Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALRX01000032 Streptococcus agalactiae MRI Z1-012 ctg120005467191, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000044 Streptococcus agalactiae MRI Z1-012 ctg120005467203, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000008 Streptococcus agalactiae MRI Z1-012 ctg120005467167, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000001 Streptococcus agalactiae MRI Z1-012 ctg120005466868, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000047 Streptococcus agalactiae MRI Z1-012 ctg120005467206, whole genome shotgun sequence 0 crisprs NA 0 0 3 0
NZ_ALRX01000023 Streptococcus agalactiae MRI Z1-012 ctg120005467182, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000049 Streptococcus agalactiae MRI Z1-012 ctg120005467208, whole genome shotgun sequence 0 crisprs DinG 0 0 1 0
NZ_ALRX01000017 Streptococcus agalactiae MRI Z1-012 ctg120005467176, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000011 Streptococcus agalactiae MRI Z1-012 ctg120005467170, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000031 Streptococcus agalactiae MRI Z1-012 ctg120005467190, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_ALRX01000015 Streptococcus agalactiae MRI Z1-012 ctg120005467174, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000005 Streptococcus agalactiae MRI Z1-012 ctg120005467164, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000043 Streptococcus agalactiae MRI Z1-012 ctg120005467202, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000026 Streptococcus agalactiae MRI Z1-012 ctg120005467185, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRX01000042 Streptococcus agalactiae MRI Z1-012 ctg120005467201, whole genome shotgun sequence 1 crisprs NA 0 17 0 0
NZ_ALRX01000003 Streptococcus agalactiae MRI Z1-012 ctg120005467162, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000052 Streptococcus agalactiae MRI Z1-012 ctg120005467211, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRX01000021 Streptococcus agalactiae MRI Z1-012 ctg120005467180, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000009 Streptococcus agalactiae MRI Z1-012 ctg120005467168, whole genome shotgun sequence 1 crisprs NA 0 1 0 0
NZ_ALRX01000020 Streptococcus agalactiae MRI Z1-012 ctg120005467179, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000036 Streptococcus agalactiae MRI Z1-012 ctg120005467195, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000019 Streptococcus agalactiae MRI Z1-012 ctg120005467178, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_ALRX01000037 Streptococcus agalactiae MRI Z1-012 ctg120005467196, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALRX01000034 Streptococcus agalactiae MRI Z1-012 ctg120005467193, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000006 Streptococcus agalactiae MRI Z1-012 ctg120005467165, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000046 Streptococcus agalactiae MRI Z1-012 ctg120005467205, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRX01000039 Streptococcus agalactiae MRI Z1-012 ctg120005467198, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000016 Streptococcus agalactiae MRI Z1-012 ctg120005467175, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000053 Streptococcus agalactiae MRI Z1-012 ctg120005467212, whole genome shotgun sequence 1 crisprs NA 1 4 1 0
NZ_ALRX01000004 Streptococcus agalactiae MRI Z1-012 ctg120005467163, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000025 Streptococcus agalactiae MRI Z1-012 ctg120005467184, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRX01000012 Streptococcus agalactiae MRI Z1-012 ctg120005467171, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000010 Streptococcus agalactiae MRI Z1-012 ctg120005467169, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000045 Streptococcus agalactiae MRI Z1-012 ctg120005467204, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_ALRX01000055 Streptococcus agalactiae MRI Z1-012 ctg120005467214, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000029 Streptococcus agalactiae MRI Z1-012 ctg120005467188, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000040 Streptococcus agalactiae MRI Z1-012 ctg120005467199, whole genome shotgun sequence 0 crisprs csm6 0 0 0 0
NZ_ALRX01000051 Streptococcus agalactiae MRI Z1-012 ctg120005467210, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000030 Streptococcus agalactiae MRI Z1-012 ctg120005467189, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALRX01000002 Streptococcus agalactiae MRI Z1-012 ctg120005467161, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000027 Streptococcus agalactiae MRI Z1-012 ctg120005467186, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRX01000041 Streptococcus agalactiae MRI Z1-012 ctg120005467200, whole genome shotgun sequence 0 crisprs cas3 0 0 1 0
NZ_ALRX01000014 Streptococcus agalactiae MRI Z1-012 ctg120005467173, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000013 Streptococcus agalactiae MRI Z1-012 ctg120005467172, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000048 Streptococcus agalactiae MRI Z1-012 ctg120005467207, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 0 10 0 0
NZ_ALRX01000018 Streptococcus agalactiae MRI Z1-012 ctg120005467177, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000022 Streptococcus agalactiae MRI Z1-012 ctg120005467181, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000054 Streptococcus agalactiae MRI Z1-012 ctg120005467213, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_ALRX01000033 Streptococcus agalactiae MRI Z1-012 ctg120005467192, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000035 Streptococcus agalactiae MRI Z1-012 ctg120005467194, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000028 Streptococcus agalactiae MRI Z1-012 ctg120005467187, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000024 Streptococcus agalactiae MRI Z1-012 ctg120005467183, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000007 Streptococcus agalactiae MRI Z1-012 ctg120005467166, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRX01000038 Streptococcus agalactiae MRI Z1-012 ctg120005467197, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRX01000050 Streptococcus agalactiae MRI Z1-012 ctg120005467209, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ALRX01000046
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 9526 : 14570 8 Streptococcus_phage(85.71%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALRX01000038
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 9498 : 19771 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALRX01000041
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 9026 : 16200 8 Staphylococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ALRX01000053
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRX01000053_1 66543-67604 Orphan NA
19 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ALRX01000053_1 1.6|66897|18|NZ_ALRX01000053|CRT 66897-66914 18 NZ_ALRX01000053.1 66525-66542 1 0.944

1. spacer 1.6|66897|18|NZ_ALRX01000053|CRT matches to position: 66525-66542, mismatch: 1, identity: 0.944

tgtcgatgcactcattga	CRISPR spacer
tgtcgatgcactcgttga	Protospacer
*************.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRX01000053_1 1.10|67089|30|NZ_ALRX01000053|CRT 67089-67118 30 NC_019418 Streptococcus phage phiNJ2, complete genome 30961-30990 5 0.833
NZ_ALRX01000053_1 1.16|67425|30|NZ_ALRX01000053|CRT 67425-67454 30 NC_049380 Vibrio phage JSF3, complete genome 68190-68219 6 0.8
NZ_ALRX01000053_1 1.16|67425|30|NZ_ALRX01000053|CRT 67425-67454 30 NC_049350 Vibrio phage VCO139, complete genome 415-444 6 0.8
NZ_ALRX01000053_1 1.16|67425|30|NZ_ALRX01000053|CRT 67425-67454 30 NC_021540 Vibrio phage JA-1, complete genome 415-444 6 0.8
NZ_ALRX01000053_1 1.13|67269|30|NZ_ALRX01000053|CRT 67269-67298 30 NZ_CP021643 Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence 69394-69423 7 0.767
NZ_ALRX01000053_1 1.10|67089|30|NZ_ALRX01000053|CRT 67089-67118 30 KC171647 Lactobacillus phage PL-1, complete genome 32832-32861 8 0.733
NZ_ALRX01000053_1 1.10|67089|30|NZ_ALRX01000053|CRT 67089-67118 30 KX879752 Halomonas phage QHHSV-1, complete genome 11010-11039 8 0.733
NZ_ALRX01000053_1 1.10|67089|30|NZ_ALRX01000053|CRT 67089-67118 30 NC_022756 Lactobacillus phage J-1, complete genome 34883-34912 8 0.733
NZ_ALRX01000053_1 1.5|66849|30|NZ_ALRX01000053|CRT 66849-66878 30 MN694468 Marine virus AFVG_250M452, complete genome 1274-1303 9 0.7
NZ_ALRX01000053_1 1.5|66849|30|NZ_ALRX01000053|CRT 66849-66878 30 MN694239 Marine virus AFVG_250M451, complete genome 26295-26324 9 0.7
NZ_ALRX01000053_1 1.16|67425|30|NZ_ALRX01000053|CRT 67425-67454 30 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 326169-326198 9 0.7

1. spacer 1.10|67089|30|NZ_ALRX01000053|CRT matches to NC_019418 (Streptococcus phage phiNJ2, complete genome) position: , mismatch: 5, identity: 0.833

cgtggatgcactggtacttgctgacgtgga	CRISPR spacer
aatggatgcactggtacttgctgaatttga	Protospacer
 .**********************  * **

2. spacer 1.16|67425|30|NZ_ALRX01000053|CRT matches to NC_049380 (Vibrio phage JSF3, complete genome) position: , mismatch: 6, identity: 0.8

tgtggatgcactggttgaagcactggttga	CRISPR spacer
tttagttgaactggttgaatcactggttgc	Protospacer
* *.* ** ********** ********* 

3. spacer 1.16|67425|30|NZ_ALRX01000053|CRT matches to NC_049350 (Vibrio phage VCO139, complete genome) position: , mismatch: 6, identity: 0.8

tgtggatgcactggttgaagcactggttga	CRISPR spacer
tttagttgaactggttgaatcactggttgc	Protospacer
* *.* ** ********** ********* 

4. spacer 1.16|67425|30|NZ_ALRX01000053|CRT matches to NC_021540 (Vibrio phage JA-1, complete genome) position: , mismatch: 6, identity: 0.8

tgtggatgcactggttgaagcactggttga	CRISPR spacer
tttagttgaactggttgaatcactggttgc	Protospacer
* *.* ** ********** ********* 

5. spacer 1.13|67269|30|NZ_ALRX01000053|CRT matches to NZ_CP021643 (Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence) position: , mismatch: 7, identity: 0.767

ggtggaagcactggtactggcactggttga	CRISPR spacer
agtggtagcactggcactggcactggcgat	Protospacer
.**** ********.***********. . 

6. spacer 1.10|67089|30|NZ_ALRX01000053|CRT matches to KC171647 (Lactobacillus phage PL-1, complete genome) position: , mismatch: 8, identity: 0.733

cgtggatgcactggtacttgctgacgtgga	CRISPR spacer
atatgatgcactggtaattgctgactatga	Protospacer
    ************ ********   **

7. spacer 1.10|67089|30|NZ_ALRX01000053|CRT matches to KX879752 (Halomonas phage QHHSV-1, complete genome) position: , mismatch: 8, identity: 0.733

cgtggatgcactggtacttgctgacgtgga	CRISPR spacer
ctaccgggcgctggttcttgctgacgtgga	Protospacer
*    . **.***** **************

8. spacer 1.10|67089|30|NZ_ALRX01000053|CRT matches to NC_022756 (Lactobacillus phage J-1, complete genome) position: , mismatch: 8, identity: 0.733

cgtggatgcactggtacttgctgacgtgga	CRISPR spacer
atatgatgcactggtaattgctgactatga	Protospacer
    ************ ********   **

9. spacer 1.5|66849|30|NZ_ALRX01000053|CRT matches to MN694468 (Marine virus AFVG_250M452, complete genome) position: , mismatch: 9, identity: 0.7

-------cgtggaggcactcgtacttgcacttgttga	CRISPR spacer
tcatctcc-------cactcgtacttgcacttgctgc	Protospacer
       *       ******************.** 

10. spacer 1.5|66849|30|NZ_ALRX01000053|CRT matches to MN694239 (Marine virus AFVG_250M451, complete genome) position: , mismatch: 9, identity: 0.7

cgtggagg-------cactcgtacttgcacttgttga	CRISPR spacer
-------gcatctcccactcgtacttgcacttgctgc	Protospacer
       *       ******************.** 

11. spacer 1.16|67425|30|NZ_ALRX01000053|CRT matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 9, identity: 0.7

tgtggatgcactggttgaagcactggttga	CRISPR spacer
cctggatgcactggttgcaggactgaaact	Protospacer
. *************** ** ****.    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 157597 : 168331 16 Streptococcus_phage(84.62%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALRX01000026
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10577 : 22070 13 Streptococcus_phage(80.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALRX01000025
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8480 : 20545 8 Synechococcus_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALRX01000042
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRX01000042_1 1-888 Orphan II-A
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRX01000042_1 1.14|97|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 97-126 30 MK448971 Streptococcus phage Javan52, complete genome 32571-32600 0 1.0
NZ_ALRX01000042_1 1.14|97|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 97-126 30 MK448956 Streptococcus phage Javan48, complete genome 30890-30919 0 1.0
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 MK448837 Streptococcus phage Javan10, complete genome 6972-7001 0 1.0
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 MK448736 Streptococcus phage Javan35, complete genome 12531-12560 0 1.0
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 MK448781 Streptococcus phage Javan5, complete genome 14553-14582 0 1.0
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 MK448938 Streptococcus phage Javan44, complete genome 12532-12561 0 1.0
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 MK448911 Streptococcus phage Javan34, complete genome 12531-12560 0 1.0
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 MK448916 Streptococcus phage Javan36, complete genome 12531-12560 0 1.0
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448507 Streptococcus satellite phage Javan463, complete genome 4750-4779 0 1.0
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448510 Streptococcus satellite phage Javan469, complete genome 3359-3388 0 1.0
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448521 Streptococcus satellite phage Javan518, complete genome 3412-3441 0 1.0
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448501 Streptococcus satellite phage Javan449, complete genome 3421-3450 0 1.0
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448343 Streptococcus satellite phage Javan162, complete genome 4750-4779 0 1.0
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448329 Streptococcus satellite phage Javan134, complete genome 4750-4779 0 1.0
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448325 Streptococcus satellite phage Javan125, complete genome 4750-4779 0 1.0
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448504 Streptococcus satellite phage Javan455, complete genome 3472-3501 0 1.0
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448516 Streptococcus satellite phage Javan490, complete genome 3411-3440 0 1.0
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448335 Streptococcus satellite phage Javan148, complete genome 4750-4779 0 1.0
NZ_ALRX01000042_1 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder 691-720 30 MK448350 Streptococcus satellite phage Javan19, complete genome 1600-1629 0 1.0
NZ_ALRX01000042_1 1.25|694|27|NZ_ALRX01000042|PILER-CR 694-720 27 MK448350 Streptococcus satellite phage Javan19, complete genome 1602-1628 0 1.0
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 MK448729 Streptococcus phage Javan31, complete genome 15067-15096 1 0.967
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 MK448691 Streptococcus phage Javan17, complete genome 15067-15096 1 0.967
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 MK448948 Streptococcus phage Javan46, complete genome 15011-15040 1 0.967
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 MK448971 Streptococcus phage Javan52, complete genome 11833-11862 2 0.933
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 MH853356 Streptococcus phage LF2, partial genome 8570-8599 2 0.933
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 MK448673 Streptococcus phage Javan119, complete genome 13656-13685 2 0.933
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448395 Streptococcus satellite phage Javan279, complete genome 3305-3334 2 0.933
NZ_ALRX01000042_1 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder 691-720 30 NZ_AP018727 Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD1, complete sequence 21389-21418 2 0.933
NZ_ALRX01000042_1 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder 691-720 30 NZ_AP018728 Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD2, complete sequence 10365-10394 2 0.933
NZ_ALRX01000042_1 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder 691-720 30 NZ_AP018730 Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD4, complete sequence 8833-8862 2 0.933
NZ_ALRX01000042_1 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder 691-720 30 NZ_AP018731 Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD5, complete sequence 136-165 2 0.933
NZ_ALRX01000042_1 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder 691-720 30 MK448662 Streptococcus satellite phage Javan97, complete genome 1667-1696 2 0.933
NZ_ALRX01000042_1 1.25|694|27|NZ_ALRX01000042|PILER-CR 694-720 27 NZ_AP018727 Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD1, complete sequence 21390-21416 2 0.926
NZ_ALRX01000042_1 1.25|694|27|NZ_ALRX01000042|PILER-CR 694-720 27 NZ_AP018728 Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD2, complete sequence 10366-10392 2 0.926
NZ_ALRX01000042_1 1.25|694|27|NZ_ALRX01000042|PILER-CR 694-720 27 NZ_AP018730 Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD4, complete sequence 8834-8860 2 0.926
NZ_ALRX01000042_1 1.25|694|27|NZ_ALRX01000042|PILER-CR 694-720 27 NZ_AP018731 Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD5, complete sequence 137-163 2 0.926
NZ_ALRX01000042_1 1.25|694|27|NZ_ALRX01000042|PILER-CR 694-720 27 MK448662 Streptococcus satellite phage Javan97, complete genome 1669-1695 2 0.926
NZ_ALRX01000042_1 1.14|97|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 97-126 30 MK448851 Streptococcus phage Javan14, complete genome 31525-31554 3 0.9
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448559 Streptococcus satellite phage Javan596, complete genome 3484-3513 3 0.9
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448553 Streptococcus satellite phage Javan588, complete genome 3484-3513 3 0.9
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448540 Streptococcus satellite phage Javan559, complete genome 3484-3513 3 0.9
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448550 Streptococcus satellite phage Javan581, complete genome 3484-3513 3 0.9
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448517 Streptococcus satellite phage Javan495, complete genome 4199-4228 3 0.9
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448385 Streptococcus satellite phage Javan251, complete genome 3143-3172 3 0.9
NZ_ALRX01000042_1 1.2|97|36|NZ_ALRX01000042|CRT 97-132 36 MK448971 Streptococcus phage Javan52, complete genome 32571-32606 4 0.889
NZ_ALRX01000042_1 1.2|97|36|NZ_ALRX01000042|CRT 97-132 36 MK448956 Streptococcus phage Javan48, complete genome 30890-30925 4 0.889
NZ_ALRX01000042_1 1.9|559|36|NZ_ALRX01000042|CRT 559-594 36 MK448736 Streptococcus phage Javan35, complete genome 12531-12566 4 0.889
NZ_ALRX01000042_1 1.9|559|36|NZ_ALRX01000042|CRT 559-594 36 MK448781 Streptococcus phage Javan5, complete genome 14553-14588 4 0.889
NZ_ALRX01000042_1 1.9|559|36|NZ_ALRX01000042|CRT 559-594 36 MK448938 Streptococcus phage Javan44, complete genome 12532-12567 4 0.889
NZ_ALRX01000042_1 1.9|559|36|NZ_ALRX01000042|CRT 559-594 36 MK448911 Streptococcus phage Javan34, complete genome 12531-12566 4 0.889
NZ_ALRX01000042_1 1.9|559|36|NZ_ALRX01000042|CRT 559-594 36 MK448916 Streptococcus phage Javan36, complete genome 12531-12566 4 0.889
NZ_ALRX01000042_1 1.11|691|36|NZ_ALRX01000042|CRT 691-726 36 MK448350 Streptococcus satellite phage Javan19, complete genome 1594-1629 4 0.889
NZ_ALRX01000042_1 1.16|229|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 229-258 30 NC_009673 Bacillus cytotoxicus NVH 391-98 plasmid pBC9801, complete sequence 7039-7068 4 0.867
NZ_ALRX01000042_1 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 361-390 30 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 474277-474306 4 0.867
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448511 Streptococcus satellite phage Javan473, complete genome 3219-3248 4 0.867
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448437 Streptococcus satellite phage Javan334, complete genome 3448-3477 4 0.867
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448645 Streptococcus satellite phage Javan757, complete genome 3878-3907 4 0.867
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448380 Streptococcus satellite phage Javan24, complete genome 4610-4639 4 0.867
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448440 Streptococcus satellite phage Javan338, complete genome 3449-3478 4 0.867
NZ_ALRX01000042_1 1.8|493|36|NZ_ALRX01000042|CRT 493-528 36 MK448837 Streptococcus phage Javan10, complete genome 6966-7001 5 0.861
NZ_ALRX01000042_1 1.9|559|36|NZ_ALRX01000042|CRT 559-594 36 MK448729 Streptococcus phage Javan31, complete genome 15067-15102 5 0.861
NZ_ALRX01000042_1 1.9|559|36|NZ_ALRX01000042|CRT 559-594 36 MK448691 Streptococcus phage Javan17, complete genome 15067-15102 5 0.861
NZ_ALRX01000042_1 1.9|559|36|NZ_ALRX01000042|CRT 559-594 36 MK448948 Streptococcus phage Javan46, complete genome 15011-15046 5 0.861
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448507 Streptococcus satellite phage Javan463, complete genome 4744-4779 5 0.861
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448510 Streptococcus satellite phage Javan469, complete genome 3353-3388 5 0.861
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448521 Streptococcus satellite phage Javan518, complete genome 3406-3441 5 0.861
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448501 Streptococcus satellite phage Javan449, complete genome 3415-3450 5 0.861
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448343 Streptococcus satellite phage Javan162, complete genome 4744-4779 5 0.861
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448329 Streptococcus satellite phage Javan134, complete genome 4744-4779 5 0.861
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448325 Streptococcus satellite phage Javan125, complete genome 4744-4779 5 0.861
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448504 Streptococcus satellite phage Javan455, complete genome 3466-3501 5 0.861
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448516 Streptococcus satellite phage Javan490, complete genome 3405-3440 5 0.861
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448335 Streptococcus satellite phage Javan148, complete genome 4744-4779 5 0.861
NZ_ALRX01000042_1 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 361-390 30 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 473664-473693 5 0.833
NZ_ALRX01000042_1 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 361-390 30 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 655420-655449 5 0.833
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448616 Streptococcus satellite phage Javan729, complete genome 6309-6338 5 0.833
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 MK448661 Streptococcus satellite phage Javan96, complete genome 4227-4256 5 0.833
NZ_ALRX01000042_1 1.6|361|36|NZ_ALRX01000042|CRT 361-396 36 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 474277-474312 6 0.833
NZ_ALRX01000042_1 1.11|691|36|NZ_ALRX01000042|CRT 691-726 36 NZ_AP018727 Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD1, complete sequence 21389-21424 6 0.833
NZ_ALRX01000042_1 1.11|691|36|NZ_ALRX01000042|CRT 691-726 36 NZ_AP018728 Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD2, complete sequence 10365-10400 6 0.833
NZ_ALRX01000042_1 1.11|691|36|NZ_ALRX01000042|CRT 691-726 36 NZ_AP018730 Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD4, complete sequence 8833-8868 6 0.833
NZ_ALRX01000042_1 1.11|691|36|NZ_ALRX01000042|CRT 691-726 36 NZ_AP018731 Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD5, complete sequence 136-171 6 0.833
NZ_ALRX01000042_1 1.11|691|36|NZ_ALRX01000042|CRT 691-726 36 MK448662 Streptococcus satellite phage Javan97, complete genome 1661-1696 6 0.833
NZ_ALRX01000042_1 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 361-390 30 NZ_CP007625 Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence 284952-284981 6 0.8
NZ_ALRX01000042_1 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 361-390 30 NZ_CP009650 Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence 227979-228008 6 0.8
NZ_ALRX01000042_1 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 361-390 30 NZ_CP045607 Bacillus cereus strain SB1 plasmid p1, complete sequence 493398-493427 6 0.8
NZ_ALRX01000042_1 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 361-390 30 MN693492 Marine virus AFVG_25M361, complete genome 19989-20018 6 0.8
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP048628 Megamonas funiformis strain JCM 14723 plasmid putative_Mfuni1, complete sequence 37661-37690 6 0.8
NZ_ALRX01000042_1 1.2|97|36|NZ_ALRX01000042|CRT 97-132 36 MK448851 Streptococcus phage Javan14, complete genome 31525-31560 7 0.806
NZ_ALRX01000042_1 1.8|493|36|NZ_ALRX01000042|CRT 493-528 36 MK448971 Streptococcus phage Javan52, complete genome 11827-11862 7 0.806
NZ_ALRX01000042_1 1.8|493|36|NZ_ALRX01000042|CRT 493-528 36 MH853356 Streptococcus phage LF2, partial genome 8570-8605 7 0.806
NZ_ALRX01000042_1 1.9|559|36|NZ_ALRX01000042|CRT 559-594 36 MK448673 Streptococcus phage Javan119, complete genome 13656-13691 7 0.806
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448395 Streptococcus satellite phage Javan279, complete genome 3299-3334 7 0.806
NZ_ALRX01000042_1 1.14|97|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 97-126 30 NZ_CP013553 Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence 206696-206725 7 0.767
NZ_ALRX01000042_1 1.14|97|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 97-126 30 NZ_CP013586 Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence 211390-211419 7 0.767
NZ_ALRX01000042_1 1.14|97|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 97-126 30 NZ_CP013564 Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence 206696-206725 7 0.767
NZ_ALRX01000042_1 1.15|163|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 163-192 30 MN694670 Marine virus AFVG_250M589, complete genome 29513-29542 7 0.767
NZ_ALRX01000042_1 1.15|163|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 163-192 30 HQ634190 Cyanophage Syn2 genomic sequence 105428-105457 7 0.767
NZ_ALRX01000042_1 1.15|163|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 163-192 30 GU071097 Synechococcus phage S-SSM5, complete genome 171105-171134 7 0.767
NZ_ALRX01000042_1 1.15|163|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 163-192 30 NC_015286 Synechococcus phage Syn19, complete genome 171318-171347 7 0.767
NZ_ALRX01000042_1 1.16|229|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 229-258 30 NZ_CP042375 Leuconostoc carnosum strain CBA3620 plasmid unnamed1, complete sequence 49735-49764 7 0.767
NZ_ALRX01000042_1 1.17|295|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 295-324 30 NZ_CP013072 Sphingobium indicum B90A plasmid pSRL2, complete sequence 93023-93052 7 0.767
NZ_ALRX01000042_1 1.17|295|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 295-324 30 NZ_CP005190 Sphingobium sp. MI1205 plasmid pMI1, complete sequence 70816-70845 7 0.767
NZ_ALRX01000042_1 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 361-390 30 NZ_CP020744 Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence 311665-311694 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 51262-51291 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 30677-30706 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 40808-40837 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 61827-61856 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 4598-4627 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 49470-49499 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 31271-31300 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 54034-54063 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 47790-47819 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 20183-20212 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 25708-25737 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 9371-9400 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 57371-57400 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 44739-44768 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 33926-33955 7 0.767
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 19083-19112 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 NZ_CP024792 Nostoc flagelliforme CCNUN1 plasmid pNFSY07, complete sequence 309901-309930 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 NC_047733 Synechococcus phage S-RIM8 isolate RW_22_0300, complete genome 6321-6350 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 JF974289 Synechococcus phage S-RIM8 A.HR3, complete genome 6321-6350 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 MK493323 Synechococcus phage S-RIM8 isolate RW_03_0617, complete genome 6323-6352 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 MK493325 Synechococcus phage S-RIM8 isolate RW_62_0316, complete genome 6312-6341 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 MK493322 Synechococcus phage S-RIM8 isolate RW_01_0115_WH8101, complete genome 6312-6341 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 KX349288 Synechococcus phage S-RIM8 isolate RW_08_0711, complete genome 6312-6341 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 NC_020486 Synechococcus phage S-RIM8 A.HR1, complete genome 6321-6350 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 KX349286 Synechococcus phage S-RIM8 isolate RW_03_0807_WH8101, complete genome 6315-6344 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 HQ317385 Synechococcus phage S-RIM8 A.HR5, complete genome 6321-6350 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 MK493324 Synechococcus phage S-RIM8 isolate RW_22_0214, complete genome 6312-6341 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 KX349290 Synechococcus phage S-RIM8 isolate RW_25_1112, complete genome 6312-6341 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 KX349285 Synechococcus phage S-RIM8 isolate RW_01_0212_WH8101, complete genome 6323-6352 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 KX349287 Synechococcus phage S-RIM8 isolate RW_06_0613, complete genome 6312-6341 7 0.767
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 JF974293 Cyanophage KBS-M-1A genomic sequence 39771-39800 7 0.767
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448559 Streptococcus satellite phage Javan596, complete genome 3478-3513 8 0.778
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448553 Streptococcus satellite phage Javan588, complete genome 3478-3513 8 0.778
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448540 Streptococcus satellite phage Javan559, complete genome 3478-3513 8 0.778
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448550 Streptococcus satellite phage Javan581, complete genome 3478-3513 8 0.778
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448517 Streptococcus satellite phage Javan495, complete genome 4193-4228 8 0.778
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448385 Streptococcus satellite phage Javan251, complete genome 3137-3172 8 0.778
NZ_ALRX01000042_1 1.16|229|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 229-258 30 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 100053-100082 8 0.733
NZ_ALRX01000042_1 1.17|295|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 295-324 30 NZ_CP022991 Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence 307848-307877 8 0.733
NZ_ALRX01000042_1 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 361-390 30 MN694072 Marine virus AFVG_250M222, complete genome 22201-22230 8 0.733
NZ_ALRX01000042_1 1.19|427|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 427-456 30 MK288022 Bacillus phage pW4, complete genome 27741-27770 8 0.733
NZ_ALRX01000042_1 1.19|427|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 427-456 30 KT070866 Bacillus phage PBC4, complete genome 15693-15722 8 0.733
NZ_ALRX01000042_1 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 4094-4123 8 0.733
NZ_ALRX01000042_1 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder 559-588 30 NC_048827 Vibrio phage vB_VchM_Kuja, complete genome 112186-112215 8 0.733
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 NZ_MG205641 Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence 31065-31094 8 0.733
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 NZ_MG205643 Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence 24169-24198 8 0.733
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 NZ_MG205642 Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence 31065-31094 8 0.733
NZ_ALRX01000042_1 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder 691-720 30 NC_005250 Vibrio anguillarum 775 plasmid pJM1, complete sequence 6381-6410 8 0.733
NZ_ALRX01000042_1 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder 691-720 30 NZ_CP020532 Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence 39190-39219 8 0.733
NZ_ALRX01000042_1 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder 691-720 30 NZ_LK021128 Vibrio anguillarum strain NB10 plasmid p67vangNB10, complete sequence 34096-34125 8 0.733
NZ_ALRX01000042_1 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder 691-720 30 NC_022225 Vibrio anguillarum M3 plasmid unnamed, complete sequence 30023-30052 8 0.733
NZ_ALRX01000042_1 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder 691-720 30 NZ_CP023210 Vibrio anguillarum strain ATCC-68554 plasmid p65, complete sequence 34435-34464 8 0.733
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448511 Streptococcus satellite phage Javan473, complete genome 3213-3248 9 0.75
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448437 Streptococcus satellite phage Javan334, complete genome 3442-3477 9 0.75
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448645 Streptococcus satellite phage Javan757, complete genome 3872-3907 9 0.75
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448380 Streptococcus satellite phage Javan24, complete genome 4604-4639 9 0.75
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 MK448440 Streptococcus satellite phage Javan338, complete genome 3443-3478 9 0.75
NZ_ALRX01000042_1 1.15|163|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 163-192 30 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 226743-226772 9 0.7
NZ_ALRX01000042_1 1.15|163|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 163-192 30 MH617331 Microviridae sp. isolate ctbd619, complete genome 1763-1792 9 0.7
NZ_ALRX01000042_1 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder 361-390 30 MG592576 Vibrio phage 1.206.O._10N.222.51.B10, partial genome 27486-27515 9 0.7
NZ_ALRX01000042_1 1.6|361|36|NZ_ALRX01000042|CRT 361-396 36 MG945789 UNVERIFIED: Microviridae sp. isolate 4354-1801, complete genome 6311-6346 10 0.722
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 NZ_MG205641 Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence 31065-31100 10 0.722
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 NZ_MG205643 Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence 24169-24204 10 0.722
NZ_ALRX01000042_1 1.10|625|36|NZ_ALRX01000042|CRT 625-660 36 NZ_MG205642 Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence 31065-31100 10 0.722
NZ_ALRX01000042_1 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder 625-654 30 NC_015712 Clostridium perfringens plasmid pCPPB-1, complete sequence 16954-16983 10 0.667

1. spacer 1.14|97|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 0, identity: 1.0

aaactaaagatattgactccctgcaggata	CRISPR spacer
aaactaaagatattgactccctgcaggata	Protospacer
******************************

2. spacer 1.14|97|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 0, identity: 1.0

aaactaaagatattgactccctgcaggata	CRISPR spacer
aaactaaagatattgactccctgcaggata	Protospacer
******************************

3. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 0, identity: 1.0

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
tcctctttctatgtttcaattgccaatttt	Protospacer
******************************

4. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 0, identity: 1.0

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaaatcttgaatcatcatataaaatctt	Protospacer
******************************

5. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 0, identity: 1.0

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaaatcttgaatcatcatataaaatctt	Protospacer
******************************

6. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 0, identity: 1.0

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaaatcttgaatcatcatataaaatctt	Protospacer
******************************

7. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 0, identity: 1.0

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaaatcttgaatcatcatataaaatctt	Protospacer
******************************

8. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 0, identity: 1.0

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaaatcttgaatcatcatataaaatctt	Protospacer
******************************

9. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448507 (Streptococcus satellite phage Javan463, complete genome) position: , mismatch: 0, identity: 1.0

agctatctttttcgtactttgaaatagttt	CRISPR spacer
agctatctttttcgtactttgaaatagttt	Protospacer
******************************

10. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448510 (Streptococcus satellite phage Javan469, complete genome) position: , mismatch: 0, identity: 1.0

agctatctttttcgtactttgaaatagttt	CRISPR spacer
agctatctttttcgtactttgaaatagttt	Protospacer
******************************

11. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448521 (Streptococcus satellite phage Javan518, complete genome) position: , mismatch: 0, identity: 1.0

agctatctttttcgtactttgaaatagttt	CRISPR spacer
agctatctttttcgtactttgaaatagttt	Protospacer
******************************

12. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448501 (Streptococcus satellite phage Javan449, complete genome) position: , mismatch: 0, identity: 1.0

agctatctttttcgtactttgaaatagttt	CRISPR spacer
agctatctttttcgtactttgaaatagttt	Protospacer
******************************

13. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448343 (Streptococcus satellite phage Javan162, complete genome) position: , mismatch: 0, identity: 1.0

agctatctttttcgtactttgaaatagttt	CRISPR spacer
agctatctttttcgtactttgaaatagttt	Protospacer
******************************

14. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448329 (Streptococcus satellite phage Javan134, complete genome) position: , mismatch: 0, identity: 1.0

agctatctttttcgtactttgaaatagttt	CRISPR spacer
agctatctttttcgtactttgaaatagttt	Protospacer
******************************

15. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448325 (Streptococcus satellite phage Javan125, complete genome) position: , mismatch: 0, identity: 1.0

agctatctttttcgtactttgaaatagttt	CRISPR spacer
agctatctttttcgtactttgaaatagttt	Protospacer
******************************

16. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448504 (Streptococcus satellite phage Javan455, complete genome) position: , mismatch: 0, identity: 1.0

agctatctttttcgtactttgaaatagttt	CRISPR spacer
agctatctttttcgtactttgaaatagttt	Protospacer
******************************

17. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448516 (Streptococcus satellite phage Javan490, complete genome) position: , mismatch: 0, identity: 1.0

agctatctttttcgtactttgaaatagttt	CRISPR spacer
agctatctttttcgtactttgaaatagttt	Protospacer
******************************

18. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448335 (Streptococcus satellite phage Javan148, complete genome) position: , mismatch: 0, identity: 1.0

agctatctttttcgtactttgaaatagttt	CRISPR spacer
agctatctttttcgtactttgaaatagttt	Protospacer
******************************

19. spacer 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448350 (Streptococcus satellite phage Javan19, complete genome) position: , mismatch: 0, identity: 1.0

tggaaaaagggcaaagtattcttgattata	CRISPR spacer
tggaaaaagggcaaagtattcttgattata	Protospacer
******************************

20. spacer 1.25|694|27|NZ_ALRX01000042|PILER-CR matches to MK448350 (Streptococcus satellite phage Javan19, complete genome) position: , mismatch: 0, identity: 1.0

ggaaaaagggcaaagtattcttgatta	CRISPR spacer
ggaaaaagggcaaagtattcttgatta	Protospacer
***************************

21. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 1, identity: 0.967

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaaatcttgagtcatcatataaaatctt	Protospacer
************.*****************

22. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 1, identity: 0.967

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaaatcttgagtcatcatataaaatctt	Protospacer
************.*****************

23. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 1, identity: 0.967

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaaatcttgagtcatcatataaaatctt	Protospacer
************.*****************

24. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 2, identity: 0.933

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
tcctctttctgtgtttcagttgccaatttt	Protospacer
**********.*******.***********

25. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 2, identity: 0.933

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
tcctctttctgtgtttcagttgccaatttt	Protospacer
**********.*******.***********

26. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 2, identity: 0.933

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaaatcttgaatcatcatatacaatttt	Protospacer
*********************** ***.**

27. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448395 (Streptococcus satellite phage Javan279, complete genome) position: , mismatch: 2, identity: 0.933

agctatctttttcgtactttgaaatagttt	CRISPR spacer
tgctatctttttcgtactttgcaatagttt	Protospacer
 ******************** ********

28. spacer 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder matches to NZ_AP018727 (Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD1, complete sequence) position: , mismatch: 2, identity: 0.933

tggaaaaagggcaaagtattcttgattata	CRISPR spacer
tagaaaaagggaaaagtattcttgattata	Protospacer
*.********* ******************

29. spacer 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder matches to NZ_AP018728 (Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD2, complete sequence) position: , mismatch: 2, identity: 0.933

tggaaaaagggcaaagtattcttgattata	CRISPR spacer
tagaaaaagggaaaagtattcttgattata	Protospacer
*.********* ******************

30. spacer 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder matches to NZ_AP018730 (Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD4, complete sequence) position: , mismatch: 2, identity: 0.933

tggaaaaagggcaaagtattcttgattata	CRISPR spacer
tagaaaaagggaaaagtattcttgattata	Protospacer
*.********* ******************

31. spacer 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder matches to NZ_AP018731 (Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD5, complete sequence) position: , mismatch: 2, identity: 0.933

tggaaaaagggcaaagtattcttgattata	CRISPR spacer
tagaaaaagggaaaagtattcttgattata	Protospacer
*.********* ******************

32. spacer 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448662 (Streptococcus satellite phage Javan97, complete genome) position: , mismatch: 2, identity: 0.933

tggaaaaagggcaaagtattcttgattata	CRISPR spacer
tagaaaaagggaaaagtattcttgattata	Protospacer
*.********* ******************

33. spacer 1.25|694|27|NZ_ALRX01000042|PILER-CR matches to NZ_AP018727 (Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD1, complete sequence) position: , mismatch: 2, identity: 0.926

ggaaaaagggcaaagtattcttgatta	CRISPR spacer
agaaaaagggaaaagtattcttgatta	Protospacer
.********* ****************

34. spacer 1.25|694|27|NZ_ALRX01000042|PILER-CR matches to NZ_AP018728 (Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD2, complete sequence) position: , mismatch: 2, identity: 0.926

ggaaaaagggcaaagtattcttgatta	CRISPR spacer
agaaaaagggaaaagtattcttgatta	Protospacer
.********* ****************

35. spacer 1.25|694|27|NZ_ALRX01000042|PILER-CR matches to NZ_AP018730 (Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD4, complete sequence) position: , mismatch: 2, identity: 0.926

ggaaaaagggcaaagtattcttgatta	CRISPR spacer
agaaaaagggaaaagtattcttgatta	Protospacer
.********* ****************

36. spacer 1.25|694|27|NZ_ALRX01000042|PILER-CR matches to NZ_AP018731 (Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD5, complete sequence) position: , mismatch: 2, identity: 0.926

ggaaaaagggcaaagtattcttgatta	CRISPR spacer
agaaaaagggaaaagtattcttgatta	Protospacer
.********* ****************

37. spacer 1.25|694|27|NZ_ALRX01000042|PILER-CR matches to MK448662 (Streptococcus satellite phage Javan97, complete genome) position: , mismatch: 2, identity: 0.926

ggaaaaagggcaaagtattcttgatta	CRISPR spacer
agaaaaagggaaaagtattcttgatta	Protospacer
.********* ****************

38. spacer 1.14|97|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 3, identity: 0.9

aaactaaagatattgactccctgcaggata	CRISPR spacer
aaaccaaagatattgactccctgcaagaca	Protospacer
****.********************.**.*

39. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448559 (Streptococcus satellite phage Javan596, complete genome) position: , mismatch: 3, identity: 0.9

agctatctttttcgtactttgaaatagttt	CRISPR spacer
tactatctttttcgtactttgagatagttt	Protospacer
 .********************.*******

40. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448553 (Streptococcus satellite phage Javan588, complete genome) position: , mismatch: 3, identity: 0.9

agctatctttttcgtactttgaaatagttt	CRISPR spacer
tactatctttttcgtactttgagatagttt	Protospacer
 .********************.*******

41. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448540 (Streptococcus satellite phage Javan559, complete genome) position: , mismatch: 3, identity: 0.9

agctatctttttcgtactttgaaatagttt	CRISPR spacer
tactatctttttcgtactttgagatagttt	Protospacer
 .********************.*******

42. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448550 (Streptococcus satellite phage Javan581, complete genome) position: , mismatch: 3, identity: 0.9

agctatctttttcgtactttgaaatagttt	CRISPR spacer
tactatctttttcgtactttgagatagttt	Protospacer
 .********************.*******

43. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448517 (Streptococcus satellite phage Javan495, complete genome) position: , mismatch: 3, identity: 0.9

agctatctttttcgtactttgaaatagttt	CRISPR spacer
tactatctttttcgtactttgagatagttt	Protospacer
 .********************.*******

44. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448385 (Streptococcus satellite phage Javan251, complete genome) position: , mismatch: 3, identity: 0.9

agctatctttttcgtactttgaaatagttt	CRISPR spacer
tgctatctttttcgtacttcgagatagttt	Protospacer
 ******************.**.*******

45. spacer 1.2|97|36|NZ_ALRX01000042|CRT matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 4, identity: 0.889

aaactaaagatattgactccctgcaggatagtttta	CRISPR spacer
aaactaaagatattgactccctgcaggatatggttt	Protospacer
******************************   ** 

46. spacer 1.2|97|36|NZ_ALRX01000042|CRT matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 4, identity: 0.889

aaactaaagatattgactccctgcaggatagtttta	CRISPR spacer
aaactaaagatattgactccctgcaggatatggttt	Protospacer
******************************   ** 

47. spacer 1.9|559|36|NZ_ALRX01000042|CRT matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 4, identity: 0.889

aaaaaatcttgaatcatcatataaaatcttgtttta	CRISPR spacer
aaaaaatcttgaatcatcatataaaatctttggtaa	Protospacer
******************************   * *

48. spacer 1.9|559|36|NZ_ALRX01000042|CRT matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 4, identity: 0.889

aaaaaatcttgaatcatcatataaaatcttgtttta	CRISPR spacer
aaaaaatcttgaatcatcatataaaatctttggtaa	Protospacer
******************************   * *

49. spacer 1.9|559|36|NZ_ALRX01000042|CRT matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 4, identity: 0.889

aaaaaatcttgaatcatcatataaaatcttgtttta	CRISPR spacer
aaaaaatcttgaatcatcatataaaatctttggtaa	Protospacer
******************************   * *

50. spacer 1.9|559|36|NZ_ALRX01000042|CRT matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 4, identity: 0.889

aaaaaatcttgaatcatcatataaaatcttgtttta	CRISPR spacer
aaaaaatcttgaatcatcatataaaatctttggtaa	Protospacer
******************************   * *

51. spacer 1.9|559|36|NZ_ALRX01000042|CRT matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 4, identity: 0.889

aaaaaatcttgaatcatcatataaaatcttgtttta	CRISPR spacer
aaaaaatcttgaatcatcatataaaatctttggtaa	Protospacer
******************************   * *

52. spacer 1.11|691|36|NZ_ALRX01000042|CRT matches to MK448350 (Streptococcus satellite phage Javan19, complete genome) position: , mismatch: 4, identity: 0.889

tggaaaaagggcaaagtattcttgattatagtttta	CRISPR spacer
tggaaaaagggcaaagtattcttgattatatgggta	Protospacer
******************************    **

53. spacer 1.16|229|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NC_009673 (Bacillus cytotoxicus NVH 391-98 plasmid pBC9801, complete sequence) position: , mismatch: 4, identity: 0.867

tagtagccattattattatggcttttattt	CRISPR spacer
taaaagccattaattttatggcttttattt	Protospacer
**. ******** * ***************

54. spacer 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.867

aaatgttaatttcatatctacatcttgtat	CRISPR spacer
aaatgttaatttcatatcaacatcttagct	Protospacer
****************** *******.  *

55. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448511 (Streptococcus satellite phage Javan473, complete genome) position: , mismatch: 4, identity: 0.867

agctatctttttcgtactttgaaatagttt	CRISPR spacer
tactatctttttcgtactttgagatagtct	Protospacer
 .********************.*****.*

56. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448437 (Streptococcus satellite phage Javan334, complete genome) position: , mismatch: 4, identity: 0.867

agctatctttttcgtactttgaaatagttt	CRISPR spacer
tactatctttttcgtactttgcgatagttt	Protospacer
 .******************* .*******

57. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448645 (Streptococcus satellite phage Javan757, complete genome) position: , mismatch: 4, identity: 0.867

agctatctttttcgtactttgaaatagttt	CRISPR spacer
tactatctttttcgtactttgagatagtct	Protospacer
 .********************.*****.*

58. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448380 (Streptococcus satellite phage Javan24, complete genome) position: , mismatch: 4, identity: 0.867

agctatctttttcgtactttgaaatagttt	CRISPR spacer
tactatctttttcgtactttgagatagtct	Protospacer
 .********************.*****.*

59. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448440 (Streptococcus satellite phage Javan338, complete genome) position: , mismatch: 4, identity: 0.867

agctatctttttcgtactttgaaatagttt	CRISPR spacer
tactatctttttcgtactttgcgatagttt	Protospacer
 .******************* .*******

60. spacer 1.8|493|36|NZ_ALRX01000042|CRT matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 5, identity: 0.861

tcctctttctatgtttcaattgccaattttgtttta	CRISPR spacer
tcctctttctatgtttcaattgccaattttcggctt	Protospacer
******************************   .* 

61. spacer 1.9|559|36|NZ_ALRX01000042|CRT matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 5, identity: 0.861

aaaaaatcttgaatcatcatataaaatcttgtttta	CRISPR spacer
aaaaaatcttgagtcatcatataaaatctttggtaa	Protospacer
************.*****************   * *

62. spacer 1.9|559|36|NZ_ALRX01000042|CRT matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 5, identity: 0.861

aaaaaatcttgaatcatcatataaaatcttgtttta	CRISPR spacer
aaaaaatcttgagtcatcatataaaatctttggtaa	Protospacer
************.*****************   * *

63. spacer 1.9|559|36|NZ_ALRX01000042|CRT matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 5, identity: 0.861

aaaaaatcttgaatcatcatataaaatcttgtttta	CRISPR spacer
aaaaaatcttgagtcatcatataaaatctttggtaa	Protospacer
************.*****************   * *

64. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448507 (Streptococcus satellite phage Javan463, complete genome) position: , mismatch: 5, identity: 0.861

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
agctatctttttcgtactttgaaatagtttggggat	Protospacer
*******************************     

65. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448510 (Streptococcus satellite phage Javan469, complete genome) position: , mismatch: 5, identity: 0.861

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
agctatctttttcgtactttgaaatagtttggggat	Protospacer
*******************************     

66. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448521 (Streptococcus satellite phage Javan518, complete genome) position: , mismatch: 5, identity: 0.861

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
agctatctttttcgtactttgaaatagtttggggat	Protospacer
*******************************     

67. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448501 (Streptococcus satellite phage Javan449, complete genome) position: , mismatch: 5, identity: 0.861

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
agctatctttttcgtactttgaaatagtttggggat	Protospacer
*******************************     

68. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448343 (Streptococcus satellite phage Javan162, complete genome) position: , mismatch: 5, identity: 0.861

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
agctatctttttcgtactttgaaatagtttggggat	Protospacer
*******************************     

69. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448329 (Streptococcus satellite phage Javan134, complete genome) position: , mismatch: 5, identity: 0.861

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
agctatctttttcgtactttgaaatagtttggggat	Protospacer
*******************************     

70. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448325 (Streptococcus satellite phage Javan125, complete genome) position: , mismatch: 5, identity: 0.861

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
agctatctttttcgtactttgaaatagtttggggat	Protospacer
*******************************     

71. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448504 (Streptococcus satellite phage Javan455, complete genome) position: , mismatch: 5, identity: 0.861

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
agctatctttttcgtactttgaaatagtttggggat	Protospacer
*******************************     

72. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448516 (Streptococcus satellite phage Javan490, complete genome) position: , mismatch: 5, identity: 0.861

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
agctatctttttcgtactttgaaatagtttggggat	Protospacer
*******************************     

73. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448335 (Streptococcus satellite phage Javan148, complete genome) position: , mismatch: 5, identity: 0.861

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
agctatctttttcgtactttgaaatagtttggggat	Protospacer
*******************************     

74. spacer 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

aaatgttaatttcatatctacatcttgtat	CRISPR spacer
aaatgttaatttcatatcaacagttttcat	Protospacer
****************** *** .** .**

75. spacer 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 5, identity: 0.833

aaatgttaatttcatatctacat-cttgtat	CRISPR spacer
aaatgttaattcaatatctacatgaatgta-	Protospacer
***********. **********   **** 

76. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448616 (Streptococcus satellite phage Javan729, complete genome) position: , mismatch: 5, identity: 0.833

agctatctttttcgtactttgaaatagttt	CRISPR spacer
tactatctttttcgtactttgcgatagtct	Protospacer
 .******************* .*****.*

77. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK448661 (Streptococcus satellite phage Javan96, complete genome) position: , mismatch: 5, identity: 0.833

agctatctttttcgtactttgaaatagttt	CRISPR spacer
tactatctttttcgtactttgagatggtct	Protospacer
 .********************.**.**.*

78. spacer 1.6|361|36|NZ_ALRX01000042|CRT matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.833

aaatgttaatttcatatctacatcttgtatgtttta	CRISPR spacer
aaatgttaatttcatatcaacatcttagctatatta	Protospacer
****************** *******.  *.* ***

79. spacer 1.11|691|36|NZ_ALRX01000042|CRT matches to NZ_AP018727 (Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD1, complete sequence) position: , mismatch: 6, identity: 0.833

tggaaaaagggcaaagtattcttgattatagtttta	CRISPR spacer
tagaaaaagggaaaagtattcttgattatatgggta	Protospacer
*.********* ******************    **

80. spacer 1.11|691|36|NZ_ALRX01000042|CRT matches to NZ_AP018728 (Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD2, complete sequence) position: , mismatch: 6, identity: 0.833

tggaaaaagggcaaagtattcttgattatagtttta	CRISPR spacer
tagaaaaagggaaaagtattcttgattatatgggta	Protospacer
*.********* ******************    **

81. spacer 1.11|691|36|NZ_ALRX01000042|CRT matches to NZ_AP018730 (Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD4, complete sequence) position: , mismatch: 6, identity: 0.833

tggaaaaagggcaaagtattcttgattatagtttta	CRISPR spacer
tagaaaaagggaaaagtattcttgattatatgggta	Protospacer
*.********* ******************    **

82. spacer 1.11|691|36|NZ_ALRX01000042|CRT matches to NZ_AP018731 (Streptococcus dysgalactiae strain Kdys0611 plasmid pFGCSD5, complete sequence) position: , mismatch: 6, identity: 0.833

tggaaaaagggcaaagtattcttgattatagtttta	CRISPR spacer
tagaaaaagggaaaagtattcttgattatatgggta	Protospacer
*.********* ******************    **

83. spacer 1.11|691|36|NZ_ALRX01000042|CRT matches to MK448662 (Streptococcus satellite phage Javan97, complete genome) position: , mismatch: 6, identity: 0.833

tggaaaaagggcaaagtattcttgattatagtttta	CRISPR spacer
tagaaaaagggaaaagtattcttgattatatgggta	Protospacer
*.********* ******************    **

84. spacer 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP007625 (Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

aaatgttaatttcatatctac---atcttgtat	CRISPR spacer
aaatgttaatttcatatcaacagtaactta---	Protospacer
****************** **   * ***.   

85. spacer 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP009650 (Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence) position: , mismatch: 6, identity: 0.8

aaatgttaatttcatatctac---atcttgtat	CRISPR spacer
aaatgttaatttcatatcaacagtaactta---	Protospacer
****************** **   * ***.   

86. spacer 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP045607 (Bacillus cereus strain SB1 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8

aaatgttaatttcatatctacatcttgtat	CRISPR spacer
agatgttaatttcatatcaacatttaagat	Protospacer
*.**************** ****.* . **

87. spacer 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to MN693492 (Marine virus AFVG_25M361, complete genome) position: , mismatch: 6, identity: 0.8

aaatgttaatttcatatctacatcttgtat	CRISPR spacer
aaagactaattttatatctacatcttctaa	Protospacer
*** ..******.************* ** 

88. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP048628 (Megamonas funiformis strain JCM 14723 plasmid putative_Mfuni1, complete sequence) position: , mismatch: 6, identity: 0.8

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
gcctttttctatgtttaaattgcctaatct	Protospacer
 ***.*********** ******* * *.*

89. spacer 1.2|97|36|NZ_ALRX01000042|CRT matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 7, identity: 0.806

aaactaaagatattgactccctgcaggatagtttta	CRISPR spacer
aaaccaaagatattgactccctgcaagacatggttc	Protospacer
****.********************.**.*   ** 

90. spacer 1.8|493|36|NZ_ALRX01000042|CRT matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 7, identity: 0.806

tcctctttctatgtttcaattgccaattttgtttta	CRISPR spacer
tcctctttctgtgtttcagttgccaattttcggctt	Protospacer
**********.*******.***********   .* 

91. spacer 1.8|493|36|NZ_ALRX01000042|CRT matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 7, identity: 0.806

tcctctttctatgtttcaattgccaattttgtttta	CRISPR spacer
tcctctttctgtgtttcagttgccaattttcggctt	Protospacer
**********.*******.***********   .* 

92. spacer 1.9|559|36|NZ_ALRX01000042|CRT matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 7, identity: 0.806

aaaaaatcttgaatcatcatataaaatcttgtttta	CRISPR spacer
aaaaaatcttgaatcatcatatacaatttttggaaa	Protospacer
*********************** ***.**     *

93. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448395 (Streptococcus satellite phage Javan279, complete genome) position: , mismatch: 7, identity: 0.806

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
tgctatctttttcgtactttgcaatagtttgaaaat	Protospacer
 ******************** *********     

94. spacer 1.14|97|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 7, identity: 0.767

aaactaaagatattgactccctgcaggata	CRISPR spacer
cgaatgtcgatattgactccgtgcaggata	Protospacer
 .* *.  ************ *********

95. spacer 1.14|97|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 7, identity: 0.767

aaactaaagatattgactccctgcaggata	CRISPR spacer
cgaatgtcgatattgactccgtgcaggata	Protospacer
 .* *.  ************ *********

96. spacer 1.14|97|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 7, identity: 0.767

aaactaaagatattgactccctgcaggata	CRISPR spacer
cgaatgtcgatattgactccgtgcaggata	Protospacer
 .* *.  ************ *********

97. spacer 1.15|163|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to MN694670 (Marine virus AFVG_250M589, complete genome) position: , mismatch: 7, identity: 0.767

tcttaatttagaaccttttttacttccttt	CRISPR spacer
atattctttagaaccttttttaattccttg	Protospacer
 . *  **************** ****** 

98. spacer 1.15|163|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to HQ634190 (Cyanophage Syn2 genomic sequence) position: , mismatch: 7, identity: 0.767

tcttaatttagaaccttttttacttccttt	CRISPR spacer
acattatttagaacgttttttacgtcctgg	Protospacer
 * * ********* ******** ****  

99. spacer 1.15|163|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to GU071097 (Synechococcus phage S-SSM5, complete genome) position: , mismatch: 7, identity: 0.767

tcttaatttagaaccttttttacttccttt	CRISPR spacer
acattatttagaacgttttttacgtcctgg	Protospacer
 * * ********* ******** ****  

100. spacer 1.15|163|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NC_015286 (Synechococcus phage Syn19, complete genome) position: , mismatch: 7, identity: 0.767

tcttaatttagaaccttttttacttccttt	CRISPR spacer
acattatttagaacgttttttacgtcctgg	Protospacer
 * * ********* ******** ****  

101. spacer 1.16|229|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP042375 (Leuconostoc carnosum strain CBA3620 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tagtagccattattattatggcttttattt	CRISPR spacer
ttgtagccatgattattatgggtttggtgg	Protospacer
* ******** ********** *** .*  

102. spacer 1.17|295|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP013072 (Sphingobium indicum B90A plasmid pSRL2, complete sequence) position: , mismatch: 7, identity: 0.767

ggatgatttcgattatgcggcggtggttga	CRISPR spacer
cgacgatttcgattatgcggcggcattcaa	Protospacer
 **.*******************.. *..*

103. spacer 1.17|295|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP005190 (Sphingobium sp. MI1205 plasmid pMI1, complete sequence) position: , mismatch: 7, identity: 0.767

ggatgatttcgattatgcggcggtggttga	CRISPR spacer
cgacgatttcgattatgcggcggccttcaa	Protospacer
 **.*******************.  *..*

104. spacer 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP020744 (Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

aaatgttaatttcatatctacatcttgtat	CRISPR spacer
aaatgttgatttcatatcaacatttaacag	Protospacer
*******.********** ****.* ..* 

105. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

106. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

107. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

108. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

109. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

110. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

111. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

112. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

113. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

114. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

115. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

116. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

117. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

118. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

119. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

120. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

121. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to NZ_CP024792 (Nostoc flagelliforme CCNUN1 plasmid pNFSY07, complete sequence) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
ttaatggcttgaaacttcatataaaatctt	Protospacer
  ** . ****** * **************

122. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to NC_047733 (Synechococcus phage S-RIM8 isolate RW_22_0300, complete genome) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaattcttgaatcatcataaactgtttg	Protospacer
***** *************** *  .*.* 

123. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to JF974289 (Synechococcus phage S-RIM8 A.HR3, complete genome) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaattcttgaatcatcataaactgtttg	Protospacer
***** *************** *  .*.* 

124. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK493323 (Synechococcus phage S-RIM8 isolate RW_03_0617, complete genome) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaattcttgaatcatcataaactgtttg	Protospacer
***** *************** *  .*.* 

125. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK493325 (Synechococcus phage S-RIM8 isolate RW_62_0316, complete genome) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaattcttgaatcatcataaactgtttg	Protospacer
***** *************** *  .*.* 

126. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK493322 (Synechococcus phage S-RIM8 isolate RW_01_0115_WH8101, complete genome) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaattcttgaatcatcataaactgtttg	Protospacer
***** *************** *  .*.* 

127. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to KX349288 (Synechococcus phage S-RIM8 isolate RW_08_0711, complete genome) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaattcttgaatcatcataaactgtttg	Protospacer
***** *************** *  .*.* 

128. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to NC_020486 (Synechococcus phage S-RIM8 A.HR1, complete genome) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaattcttgaatcatcataaactgtttg	Protospacer
***** *************** *  .*.* 

129. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to KX349286 (Synechococcus phage S-RIM8 isolate RW_03_0807_WH8101, complete genome) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaattcttgaatcatcataaactgtttg	Protospacer
***** *************** *  .*.* 

130. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to HQ317385 (Synechococcus phage S-RIM8 A.HR5, complete genome) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaattcttgaatcatcataaactgtttg	Protospacer
***** *************** *  .*.* 

131. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to MK493324 (Synechococcus phage S-RIM8 isolate RW_22_0214, complete genome) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaattcttgaatcatcataaactgtttg	Protospacer
***** *************** *  .*.* 

132. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to KX349290 (Synechococcus phage S-RIM8 isolate RW_25_1112, complete genome) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaattcttgaatcatcataaactgtttg	Protospacer
***** *************** *  .*.* 

133. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to KX349285 (Synechococcus phage S-RIM8 isolate RW_01_0212_WH8101, complete genome) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaattcttgaatcatcataaactgtttg	Protospacer
***** *************** *  .*.* 

134. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to KX349287 (Synechococcus phage S-RIM8 isolate RW_06_0613, complete genome) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaattcttgaatcatcataaactgtttg	Protospacer
***** *************** *  .*.* 

135. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to JF974293 (Cyanophage KBS-M-1A genomic sequence) position: , mismatch: 7, identity: 0.767

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaattcttgaatcatcataaactgtttg	Protospacer
***** *************** *  .*.* 

136. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448559 (Streptococcus satellite phage Javan596, complete genome) position: , mismatch: 8, identity: 0.778

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
tactatctttttcgtactttgagatagtttgaaaat	Protospacer
 .********************.********     

137. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448553 (Streptococcus satellite phage Javan588, complete genome) position: , mismatch: 8, identity: 0.778

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
tactatctttttcgtactttgagatagtttgaaaat	Protospacer
 .********************.********     

138. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448540 (Streptococcus satellite phage Javan559, complete genome) position: , mismatch: 8, identity: 0.778

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
tactatctttttcgtactttgagatagtttgaaaat	Protospacer
 .********************.********     

139. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448550 (Streptococcus satellite phage Javan581, complete genome) position: , mismatch: 8, identity: 0.778

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
tactatctttttcgtactttgagatagtttgaaaat	Protospacer
 .********************.********     

140. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448517 (Streptococcus satellite phage Javan495, complete genome) position: , mismatch: 8, identity: 0.778

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
tactatctttttcgtactttgagatagtttgaaaat	Protospacer
 .********************.********     

141. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448385 (Streptococcus satellite phage Javan251, complete genome) position: , mismatch: 8, identity: 0.778

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
tgctatctttttcgtacttcgagatagtttgaaagt	Protospacer
 ******************.**.********     

142. spacer 1.16|229|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.733

tagtagccattattattatggcttttattt	CRISPR spacer
cgttcctcattattattatggattttatgt	Protospacer
.. *  .************** ****** *

143. spacer 1.17|295|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP022991 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence) position: , mismatch: 8, identity: 0.733

ggatgatttcgattatgcggcggtggttga	CRISPR spacer
agaacggatcgtttatgcggcggtggttgg	Protospacer
.**  .  *** *****************.

144. spacer 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to MN694072 (Marine virus AFVG_250M222, complete genome) position: , mismatch: 8, identity: 0.733

aaatgttaatttcatatctacatcttgtat	CRISPR spacer
gtcaggtaatttaatatctatatcttgtac	Protospacer
.   * ****** *******.********.

145. spacer 1.19|427|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to MK288022 (Bacillus phage pW4, complete genome) position: , mismatch: 8, identity: 0.733

tggcgaaaaatggtattatctcaaaggcaa	CRISPR spacer
aaaggtgaaatggtattaactcaaagtcaa	Protospacer
 .. * .*********** ******* ***

146. spacer 1.19|427|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to KT070866 (Bacillus phage PBC4, complete genome) position: , mismatch: 8, identity: 0.733

tggcgaaaaatggtattatctcaaaggcaa	CRISPR spacer
aaaggtgaaatggtattaactcaaagtcaa	Protospacer
 .. * .*********** ******* ***

147. spacer 1.20|493|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 8, identity: 0.733

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaataac	Protospacer
. .************* * ********  .

148. spacer 1.21|559|30|NZ_ALRX01000042|CRISPRCasFinder matches to NC_048827 (Vibrio phage vB_VchM_Kuja, complete genome) position: , mismatch: 8, identity: 0.733

aaaaaatcttgaatcatcatataaaatctt	CRISPR spacer
aaaaaatcttgaagaatcatatattgttga	Protospacer
*************  ********  .*.  

149. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to NZ_MG205641 (Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence) position: , mismatch: 8, identity: 0.733

agctatctttttcgtactttgaaatagttt	CRISPR spacer
caagtcctttttcatattttgaaatagttt	Protospacer
 .   .*******.**.*************

150. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 8, identity: 0.733

agctatctttttcgtactttgaaatagttt	CRISPR spacer
caagtcctttttcatattttgaaatagttt	Protospacer
 .   .*******.**.*************

151. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to NZ_MG205642 (Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence) position: , mismatch: 8, identity: 0.733

agctatctttttcgtactttgaaatagttt	CRISPR spacer
caagtcctttttcatattttgaaatagttt	Protospacer
 .   .*******.**.*************

152. spacer 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder matches to NC_005250 (Vibrio anguillarum 775 plasmid pJM1, complete sequence) position: , mismatch: 8, identity: 0.733

tggaaaaagggcaaagtattcttgattata	CRISPR spacer
tggaaaaacggcaaagtaatctttgtcgat	Protospacer
******** ********* **** .*..  

153. spacer 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder matches to NZ_CP020532 (Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence) position: , mismatch: 8, identity: 0.733

tggaaaaagggcaaagtattcttgattata	CRISPR spacer
tggaaaaacggcaaagtaatctttgtcgat	Protospacer
******** ********* **** .*..  

154. spacer 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder matches to NZ_LK021128 (Vibrio anguillarum strain NB10 plasmid p67vangNB10, complete sequence) position: , mismatch: 8, identity: 0.733

tggaaaaagggcaaagtattcttgattata	CRISPR spacer
tggaaaaacggcaaagtaatctttgtcgat	Protospacer
******** ********* **** .*..  

155. spacer 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder matches to NC_022225 (Vibrio anguillarum M3 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

tggaaaaagggcaaagtattcttgattata	CRISPR spacer
tggaaaaacggcaaagtaatctttgtcgat	Protospacer
******** ********* **** .*..  

156. spacer 1.23|691|30|NZ_ALRX01000042|CRISPRCasFinder matches to NZ_CP023210 (Vibrio anguillarum strain ATCC-68554 plasmid p65, complete sequence) position: , mismatch: 8, identity: 0.733

tggaaaaagggcaaagtattcttgattata	CRISPR spacer
tggaaaaacggcaaagtaatctttgtcgat	Protospacer
******** ********* **** .*..  

157. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448511 (Streptococcus satellite phage Javan473, complete genome) position: , mismatch: 9, identity: 0.75

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
tactatctttttcgtactttgagatagtctgaaaat	Protospacer
 .********************.*****.**     

158. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448437 (Streptococcus satellite phage Javan334, complete genome) position: , mismatch: 9, identity: 0.75

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
tactatctttttcgtactttgcgatagtttgaaaac	Protospacer
 .******************* .********     

159. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448645 (Streptococcus satellite phage Javan757, complete genome) position: , mismatch: 9, identity: 0.75

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
tactatctttttcgtactttgagatagtctgaaaat	Protospacer
 .********************.*****.**     

160. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448380 (Streptococcus satellite phage Javan24, complete genome) position: , mismatch: 9, identity: 0.75

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
tactatctttttcgtactttgagatagtctgaaaat	Protospacer
 .********************.*****.**     

161. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to MK448440 (Streptococcus satellite phage Javan338, complete genome) position: , mismatch: 9, identity: 0.75

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
tactatctttttcgtactttgcgatagtttgaaaac	Protospacer
 .******************* .********     

162. spacer 1.15|163|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 9, identity: 0.7

tcttaatttagaaccttttttacttccttt	CRISPR spacer
tcttaatttagaacctttgtttagggtaat	Protospacer
****************** **     .  *

163. spacer 1.15|163|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to MH617331 (Microviridae sp. isolate ctbd619, complete genome) position: , mismatch: 9, identity: 0.7

tcttaatttagaaccttttttacttccttt	CRISPR spacer
gtaaacggcagaaccttttttactaccttt	Protospacer
 .  *   .*************** *****

164. spacer 1.18|361|30|NZ_ALRX01000042|PILER-CR,CRISPRCasFinder matches to MG592576 (Vibrio phage 1.206.O._10N.222.51.B10, partial genome) position: , mismatch: 9, identity: 0.7

aaatgttaatttcatatctacatcttgtat	CRISPR spacer
tcttgttaatttaatatctacaccttaatc	Protospacer
   ********* *********.***.  .

165. spacer 1.6|361|36|NZ_ALRX01000042|CRT matches to MG945789 (UNVERIFIED: Microviridae sp. isolate 4354-1801, complete genome) position: , mismatch: 10, identity: 0.722

aaatgttaatttcatatctacatcttgtatgtttta	CRISPR spacer
tacaatagcattcatatctatatcttttatgtttta	Protospacer
 *  .* .  **********.***** *********

166. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to NZ_MG205641 (Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence) position: , mismatch: 10, identity: 0.722

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
caagtcctttttcatattttgaaatagtttgtttag	Protospacer
 .   .*******.**.***************** .

167. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 10, identity: 0.722

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
caagtcctttttcatattttgaaatagtttgtttag	Protospacer
 .   .*******.**.***************** .

168. spacer 1.10|625|36|NZ_ALRX01000042|CRT matches to NZ_MG205642 (Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence) position: , mismatch: 10, identity: 0.722

agctatctttttcgtactttgaaatagtttgtttta	CRISPR spacer
caagtcctttttcatattttgaaatagtttgtttag	Protospacer
 .   .*******.**.***************** .

169. spacer 1.22|625|30|NZ_ALRX01000042|CRISPRCasFinder matches to NC_015712 (Clostridium perfringens plasmid pCPPB-1, complete sequence) position: , mismatch: 10, identity: 0.667

agctatctttttcgtactttgaaatagttt	CRISPR spacer
catcgataatttcgtactttgaaatatttt	Protospacer
 .... .  ***************** ***

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ALRX01000048
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRX01000048_1 1-954 TypeII II-A
14 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRX01000048_1 1.20|427|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 427-456 30 MK448729 Streptococcus phage Javan31, complete genome 10214-10243 0 1.0
NZ_ALRX01000048_1 1.20|427|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 427-456 30 MK448691 Streptococcus phage Javan17, complete genome 10214-10243 0 1.0
NZ_ALRX01000048_1 1.20|427|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 427-456 30 MK448948 Streptococcus phage Javan46, complete genome 10214-10243 0 1.0
NZ_ALRX01000048_1 1.20|427|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 427-456 30 MK448768 Streptococcus phage Javan47, complete genome 11359-11388 0 1.0
NZ_ALRX01000048_1 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 493-522 30 MK448708 Streptococcus phage Javan23, complete genome 17274-17303 1 0.967
NZ_ALRX01000048_1 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 493-522 30 MK448897 Streptococcus phage Javan28, complete genome 17274-17303 1 0.967
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 JX409894 Streptococcus phage LYGO9, complete genome 28291-28320 1 0.967
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 JX409895 Streptococcus phage JX01, complete genome 40138-40167 1 0.967
NZ_ALRX01000048_1 1.7|427|36|NZ_ALRX01000048|CRT 427-462 36 MK448729 Streptococcus phage Javan31, complete genome 10208-10243 2 0.944
NZ_ALRX01000048_1 1.7|427|36|NZ_ALRX01000048|CRT 427-462 36 MK448691 Streptococcus phage Javan17, complete genome 10208-10243 2 0.944
NZ_ALRX01000048_1 1.7|427|36|NZ_ALRX01000048|CRT 427-462 36 MK448948 Streptococcus phage Javan46, complete genome 10208-10243 2 0.944
NZ_ALRX01000048_1 1.7|427|36|NZ_ALRX01000048|CRT 427-462 36 MK448768 Streptococcus phage Javan47, complete genome 11353-11388 2 0.944
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448761 Streptococcus phage Javan445, complete genome 20710-20739 2 0.933
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448760 Streptococcus phage Javan443, complete genome 20710-20739 2 0.933
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448675 Streptococcus phage Javan129, complete genome 20835-20864 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448973 Streptococcus phage Javan522, complete genome 20036-20065 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 NC_004585 Streptococcus prophage 315.2, complete genome 19207-19236 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448749 Streptococcus phage Javan39, complete genome 20370-20399 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448955 Streptococcus phage Javan478, complete genome 21413-21442 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448966 Streptococcus phage Javan508, complete genome 19062-19091 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448859 Streptococcus phage Javan170, complete genome 20585-20614 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448690 Streptococcus phage Javan169, complete genome 20943-20972 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448772 Streptococcus phage Javan483, complete genome 19076-19105 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448778 Streptococcus phage Javan493, complete genome 19578-19607 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448962 Streptococcus phage Javan496, complete genome 9569-9598 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MH853356 Streptococcus phage LF2, partial genome 42651-42680 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448850 Streptococcus phage Javan132, complete genome 20172-20201 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448676 Streptococcus phage Javan131, complete genome 23095-23124 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448975 Streptococcus phage Javan526, complete genome 20360-20389 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448688 Streptococcus phage Javan161, complete genome 20538-20567 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448995 Streptococcus phage Javan626, complete genome 20462-20491 3 0.9
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MK448782 Streptococcus phage Javan501, complete genome 22718-22747 3 0.9
NZ_ALRX01000048_1 1.8|493|36|NZ_ALRX01000048|CRT 493-528 36 MK448708 Streptococcus phage Javan23, complete genome 17268-17303 4 0.889
NZ_ALRX01000048_1 1.8|493|36|NZ_ALRX01000048|CRT 493-528 36 MK448897 Streptococcus phage Javan28, complete genome 17268-17303 4 0.889
NZ_ALRX01000048_1 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 559-588 30 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 474277-474306 5 0.833
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 JX409894 Streptococcus phage LYGO9, complete genome 28285-28320 6 0.833
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 JX409895 Streptococcus phage JX01, complete genome 40132-40167 6 0.833
NZ_ALRX01000048_1 1.16|163|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 163-192 30 AP014352 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C33, *** SEQUENCING IN PROGRESS *** 25577-25606 6 0.8
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 NZ_MG205641 Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence 81513-81542 6 0.8
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 NZ_MG205642 Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence 81513-81542 6 0.8
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 AF424781 Staphylococcus aureus phage phi 11, complete genome 43535-43564 6 0.8
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 NC_004615 Staphylococcus phage 11, complete genome 43535-43564 6 0.8
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 NC_007063 Staphylococcus phage 88, complete genome 26683-26712 6 0.8
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 AY954966 Bacteriophage 88, complete genome 26683-26712 6 0.8
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 M34832 Bacteriophage phi-11 integrase (int) and excisionase (xis) genes, complete cds 1559-1588 6 0.8
NZ_ALRX01000048_1 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 691-720 30 MN904510 Staphylococcus phage vB_SauS-SAP27, complete genome 21975-22004 6 0.8
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448761 Streptococcus phage Javan445, complete genome 20710-20745 7 0.806
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448760 Streptococcus phage Javan443, complete genome 20710-20745 7 0.806
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448973 Streptococcus phage Javan522, complete genome 20036-20071 7 0.806
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448749 Streptococcus phage Javan39, complete genome 20370-20405 7 0.806
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448955 Streptococcus phage Javan478, complete genome 21413-21448 7 0.806
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448859 Streptococcus phage Javan170, complete genome 20585-20620 7 0.806
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448690 Streptococcus phage Javan169, complete genome 20943-20978 7 0.806
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448778 Streptococcus phage Javan493, complete genome 19578-19613 7 0.806
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448962 Streptococcus phage Javan496, complete genome 9569-9604 7 0.806
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448850 Streptococcus phage Javan132, complete genome 20172-20207 7 0.806
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448676 Streptococcus phage Javan131, complete genome 23095-23130 7 0.806
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448975 Streptococcus phage Javan526, complete genome 20360-20395 7 0.806
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448688 Streptococcus phage Javan161, complete genome 20538-20573 7 0.806
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448782 Streptococcus phage Javan501, complete genome 22718-22753 7 0.806
NZ_ALRX01000048_1 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 559-588 30 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 473664-473693 7 0.767
NZ_ALRX01000048_1 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 559-588 30 NZ_KJ776580 Clostridium botulinum strain CDC5900 plasmid pCDC5900, complete sequence 5593-5622 7 0.767
NZ_ALRX01000048_1 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 559-588 30 NZ_CP007625 Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence 284952-284981 7 0.767
NZ_ALRX01000048_1 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 559-588 30 NZ_CP009650 Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence 227979-228008 7 0.767
NZ_ALRX01000048_1 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 559-588 30 MG592576 Vibrio phage 1.206.O._10N.222.51.B10, partial genome 27486-27515 7 0.767
NZ_ALRX01000048_1 1.25|757|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 757-786 30 NZ_CP019367 Borrelia turicatae 91E135 isolate Oz1 plasmid lpG29, complete sequence 25253-25282 7 0.767
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448675 Streptococcus phage Javan129, complete genome 20835-20870 8 0.778
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 NC_004585 Streptococcus prophage 315.2, complete genome 19207-19242 8 0.778
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448966 Streptococcus phage Javan508, complete genome 19062-19097 8 0.778
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448772 Streptococcus phage Javan483, complete genome 19076-19111 8 0.778
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MH853356 Streptococcus phage LF2, partial genome 42645-42680 8 0.778
NZ_ALRX01000048_1 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 493-522 30 MT774411 CrAssphage cr273_1, complete genome 91946-91975 8 0.733
NZ_ALRX01000048_1 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 493-522 30 MT774410 CrAssphage cr272_1, complete genome 40926-40955 8 0.733
NZ_ALRX01000048_1 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 493-522 30 NZ_CP045419 Pseudoalteromonas sp. THAF3 plasmid pTHAF3_a, complete sequence 428420-428449 8 0.733
NZ_ALRX01000048_1 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 493-522 30 NC_031274 Pseudomonas phage O4, complete genome 9990-10019 8 0.733
NZ_ALRX01000048_1 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 493-522 30 MF788075 Pseudomonas phage IME180, complete genome 9501-9530 8 0.733
NZ_ALRX01000048_1 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 559-588 30 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 655420-655449 8 0.733
NZ_ALRX01000048_1 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 559-588 30 NZ_CP020744 Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence 311665-311694 8 0.733
NZ_ALRX01000048_1 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 559-588 30 NZ_CP045607 Bacillus cereus strain SB1 plasmid p1, complete sequence 493398-493427 8 0.733
NZ_ALRX01000048_1 1.25|757|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 757-786 30 MK295204 Shigella phage vB_SdyM_006, complete genome 59264-59293 8 0.733
NZ_ALRX01000048_1 1.25|757|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 757-786 30 MG696114 Proteus phage phiP4-3, complete genome 106666-106695 8 0.733
NZ_ALRX01000048_1 1.9|559|36|NZ_ALRX01000048|CRT 559-594 36 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 473658-473693 9 0.75
NZ_ALRX01000048_1 1.11|691|36|NZ_ALRX01000048|CRT 691-726 36 MK448995 Streptococcus phage Javan626, complete genome 20462-20497 9 0.75
NZ_ALRX01000048_1 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 493-522 30 KU160641 Arthrobacter phage CaptnMurica, complete genome 18771-18800 9 0.7
NZ_ALRX01000048_1 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder 493-522 30 MH825711 Arthrobacter phage Tenno, complete genome 18765-18794 9 0.7
NZ_ALRX01000048_1 1.9|559|36|NZ_ALRX01000048|CRT 559-594 36 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 474271-474306 10 0.722

1. spacer 1.20|427|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0

tatcgctcaagcattcgtatttgttttgga	CRISPR spacer
tatcgctcaagcattcgtatttgttttgga	Protospacer
******************************

2. spacer 1.20|427|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0

tatcgctcaagcattcgtatttgttttgga	CRISPR spacer
tatcgctcaagcattcgtatttgttttgga	Protospacer
******************************

3. spacer 1.20|427|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0

tatcgctcaagcattcgtatttgttttgga	CRISPR spacer
tatcgctcaagcattcgtatttgttttgga	Protospacer
******************************

4. spacer 1.20|427|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

tatcgctcaagcattcgtatttgttttgga	CRISPR spacer
tatcgctcaagcattcgtatttgttttgga	Protospacer
******************************

5. spacer 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448708 (Streptococcus phage Javan23, complete genome) position: , mismatch: 1, identity: 0.967

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
taccgcaataagatcaccaatgttatttga	Protospacer
************************.*****

6. spacer 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448897 (Streptococcus phage Javan28, complete genome) position: , mismatch: 1, identity: 0.967

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
taccgcaataagatcaccaatgttatttga	Protospacer
************************.*****

7. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 1, identity: 0.967

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
taaaaaaggcaaaataaagcactctggcaa	Protospacer
*********************.********

8. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 1, identity: 0.967

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
taaaaaaggcaaaataaagcactctggcaa	Protospacer
*********************.********

9. spacer 1.7|427|36|NZ_ALRX01000048|CRT matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 2, identity: 0.944

tatcgctcaagcattcgtatttgttttggagttttg	CRISPR spacer
tatcgctcaagcattcgtatttgttttggagttgtt	Protospacer
********************************* * 

10. spacer 1.7|427|36|NZ_ALRX01000048|CRT matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 2, identity: 0.944

tatcgctcaagcattcgtatttgttttggagttttg	CRISPR spacer
tatcgctcaagcattcgtatttgttttggagttgtt	Protospacer
********************************* * 

11. spacer 1.7|427|36|NZ_ALRX01000048|CRT matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 2, identity: 0.944

tatcgctcaagcattcgtatttgttttggagttttg	CRISPR spacer
tatcgctcaagcattcgtatttgttttggagttgtt	Protospacer
********************************* * 

12. spacer 1.7|427|36|NZ_ALRX01000048|CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 2, identity: 0.944

tatcgctcaagcattcgtatttgttttggagttttg	CRISPR spacer
tatcgctcaagcattcgtatttgttttggagttgtt	Protospacer
********************************* * 

13. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448761 (Streptococcus phage Javan445, complete genome) position: , mismatch: 2, identity: 0.933

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
taaaaacggcaaaataaagcattctggaaa	Protospacer
****** ******************** **

14. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448760 (Streptococcus phage Javan443, complete genome) position: , mismatch: 2, identity: 0.933

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
taaaaacggcaaaataaagcattctggaaa	Protospacer
****** ******************** **

15. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaa	Protospacer
.********************.*****.**

16. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaa	Protospacer
.********************.*****.**

17. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NC_004585 (Streptococcus prophage 315.2, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctgggaa	Protospacer
.********************.***** **

18. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaa	Protospacer
.********************.*****.**

19. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448955 (Streptococcus phage Javan478, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaa	Protospacer
.********************.*****.**

20. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448966 (Streptococcus phage Javan508, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctgggaa	Protospacer
.********************.***** **

21. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448859 (Streptococcus phage Javan170, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaa	Protospacer
.********************.*****.**

22. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448690 (Streptococcus phage Javan169, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaa	Protospacer
.********************.*****.**

23. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448772 (Streptococcus phage Javan483, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctgggaa	Protospacer
.********************.***** **

24. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaa	Protospacer
.********************.*****.**

25. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448962 (Streptococcus phage Javan496, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaa	Protospacer
.********************.*****.**

26. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caagaaaggcaaaataaagcattctgggaa	Protospacer
.**.*********************** **

27. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448850 (Streptococcus phage Javan132, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaa	Protospacer
.********************.*****.**

28. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448676 (Streptococcus phage Javan131, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaa	Protospacer
.********************.*****.**

29. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448975 (Streptococcus phage Javan526, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaa	Protospacer
.********************.*****.**

30. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448688 (Streptococcus phage Javan161, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaa	Protospacer
.********************.*****.**

31. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448995 (Streptococcus phage Javan626, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaacggcaaaataaagcattctggaaa	Protospacer
.***** ******************** **

32. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK448782 (Streptococcus phage Javan501, complete genome) position: , mismatch: 3, identity: 0.9

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaa	Protospacer
.********************.*****.**

33. spacer 1.8|493|36|NZ_ALRX01000048|CRT matches to MK448708 (Streptococcus phage Javan23, complete genome) position: , mismatch: 4, identity: 0.889

taccgcaataagatcaccaatgttgtttgagttttg	CRISPR spacer
taccgcaataagatcaccaatgttatttgatttcag	Protospacer
************************.***** **. *

34. spacer 1.8|493|36|NZ_ALRX01000048|CRT matches to MK448897 (Streptococcus phage Javan28, complete genome) position: , mismatch: 4, identity: 0.889

taccgcaataagatcaccaatgttgtttgagttttg	CRISPR spacer
taccgcaataagatcaccaatgttatttgatttcag	Protospacer
************************.***** **. *

35. spacer 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
agctaagatgttgatatgaaattaacattt	Protospacer
.. .******* ******************

36. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 6, identity: 0.833

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
taaaaaaggcaaaataaagcactctggcaatccatt	Protospacer
*********************.******** .. * 

37. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 6, identity: 0.833

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
taaaaaaggcaaaataaagcactctggcaatccatt	Protospacer
*********************.******** .. * 

38. spacer 1.16|163|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to AP014352 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C33, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

atttccataatcagtcgaaactgtaatttg	CRISPR spacer
atttgcataatcagttgaaactggtcttgg	Protospacer
**** **********.*******   ** *

39. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NZ_MG205641 (Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence) position: , mismatch: 6, identity: 0.8

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
tcaaaaagaaaaaataaagcattctcagaa	Protospacer
* ******. *************** . **

40. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NZ_MG205642 (Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence) position: , mismatch: 6, identity: 0.8

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
tcaaaaagaaaaaataaagcattctcagaa	Protospacer
* ******. *************** . **

41. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to AF424781 (Staphylococcus aureus phage phi 11, complete genome) position: , mismatch: 6, identity: 0.8

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
taaaaaaggcaaaaaaacgcattaaatcaa	Protospacer
************** ** *****  . ***

42. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NC_004615 (Staphylococcus phage 11, complete genome) position: , mismatch: 6, identity: 0.8

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
taaaaaaggcaaaaaaacgcattaaatcaa	Protospacer
************** ** *****  . ***

43. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NC_007063 (Staphylococcus phage 88, complete genome) position: , mismatch: 6, identity: 0.8

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
taaaaaaggcaaaaaaacgcattaaatcaa	Protospacer
************** ** *****  . ***

44. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to AY954966 (Bacteriophage 88, complete genome) position: , mismatch: 6, identity: 0.8

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
taaaaaaggcaaaaaaacgcattaaatcaa	Protospacer
************** ** *****  . ***

45. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to M34832 (Bacteriophage phi-11 integrase (int) and excisionase (xis) genes, complete cds) position: , mismatch: 6, identity: 0.8

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
taaaaaaggcaaaaaaacgcattaaatcaa	Protospacer
************** ** *****  . ***

46. spacer 1.24|691|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MN904510 (Staphylococcus phage vB_SauS-SAP27, complete genome) position: , mismatch: 6, identity: 0.8

taaaaaaggcaaaataaagcattctggcaa	CRISPR spacer
taaaaaaggcaaaaaaacgcattaaatcaa	Protospacer
************** ** *****  . ***

47. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448761 (Streptococcus phage Javan445, complete genome) position: , mismatch: 7, identity: 0.806

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
taaaaacggcaaaataaagcattctggaaatccatt	Protospacer
****** ******************** ** .. * 

48. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448760 (Streptococcus phage Javan443, complete genome) position: , mismatch: 7, identity: 0.806

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
taaaaacggcaaaataaagcattctggaaatccatt	Protospacer
****** ******************** ** .. * 

49. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 7, identity: 0.806

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaacccttt	Protospacer
.********************.*****.** ..** 

50. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 7, identity: 0.806

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaacccttt	Protospacer
.********************.*****.** ..** 

51. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448955 (Streptococcus phage Javan478, complete genome) position: , mismatch: 7, identity: 0.806

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaacccttt	Protospacer
.********************.*****.** ..** 

52. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448859 (Streptococcus phage Javan170, complete genome) position: , mismatch: 7, identity: 0.806

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaacccttt	Protospacer
.********************.*****.** ..** 

53. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448690 (Streptococcus phage Javan169, complete genome) position: , mismatch: 7, identity: 0.806

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaacccttt	Protospacer
.********************.*****.** ..** 

54. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 7, identity: 0.806

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaacccttt	Protospacer
.********************.*****.** ..** 

55. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448962 (Streptococcus phage Javan496, complete genome) position: , mismatch: 7, identity: 0.806

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaacccttt	Protospacer
.********************.*****.** ..** 

56. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448850 (Streptococcus phage Javan132, complete genome) position: , mismatch: 7, identity: 0.806

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaacccttt	Protospacer
.********************.*****.** ..** 

57. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448676 (Streptococcus phage Javan131, complete genome) position: , mismatch: 7, identity: 0.806

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaacccttt	Protospacer
.********************.*****.** ..** 

58. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448975 (Streptococcus phage Javan526, complete genome) position: , mismatch: 7, identity: 0.806

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaacccttt	Protospacer
.********************.*****.** ..** 

59. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448688 (Streptococcus phage Javan161, complete genome) position: , mismatch: 7, identity: 0.806

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaacccttt	Protospacer
.********************.*****.** ..** 

60. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448782 (Streptococcus phage Javan501, complete genome) position: , mismatch: 7, identity: 0.806

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaacccttt	Protospacer
.********************.*****.** ..** 

61. spacer 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
atgaaaactgttgatatgaaattaacattt	Protospacer
. . **. *** ******************

62. spacer 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NZ_KJ776580 (Clostridium botulinum strain CDC5900 plasmid pCDC5900, complete sequence) position: , mismatch: 7, identity: 0.767

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
attcaaaatgaagatatgaaattaacagtg	Protospacer
.  ***.*** **************** * 

63. spacer 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NZ_CP007625 (Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
taagttactgttgatatgaaattaacattt	Protospacer
 **   . *** ******************

64. spacer 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NZ_CP009650 (Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence) position: , mismatch: 7, identity: 0.767

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
taagttactgttgatatgaaattaacattt	Protospacer
 **   . *** ******************

65. spacer 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MG592576 (Vibrio phage 1.206.O._10N.222.51.B10, partial genome) position: , mismatch: 7, identity: 0.767

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
gattaaggtgtagatattaaattaacaaga	Protospacer
** .***.********* *********   

66. spacer 1.25|757|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NZ_CP019367 (Borrelia turicatae 91E135 isolate Oz1 plasmid lpG29, complete sequence) position: , mismatch: 7, identity: 0.767

acagacatatttgtcactttataaaataat	CRISPR spacer
tcagacatatttgtctctttattaatttga	Protospacer
 ************** ****** ** * . 

67. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 8, identity: 0.778

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctggtaacccatt	Protospacer
.********************.*****.** .. * 

68. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to NC_004585 (Streptococcus prophage 315.2, complete genome) position: , mismatch: 8, identity: 0.778

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctgggaacccatt	Protospacer
.********************.***** ** .. * 

69. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448966 (Streptococcus phage Javan508, complete genome) position: , mismatch: 8, identity: 0.778

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctgggaacccatt	Protospacer
.********************.***** ** .. * 

70. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448772 (Streptococcus phage Javan483, complete genome) position: , mismatch: 8, identity: 0.778

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaaaggcaaaataaagcactctgggaacccatt	Protospacer
.********************.***** ** .. * 

71. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 8, identity: 0.778

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caagaaaggcaaaataaagcattctgggaatccgtt	Protospacer
.**.*********************** ** .. * 

72. spacer 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MT774411 (CrAssphage cr273_1, complete genome) position: , mismatch: 8, identity: 0.733

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
cttgttaataagatcagcaatgttctttga	Protospacer
. .  .********** ******* *****

73. spacer 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MT774410 (CrAssphage cr272_1, complete genome) position: , mismatch: 8, identity: 0.733

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
cttgttaataagatcagcaatgttctttga	Protospacer
. .  .********** ******* *****

74. spacer 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NZ_CP045419 (Pseudoalteromonas sp. THAF3 plasmid pTHAF3_a, complete sequence) position: , mismatch: 8, identity: 0.733

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
gattacaataagatcaacaatgttatttat	Protospacer
 *...*********** *******.***. 

75. spacer 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NC_031274 (Pseudomonas phage O4, complete genome) position: , mismatch: 8, identity: 0.733

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
tgtggcaataagaccaccactgttgttacc	Protospacer
*.. *********.***** *******   

76. spacer 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MF788075 (Pseudomonas phage IME180, complete genome) position: , mismatch: 8, identity: 0.733

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
tgtggcaataagaccaccactgttgttacc	Protospacer
*.. *********.***** *******   

77. spacer 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.733

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
tacattcatgtagatattgaattaacattt	Protospacer
 *     ********** .***********

78. spacer 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NZ_CP020744 (Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
ctgttaaatgttgatatgaaatcaacattt	Protospacer
  .. *.**** **********.*******

79. spacer 1.22|559|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to NZ_CP045607 (Bacillus cereus strain SB1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

gaacaagatgtagatatgaaattaacattt	CRISPR spacer
atcttaaatgttgatatgaaattaacatct	Protospacer
.  . *.**** ****************.*

80. spacer 1.25|757|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MK295204 (Shigella phage vB_SdyM_006, complete genome) position: , mismatch: 8, identity: 0.733

acagacatatttgtcactttataaaataat	CRISPR spacer
gatgttttatttgacactttaaaaaataat	Protospacer
.  * . ****** ******* ********

81. spacer 1.25|757|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MG696114 (Proteus phage phiP4-3, complete genome) position: , mismatch: 8, identity: 0.733

acagacatatttgtcactttataaaataat	CRISPR spacer
gatgttttatttgacactttaaaaaataat	Protospacer
.  * . ****** ******* ********

82. spacer 1.9|559|36|NZ_ALRX01000048|CRT matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.75

gaacaagatgtagatatgaaattaacatttgttttg	CRISPR spacer
atgaaaactgttgatatgaaattaacatttcttttt	Protospacer
. . **. *** ****************** **** 

83. spacer 1.11|691|36|NZ_ALRX01000048|CRT matches to MK448995 (Streptococcus phage Javan626, complete genome) position: , mismatch: 9, identity: 0.75

taaaaaaggcaaaataaagcattctggcaagttttg	CRISPR spacer
caaaaacggcaaaataaagcattctggaaatccgct	Protospacer
.***** ******************** ** .. . 

84. spacer 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to KU160641 (Arthrobacter phage CaptnMurica, complete genome) position: , mismatch: 9, identity: 0.7

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
tgtgagaataagatcaccattgttgttaat	Protospacer
*.. . ************* ******* . 

85. spacer 1.21|493|30|NZ_ALRX01000048|PILER-CR,CRISPRCasFinder matches to MH825711 (Arthrobacter phage Tenno, complete genome) position: , mismatch: 9, identity: 0.7

taccgcaataagatcaccaatgttgtttga	CRISPR spacer
tgtgagaataagatcaccattgttgttaat	Protospacer
*.. . ************* ******* . 

86. spacer 1.9|559|36|NZ_ALRX01000048|CRT matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.722

gaacaagatgtagatatgaaattaacatttgttttg	CRISPR spacer
agctaagatgttgatatgaaattaacatttaccacg	Protospacer
.. .******* ******************... .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ALRX01000047
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1170 : 10766 11 Streptococcus_phage(77.78%) integrase attL 2923:2937|attR 18559:18573
DBSCAN-SWA_2 48648 : 58031 9 uncultured_Caudovirales_phage(28.57%) NA NA
DBSCAN-SWA_3 114800 : 123793 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_ALRX01000054
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRX01000054_1 23419-23509 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_ALRX01000049
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3865 : 11419 11 Streptococcus_phage(50.0%) integrase,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_ALRX01000009
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRX01000009_1 2271-2343 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRX01000009_1 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder 2294-2320 27 NZ_CP024108 Bacillus cytotoxicus strain CH_15 plasmid pCh15_83, complete sequence 19107-19133 6 0.778
NZ_ALRX01000009_1 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder 2294-2320 27 NZ_CP024100 Bacillus cytotoxicus strain CH_38 plasmid pCh38_83, complete sequence 81938-81964 6 0.778
NZ_ALRX01000009_1 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder 2294-2320 27 NZ_CP024122 Bacillus cytotoxicus strain CH_1 plasmid pCh1_67, complete sequence 36523-36549 6 0.778
NZ_ALRX01000009_1 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder 2294-2320 27 NZ_CP024115 Bacillus cytotoxicus strain CH_3 plasmid pCh3_83, complete sequence 6072-6098 6 0.778
NZ_ALRX01000009_1 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder 2294-2320 27 NZ_CP024110 Bacillus cytotoxicus strain CH_13 plasmid pCh13_79, complete sequence 12311-12337 6 0.778
NZ_ALRX01000009_1 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder 2294-2320 27 NZ_CP024106 Bacillus cytotoxicus strain CH_23 plasmid pCh23_67, complete sequence 66618-66644 6 0.778
NZ_ALRX01000009_1 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder 2294-2320 27 NZ_CP024118 Bacillus cytotoxicus strain CH_2 plasmid pCh2_83, complete sequence 12322-12348 6 0.778
NZ_ALRX01000009_1 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder 2294-2320 27 NZ_CP024097 Bacillus cytotoxicus strain CH_39 plasmid pCh39_83, complete sequence 23267-23293 6 0.778
NZ_ALRX01000009_1 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder 2294-2320 27 NZ_CP024103 Bacillus cytotoxicus strain CH_25 plasmid pCh25_67, complete sequence 36800-36826 6 0.778

1. spacer 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder matches to NZ_CP024108 (Bacillus cytotoxicus strain CH_15 plasmid pCh15_83, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

2. spacer 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder matches to NZ_CP024100 (Bacillus cytotoxicus strain CH_38 plasmid pCh38_83, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

3. spacer 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder matches to NZ_CP024122 (Bacillus cytotoxicus strain CH_1 plasmid pCh1_67, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

4. spacer 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder matches to NZ_CP024115 (Bacillus cytotoxicus strain CH_3 plasmid pCh3_83, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

5. spacer 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder matches to NZ_CP024110 (Bacillus cytotoxicus strain CH_13 plasmid pCh13_79, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

6. spacer 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder matches to NZ_CP024106 (Bacillus cytotoxicus strain CH_23 plasmid pCh23_67, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

7. spacer 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder matches to NZ_CP024118 (Bacillus cytotoxicus strain CH_2 plasmid pCh2_83, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

8. spacer 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder matches to NZ_CP024097 (Bacillus cytotoxicus strain CH_39 plasmid pCh39_83, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

9. spacer 1.1|2294|27|NZ_ALRX01000009|CRISPRCasFinder matches to NZ_CP024103 (Bacillus cytotoxicus strain CH_25 plasmid pCh25_67, complete sequence) position: , mismatch: 6, identity: 0.778

tttaattgacaattaataaaggttgtt	CRISPR spacer
ttttattgacaattaataaagggcaag	Protospacer
*** ****************** ..  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_ALRX01000037
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALRX01000037.1|WP_000384271.1|64271_64598_+|hypothetical-protein 64271_64598_+ 108 aa aa AcrIIA21 NA NA No NA
14. NZ_ALRX01000045
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRX01000045_1 46095-46176 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage