: , mismatch: 7, identity: 0.767

----atttgacaaacattgaacttaaaagaaact	CRISPR spacer
cagaat----aaaacattaaactcaaaagaaact	Protospacer
    **     *******.****.**********

24. spacer 1.5|121027|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046475 (Janibacter melonis strain M714 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

aggtgcactcgcaccattgca-aacactgga	CRISPR spacer
aggtgcactcgcaccatggcagggcatttc-	Protospacer
***************** *** ..**.*   

25. spacer 1.8|121225|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MK448878 (Streptococcus phage Javan224, complete genome) position: , mismatch: 7, identity: 0.767

aatcagagctttacaacgcaattgttgata	CRISPR spacer
gtcctgaactttacaacgcaattattgaca	Protospacer
. .* **.***************.****.*

26. spacer 1.9|121291|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009417 (Jeotgalibacillus malaysiensis strain malaysiensis plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

gtaaaaacttgtgttttttttgtgtttgaa	CRISPR spacer
tcacgatgttgtgttttttttgtgtttgac	Protospacer
 .* .*  ********************* 

27. spacer 1.11|121423|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NC_047925 (Lactobacillus phage Nyseid, complete genome) position: , mismatch: 7, identity: 0.767

tggttatacatttactaatccatcagcatt	CRISPR spacer
ggacggtactgttactaatccatcagcatt	Protospacer
 *.. .***  *******************

28. spacer 1.11|121423|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to KU052488 (Lactobacillus phage SA-C12, complete genome) position: , mismatch: 7, identity: 0.767

tggttatacatttactaatccatcagcatt	CRISPR spacer
ggacggtactgttactaatccatcagcatt	Protospacer
 *.. .***  *******************

29. spacer 1.11|121423|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MN693473 (Marine virus AFVG_25M504, complete genome) position: , mismatch: 7, identity: 0.767

tggttatacatttactaatccatcagcatt	CRISPR spacer
tggtgatacatttactaatcctatgccatc	Protospacer
**** ****************  .. ***.

30. spacer 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT matches to MN693770 (Marine virus AFVG_250M115, complete genome) position: , mismatch: 8, identity: 0.733

taattaaaaacaaaaagccccaaaacctgt	CRISPR spacer
caaataaaaagaaaaagccccaaaaataaa	Protospacer
.** ****** ************** . . 

31. spacer 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT matches to MN693770 (Marine virus AFVG_250M115, complete genome) position: , mismatch: 8, identity: 0.733

taattaaaaacaaaaagccccaaaacctgt	CRISPR spacer
caaataaaaagaaaaagccccaaaaataaa	Protospacer
.** ****** ************** . . 

32. spacer 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT matches to NZ_CP021457 (Lactobacillus brevis strain ZLB004 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

taattaaaaacaaaaagccccaaaacctgt	CRISPR spacer
ccattgaaaacaaaaagccccacaattgga	Protospacer
. ***.**************** **.. * 

33. spacer 1.1|120763|30|NZ_ALTB01000020|CRISPRCasFinder,CRT matches to NZ_CP040048 (Acinetobacter baumannii strain VB1190 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

taattaaaaacaaaaagccccaaaacctgt	CRISPR spacer
atcttaaaaacaaaaaaccccgaaactttc	Protospacer
   *************.****.****.* .

34. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to HG983280 (Aliivibrio salmonicida plasmid pVSAL68, strain Vs289, complete sequence) position: , mismatch: 8, identity: 0.733

tccatataatgctaactcagcatcattctc	CRISPR spacer
acgggccaatgctaactcagcaacattcta	Protospacer
 * .  .*************** ****** 

35. spacer 1.7|121159|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MF042360 (Pseudomonas phage Phabio, complete genome) position: , mismatch: 8, identity: 0.733

ggagaaccttgacatcattgctaaacgcac	CRISPR spacer
agagaaccttcacagcattgctaagccgtt	Protospacer
.********* *** *********.*   .

36. spacer 1.9|121291|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to AP014379 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S43-C51, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733

gtaaaaacttgtgttttttttgtgtttgaa	CRISPR spacer
tataaaacttgtatcttttttgtgttctat	Protospacer
   *********.*.***********. * 

37. spacer 1.9|121291|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MN850656 (Flavobacterium phage fF4, complete genome) position: , mismatch: 8, identity: 0.733

gtaaaaacttgtgttttttttgtgtttgaa	CRISPR spacer
acagaaagttttgttttttttgtgttttgc	Protospacer
..*.*** ** **************** . 

38. spacer 1.11|121423|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to AP018932 (Escherichia phage KIT03 DNA, complete sequence) position: , mismatch: 8, identity: 0.733

tggttatacatttactaatccatcagcatt	CRISPR spacer
gggtaatacatttactaatccaagcgaagg	Protospacer
 *** *****************   * *  

39. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to HG983279 (Aliivibrio salmonicida plasmid pVSAL111, strain TEO83.001, complete sequence) position: , mismatch: 9, identity: 0.7

tccatataatgctaactcagcatcattctc	CRISPR spacer
acgggccaatgctaactcagcaacattcaa	Protospacer
 * .  .*************** *****  

40. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to HG983279 (Aliivibrio salmonicida plasmid pVSAL111, strain TEO83.001, complete sequence) position: , mismatch: 9, identity: 0.7

tccatataatgctaactcagcatcattctc	CRISPR spacer
acgggccaatgctaactcagcaacattcaa	Protospacer
 * .  .*************** *****  

41. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NC_011314 (Aliivibrio salmonicida LFI1238 plasmid pVSAL320, complete sequence) position: , mismatch: 9, identity: 0.7

tccatataatgctaactcagcatcattctc	CRISPR spacer
acgggccaatgctaactcagcaacattcaa	Protospacer
 * .  .*************** *****  

42. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NC_011314 (Aliivibrio salmonicida LFI1238 plasmid pVSAL320, complete sequence) position: , mismatch: 9, identity: 0.7

tccatataatgctaactcagcatcattctc	CRISPR spacer
acgggccaatgctaactcagcaacattcaa	Protospacer
 * .  .*************** *****  

43. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NC_011314 (Aliivibrio salmonicida LFI1238 plasmid pVSAL320, complete sequence) position: , mismatch: 9, identity: 0.7

tccatataatgctaactcagcatcattctc	CRISPR spacer
acgggccaatgctaactcagcaacattcaa	Protospacer
 * .  .*************** *****  

44. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034239 (Aliivibrio salmonicida strain VS224 plasmid pVS320-224, complete sequence) position: , mismatch: 9, identity: 0.7

tccatataatgctaactcagcatcattctc	CRISPR spacer
acgggccaatgctaactcagcaacattcaa	Protospacer
 * .  .*************** *****  

45. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034239 (Aliivibrio salmonicida strain VS224 plasmid pVS320-224, complete sequence) position: , mismatch: 9, identity: 0.7

tccatataatgctaactcagcatcattctc	CRISPR spacer
acgggccaatgctaactcagcaacattcaa	Protospacer
 * .  .*************** *****  

46. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034239 (Aliivibrio salmonicida strain VS224 plasmid pVS320-224, complete sequence) position: , mismatch: 9, identity: 0.7

tccatataatgctaactcagcatcattctc	CRISPR spacer
acgggccaatgctaactcagcaacattcaa	Protospacer
 * .  .*************** *****  

47. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034239 (Aliivibrio salmonicida strain VS224 plasmid pVS320-224, complete sequence) position: , mismatch: 9, identity: 0.7

tccatataatgctaactcagcatcattctc	CRISPR spacer
acgggccaatgctaactcagcaacattcaa	Protospacer
 * .  .*************** *****  

48. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007625 (Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tccatataatgctaactcagcatcattctc	CRISPR spacer
cttatataaagctatctcagcatcatcaaa	Protospacer
...****** **** ***********.   

49. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009650 (Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence) position: , mismatch: 9, identity: 0.7

tccatataatgctaactcagcatcattctc	CRISPR spacer
cttatataaagctatctcagcatcatcaaa	Protospacer
...****** **** ***********.   

50. spacer 1.4|120961|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to NC_011316 (Aliivibrio salmonicida LFI1238 plasmid pVSAL43, complete sequence) position: , mismatch: 9, identity: 0.7

tccatataatgctaactcagcatcattctc	CRISPR spacer
acgggccaatgctaactcagcaacattcaa	Protospacer
 * .  .*************** *****  

51. spacer 1.9|121291|30|NZ_ALTB01000020|CRISPRCasFinder,CRT,PILER-CR matches to MK249142 (Blackfly microvirus SF02 isolate 030, complete genome) position: , mismatch: 9, identity: 0.7

gtaaaaacttgtgttttttttgtgtttgaa	CRISPR spacer
tttcttacttgtgttttttttgtatttttg	Protospacer
 *    *****************.***  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_ALTB01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALTB01000005.1|WP_000384271.1|62764_63091_+|hypothetical-protein 62764_63091_+ 108 aa aa AcrIIA21 HTH_XRE NA No NA
12. NZ_ALTB01000025
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12360 : 28115 15 Streptococcus_phage(81.82%) holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage