Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALRU01000079 Streptococcus agalactiae LMG 14608 ctg7180000003328, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000132 Streptococcus agalactiae LMG 14608 ctg7180000003381, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000134 Streptococcus agalactiae LMG 14608 ctg7180000003383, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000003 Streptococcus agalactiae LMG 14608 ctg7180000003233, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000124 Streptococcus agalactiae LMG 14608 ctg7180000003373, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000063 Streptococcus agalactiae LMG 14608 ctg7180000003312, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000059 Streptococcus agalactiae LMG 14608 ctg7180000003308, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000120 Streptococcus agalactiae LMG 14608 ctg7180000003369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000034 Streptococcus agalactiae LMG 14608 ctg7180000003283, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000139 Streptococcus agalactiae LMG 14608 ctg7180000003388, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000091 Streptococcus agalactiae LMG 14608 ctg7180000003340, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000111 Streptococcus agalactiae LMG 14608 ctg7180000003360, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000118 Streptococcus agalactiae LMG 14608 ctg7180000003367, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000100 Streptococcus agalactiae LMG 14608 ctg7180000003349, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000104 Streptococcus agalactiae LMG 14608 ctg7180000003353, whole genome shotgun sequence 1 crisprs csn2 0 12 0 0
NZ_ALRU01000030 Streptococcus agalactiae LMG 14608 ctg7180000003279, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000093 Streptococcus agalactiae LMG 14608 ctg7180000003342, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000117 Streptococcus agalactiae LMG 14608 ctg7180000003366, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000032 Streptococcus agalactiae LMG 14608 ctg7180000003281, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000033 Streptococcus agalactiae LMG 14608 ctg7180000003282, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000105 Streptococcus agalactiae LMG 14608 ctg7180000003354, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000090 Streptococcus agalactiae LMG 14608 ctg7180000003339, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000020 Streptococcus agalactiae LMG 14608 ctg7180000003269, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000045 Streptococcus agalactiae LMG 14608 ctg7180000003294, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000021 Streptococcus agalactiae LMG 14608 ctg7180000003270, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000080 Streptococcus agalactiae LMG 14608 ctg7180000003329, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000106 Streptococcus agalactiae LMG 14608 ctg7180000003355, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000057 Streptococcus agalactiae LMG 14608 ctg7180000003306, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000078 Streptococcus agalactiae LMG 14608 ctg7180000003327, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000018 Streptococcus agalactiae LMG 14608 ctg7180000003267, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000113 Streptococcus agalactiae LMG 14608 ctg7180000003362, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000054 Streptococcus agalactiae LMG 14608 ctg7180000003303, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000025 Streptococcus agalactiae LMG 14608 ctg7180000003274, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000027 Streptococcus agalactiae LMG 14608 ctg7180000003276, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000015 Streptococcus agalactiae LMG 14608 ctg7180000003264, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000058 Streptococcus agalactiae LMG 14608 ctg7180000003307, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000136 Streptococcus agalactiae LMG 14608 ctg7180000003385, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000009 Streptococcus agalactiae LMG 14608 ctg7180000003258, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000051 Streptococcus agalactiae LMG 14608 ctg7180000003300, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000089 Streptococcus agalactiae LMG 14608 ctg7180000003338, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000082 Streptococcus agalactiae LMG 14608 ctg7180000003331, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000081 Streptococcus agalactiae LMG 14608 ctg7180000003330, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRU01000064 Streptococcus agalactiae LMG 14608 ctg7180000003313, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000101 Streptococcus agalactiae LMG 14608 ctg7180000003350, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000127 Streptococcus agalactiae LMG 14608 ctg7180000003376, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000061 Streptococcus agalactiae LMG 14608 ctg7180000003310, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000094 Streptococcus agalactiae LMG 14608 ctg7180000003343, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000131 Streptococcus agalactiae LMG 14608 ctg7180000003380, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALRU01000130 Streptococcus agalactiae LMG 14608 ctg7180000003379, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000004 Streptococcus agalactiae LMG 14608 ctg7180000003253, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000084 Streptococcus agalactiae LMG 14608 ctg7180000003333, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000076 Streptococcus agalactiae LMG 14608 ctg7180000003325, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000115 Streptococcus agalactiae LMG 14608 ctg7180000003364, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000097 Streptococcus agalactiae LMG 14608 ctg7180000003346, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000110 Streptococcus agalactiae LMG 14608 ctg7180000003359, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000087 Streptococcus agalactiae LMG 14608 ctg7180000003336, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000140 Streptococcus agalactiae LMG 14608 ctg7180000003389, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000103 Streptococcus agalactiae LMG 14608 ctg7180000003352, whole genome shotgun sequence 0 crisprs cas9,cas1,cas2 0 0 0 0
NZ_ALRU01000138 Streptococcus agalactiae LMG 14608 ctg7180000003387, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000037 Streptococcus agalactiae LMG 14608 ctg7180000003286, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000050 Streptococcus agalactiae LMG 14608 ctg7180000003299, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000107 Streptococcus agalactiae LMG 14608 ctg7180000003356, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000053 Streptococcus agalactiae LMG 14608 ctg7180000003302, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000014 Streptococcus agalactiae LMG 14608 ctg7180000003263, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000060 Streptococcus agalactiae LMG 14608 ctg7180000003309, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000122 Streptococcus agalactiae LMG 14608 ctg7180000003371, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRU01000071 Streptococcus agalactiae LMG 14608 ctg7180000003320, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000126 Streptococcus agalactiae LMG 14608 ctg7180000003375, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000022 Streptococcus agalactiae LMG 14608 ctg7180000003271, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000013 Streptococcus agalactiae LMG 14608 ctg7180000003262, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000135 Streptococcus agalactiae LMG 14608 ctg7180000003384, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000092 Streptococcus agalactiae LMG 14608 ctg7180000003341, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000070 Streptococcus agalactiae LMG 14608 ctg7180000003319, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000083 Streptococcus agalactiae LMG 14608 ctg7180000003332, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000029 Streptococcus agalactiae LMG 14608 ctg7180000003278, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000049 Streptococcus agalactiae LMG 14608 ctg7180000003298, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000047 Streptococcus agalactiae LMG 14608 ctg7180000003296, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000036 Streptococcus agalactiae LMG 14608 ctg7180000003285, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000019 Streptococcus agalactiae LMG 14608 ctg7180000003268, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000039 Streptococcus agalactiae LMG 14608 ctg7180000003288, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000052 Streptococcus agalactiae LMG 14608 ctg7180000003301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000072 Streptococcus agalactiae LMG 14608 ctg7180000003321, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000095 Streptococcus agalactiae LMG 14608 ctg7180000003344, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000038 Streptococcus agalactiae LMG 14608 ctg7180000003287, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000065 Streptococcus agalactiae LMG 14608 ctg7180000003314, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000026 Streptococcus agalactiae LMG 14608 ctg7180000003275, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000073 Streptococcus agalactiae LMG 14608 ctg7180000003322, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000046 Streptococcus agalactiae LMG 14608 ctg7180000003295, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000017 Streptococcus agalactiae LMG 14608 ctg7180000003266, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000141 Streptococcus agalactiae LMG 14608 ctg7180000003390, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000088 Streptococcus agalactiae LMG 14608 ctg7180000003337, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000075 Streptococcus agalactiae LMG 14608 ctg7180000003324, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000129 Streptococcus agalactiae LMG 14608 ctg7180000003378, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALRU01000007 Streptococcus agalactiae LMG 14608 ctg7180000003256, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000121 Streptococcus agalactiae LMG 14608 ctg7180000003370, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000012 Streptococcus agalactiae LMG 14608 ctg7180000003261, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000099 Streptococcus agalactiae LMG 14608 ctg7180000003348, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000133 Streptococcus agalactiae LMG 14608 ctg7180000003382, whole genome shotgun sequence 0 crisprs NA 0 0 3 0
NZ_ALRU01000011 Streptococcus agalactiae LMG 14608 ctg7180000003260, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000074 Streptococcus agalactiae LMG 14608 ctg7180000003323, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000010 Streptococcus agalactiae LMG 14608 ctg7180000003259, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000123 Streptococcus agalactiae LMG 14608 ctg7180000003372, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000016 Streptococcus agalactiae LMG 14608 ctg7180000003265, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000067 Streptococcus agalactiae LMG 14608 ctg7180000003316, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000028 Streptococcus agalactiae LMG 14608 ctg7180000003277, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000137 Streptococcus agalactiae LMG 14608 ctg7180000003386, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000056 Streptococcus agalactiae LMG 14608 ctg7180000003305, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALRU01000116 Streptococcus agalactiae LMG 14608 ctg7180000003365, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000102 Streptococcus agalactiae LMG 14608 ctg7180000003351, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000008 Streptococcus agalactiae LMG 14608 ctg7180000003257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000062 Streptococcus agalactiae LMG 14608 ctg7180000003311, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000112 Streptococcus agalactiae LMG 14608 ctg7180000003361, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000096 Streptococcus agalactiae LMG 14608 ctg7180000003345, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000066 Streptococcus agalactiae LMG 14608 ctg7180000003315, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000006 Streptococcus agalactiae LMG 14608 ctg7180000003255, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000035 Streptococcus agalactiae LMG 14608 ctg7180000003284, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000077 Streptococcus agalactiae LMG 14608 ctg7180000003326, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000069 Streptococcus agalactiae LMG 14608 ctg7180000003318, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000068 Streptococcus agalactiae LMG 14608 ctg7180000003317, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000001 Streptococcus agalactiae LMG 14608 ctg7180000002912, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000055 Streptococcus agalactiae LMG 14608 ctg7180000003304, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000031 Streptococcus agalactiae LMG 14608 ctg7180000003280, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000086 Streptococcus agalactiae LMG 14608 ctg7180000003335, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRU01000044 Streptococcus agalactiae LMG 14608 ctg7180000003293, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000024 Streptococcus agalactiae LMG 14608 ctg7180000003273, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000085 Streptococcus agalactiae LMG 14608 ctg7180000003334, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000043 Streptococcus agalactiae LMG 14608 ctg7180000003292, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRU01000128 Streptococcus agalactiae LMG 14608 ctg7180000003377, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000042 Streptococcus agalactiae LMG 14608 ctg7180000003291, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000114 Streptococcus agalactiae LMG 14608 ctg7180000003363, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000098 Streptococcus agalactiae LMG 14608 ctg7180000003347, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000109 Streptococcus agalactiae LMG 14608 ctg7180000003358, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000125 Streptococcus agalactiae LMG 14608 ctg7180000003374, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000041 Streptococcus agalactiae LMG 14608 ctg7180000003290, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000119 Streptococcus agalactiae LMG 14608 ctg7180000003368, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000023 Streptococcus agalactiae LMG 14608 ctg7180000003272, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000040 Streptococcus agalactiae LMG 14608 ctg7180000003289, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000048 Streptococcus agalactiae LMG 14608 ctg7180000003297, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000108 Streptococcus agalactiae LMG 14608 ctg7180000003357, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000002 Streptococcus agalactiae LMG 14608 ctg7180000002914, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRU01000005 Streptococcus agalactiae LMG 14608 ctg7180000003254, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ALRU01000056
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALRU01000056.1|WP_000384271.1|15399_15726_-|hypothetical-protein 15399_15726_- 108 aa aa AcrIIA21 NA NA No NA
2. NZ_ALRU01000104
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRU01000104_1 886-1911 TypeII-A II-A
15 spacers
csn2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRU01000104_1 1.4|1120|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1120-1149 30 JX409894 Streptococcus phage LYGO9, complete genome 37492-37521 0 1.0
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448675 Streptococcus phage Javan129, complete genome 10387-10416 0 1.0
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448771 Streptococcus phage Javan481, complete genome 6321-6350 0 1.0
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448973 Streptococcus phage Javan522, complete genome 8226-8255 0 1.0
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448774 Streptococcus phage Javan487, complete genome 6306-6335 0 1.0
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448778 Streptococcus phage Javan493, complete genome 8241-8270 0 1.0
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448958 Streptococcus phage Javan486, complete genome 8550-8579 0 1.0
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448956 Streptococcus phage Javan48, complete genome 13968-13997 0 1.0
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448749 Streptococcus phage Javan39, complete genome 13968-13997 0 1.0
NZ_ALRU01000104_1 1.12|1648|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1648-1677 30 MK448711 Streptococcus phage Javan235, complete genome 7584-7613 0 1.0
NZ_ALRU01000104_1 1.13|1714|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1714-1743 30 MK448711 Streptococcus phage Javan235, complete genome 7584-7613 0 1.0
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 MK448790 Streptococcus phage Javan515, complete genome 1426-1455 0 1.0
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 MK448957 Streptococcus phage Javan484, complete genome 1422-1451 0 1.0
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448850 Streptococcus phage Javan132, complete genome 10906-10935 1 0.967
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448851 Streptococcus phage Javan14, complete genome 11717-11746 1 0.967
NZ_ALRU01000104_1 1.4|1120|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1120-1149 30 MK448845 Streptococcus phage Javan118, complete genome 8851-8880 2 0.933
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448681 Streptococcus phage Javan141, complete genome 6109-6138 2 0.933
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448944 Streptococcus phage Javan452, complete genome 10585-10614 2 0.933
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448672 Streptococcus phage Javan117, complete genome 6167-6196 2 0.933
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448849 Streptococcus phage Javan128, complete genome 6260-6289 2 0.933
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MH853356 Streptococcus phage LF2, partial genome 7489-7518 2 0.933
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448933 Streptococcus phage Javan420, complete genome 10082-10111 2 0.933
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448845 Streptococcus phage Javan118, complete genome 8048-8077 2 0.933
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MK448673 Streptococcus phage Javan119, complete genome 9523-9552 2 0.933
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448704 Streptococcus phage Javan213, complete genome 11298-11327 2 0.933
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448734 Streptococcus phage Javan347, complete genome 8977-9006 2 0.933
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448876 Streptococcus phage Javan214, complete genome 11800-11829 2 0.933
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 HG424323 Streptococcus phage 20617 complete prophage genome 40561-40590 2 0.933
NZ_ALRU01000104_1 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1582-1611 30 MK448796 Streptococcus phage Javan53, complete genome 1809-1838 2 0.933
NZ_ALRU01000104_1 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1582-1611 30 MK448736 Streptococcus phage Javan35, complete genome 1709-1738 2 0.933
NZ_ALRU01000104_1 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1582-1611 30 MK448781 Streptococcus phage Javan5, complete genome 1709-1738 2 0.933
NZ_ALRU01000104_1 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1582-1611 30 MK448938 Streptococcus phage Javan44, complete genome 1709-1738 2 0.933
NZ_ALRU01000104_1 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1582-1611 30 MK448911 Streptococcus phage Javan34, complete genome 1709-1738 2 0.933
NZ_ALRU01000104_1 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1582-1611 30 MK448916 Streptococcus phage Javan36, complete genome 1709-1738 2 0.933
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448796 Streptococcus phage Javan53, complete genome 17381-17410 3 0.9
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448822 Streptococcus phage Javan629, complete genome 13388-13417 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH892366 Streptococcus phage SW18, complete genome 22497-22526 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH937501 Streptococcus phage CHPC1073, complete genome 20886-20915 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH973662 Streptococcus phage SW7, complete genome 22351-22380 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH892373 Streptococcus phage SW27, complete genome 19539-19568 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 KY705256 Streptococcus phage P3681, complete genome 23190-23219 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MF161328 Streptococcus phage D4276, complete genome 21671-21700 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 KX879643 Streptococcus phage CHPC1151, complete genome 20070-20099 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH937458 Streptococcus phage CHPC572, complete genome 22116-22145 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH892363 Streptococcus phage SW14, complete genome 23138-23167 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 KY705252 Streptococcus phage P0092, complete genome 19588-19617 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH937506 Streptococcus phage CHPC1148, complete genome 21012-21041 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH937486 Streptococcus phage CHPC1027, complete genome 21636-21665 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH937471 Streptococcus phage CHPC927, complete genome 23002-23031 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 KY705282 Streptococcus phage P8921, complete genome 22072-22101 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 KY705253 Streptococcus phage P0093, complete genome 19588-19617 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 KY705287 Streptococcus phage P9854, complete genome 23623-23652 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH892367 Streptococcus phage SW19, complete genome 20151-20180 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH892355 Streptococcus phage SW4, complete genome 19443-19472 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 KY705263 Streptococcus phage P7133, complete genome 21137-21166 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH937467 Streptococcus phage CHPC877, complete genome 22120-22149 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 KY705254 Streptococcus phage P0094, complete genome 19588-19617 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 KY705264 Streptococcus phage P7134, complete genome 20896-20925 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 KY705260 Streptococcus phage P5651, complete genome 21779-21808 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 KY705284 Streptococcus phage P9851, complete genome 22500-22529 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH973663 Streptococcus phage SW24, complete genome 19662-19691 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 KY705272 Streptococcus phage P7601, complete genome 22668-22697 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH937488 Streptococcus phage CHPC1033, complete genome 22921-22950 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 KY705271 Streptococcus phage P7574, complete genome 21221-21250 3 0.9
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 KY705265 Streptococcus phage P7151, complete genome 22501-22530 3 0.9
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448736 Streptococcus phage Javan35, complete genome 13064-13093 4 0.867
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448781 Streptococcus phage Javan5, complete genome 15086-15115 4 0.867
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448938 Streptococcus phage Javan44, complete genome 13065-13094 4 0.867
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 HG424323 Streptococcus phage 20617 complete prophage genome 15101-15130 4 0.867
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448911 Streptococcus phage Javan34, complete genome 13064-13093 4 0.867
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448916 Streptococcus phage Javan36, complete genome 13064-13093 4 0.867
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448755 Streptococcus phage Javan423, complete genome 12783-12812 4 0.867
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448756 Streptococcus phage Javan425, complete genome 12783-12812 4 0.867
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448707 Streptococcus phage Javan227, complete genome 16383-16412 4 0.867
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448954 Streptococcus phage Javan476, complete genome 12435-12464 4 0.867
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK449012 Streptococcus phage Javan94, complete genome 12477-12506 4 0.867
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448680 Streptococcus phage Javan139, complete genome 10668-10697 4 0.867
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 NC_000872 Streptococcus phage Sfi21, complete genome 36726-36755 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 KY705251 Streptococcus phage P0091, complete genome 31406-31435 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 KY705273 Streptococcus phage P7602, complete genome 33980-34009 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MH937473 Streptococcus phage CHPC929, complete genome 35982-36011 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MH892360 Streptococcus phage SW11, complete genome 33275-33304 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MH892353 Streptococcus phage SW2, complete genome 34246-34275 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 KY705277 Streptococcus phage P7951, complete genome 31360-31389 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 NC_000871 Streptococcus phage Sfi19, complete genome 35421-35450 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MH937464 Streptococcus phage CHPC869, complete genome 34213-34242 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MH937480 Streptococcus phage CHPC954, complete genome 34114-34143 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448753 Streptococcus phage Javan407, complete genome 12528-12557 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MH937475 Streptococcus phage CHPC931, complete genome 33663-33692 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MF417967 Uncultured Caudovirales phage clone 3S_16, partial genome 7733-7762 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 AF158601 Streptococcus thermophilus bacteriophage SFi18 lysin, gp111, gp183, gp47, gp54, gp71, gp145, gp69, gp40, gp229, gp157, gp233, putative helicase, gp151, gp271, putative primase, gp143, gp106, gp89, gp57, gp51, gp66, gp192, putative DNA binding protein, gp99, and gp235 genes, complete cds 12499-12528 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 KY705268 Streptococcus phage P7571, complete genome 32083-32112 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 KY705269 Streptococcus phage P7572, complete genome 30586-30615 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 KY705281 Streptococcus phage P7955, complete genome 33997-34026 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 AF115103 Streptococcus thermophilus bacteriophage Sfi21, complete genome 36726-36755 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 NC_013645 Streptococcus phage Abc2, complete genome 31500-31529 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 AF115102 Streptococcus thermophilus bacteriophage Sfi19, complete genome 35421-35450 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 FJ226752 Streptococcus phage ALQ13.2, complete genome 32704-32733 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 NC_002214 Streptococcus thermophilus bacteriophage Sfi11, complete genome 37427-37456 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 KY705272 Streptococcus phage P7601, complete genome 32090-32119 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 KY705271 Streptococcus phage P7574, complete genome 32891-32920 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MH937505 Streptococcus phage CHPC1109, complete genome 30694-30723 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MH937469 Streptococcus phage CHPC919, complete genome 33754-33783 5 0.833
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MH937491 Streptococcus phage CHPC1037, partial genome 33178-33207 5 0.833
NZ_ALRU01000104_1 1.12|1648|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1648-1677 30 MK448750 Streptococcus phage Javan393, complete genome 3056-3085 5 0.833
NZ_ALRU01000104_1 1.13|1714|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1714-1743 30 MK448750 Streptococcus phage Javan393, complete genome 3056-3085 5 0.833
NZ_ALRU01000104_1 1.2|988|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 988-1017 30 NZ_CP045273 Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence 484680-484709 6 0.8
NZ_ALRU01000104_1 1.7|1318|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1318-1347 30 KY065466 Streptococcus phage IPP25, complete genome 30380-30409 6 0.8
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448896 Streptococcus phage Javan278, complete genome 6108-6137 6 0.8
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448757 Streptococcus phage Javan427, complete genome 14224-14253 6 0.8
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MK448890 Streptococcus phage Javan264, complete genome 30767-30796 6 0.8
NZ_ALRU01000104_1 1.12|1648|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1648-1677 30 KJ018211 Shewanella sp. phage 1/40, complete genome 81048-81077 6 0.8
NZ_ALRU01000104_1 1.13|1714|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1714-1743 30 KJ018211 Shewanella sp. phage 1/40, complete genome 81048-81077 6 0.8
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NC_018685 Bacillus thuringiensis MC28 plasmid pMC95, complete sequence 82837-82866 6 0.8
NZ_ALRU01000104_1 1.1|922|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 922-951 30 JX006077 Saccharomonospora phage PIS 136, complete genome 75570-75599 7 0.767
NZ_ALRU01000104_1 1.8|1384|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1384-1413 30 MN602266 Bacteriophage DSS3_VP1, complete genome 51181-51210 7 0.767
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 NZ_CP006727 Leptospira interrogans serovar Linhai str. 56609 plasmid lcp3, complete sequence 30951-30980 7 0.767
NZ_ALRU01000104_1 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1450-1479 30 MK448885 Streptococcus phage Javan252, complete genome 13038-13067 7 0.767
NZ_ALRU01000104_1 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1582-1611 30 MN399336 Edwardsiella phage vB_EtaM_ET-ABTNL-9, complete genome 82194-82223 7 0.767
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NZ_CP034168 Enterococcus avium strain 352 plasmid unnamed, complete sequence 14259-14288 7 0.767
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NZ_CP053971 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence 180131-180160 7 0.767
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NZ_CP013278 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence 130740-130769 7 0.767
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NC_018509 Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence 124624-124653 7 0.767
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NZ_CP039724 Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence 2565-2594 7 0.767
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NZ_CP051859 Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence 1843-1872 7 0.767
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NZ_CP009347 Bacillus thuringiensis HD1002 plasmid 3, complete sequence 40599-40628 7 0.767
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NC_015417 Clostridium botulinum BKT015925 plasmid p1BKT015925, complete sequence 153049-153078 7 0.767
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NZ_CP045025 Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence 130740-130769 7 0.767
NZ_ALRU01000104_1 1.2|988|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 988-1017 30 NZ_CP045270 Bacillus megaterium strain FDU301 plasmid pFDU301H, complete sequence 8858-8887 8 0.733
NZ_ALRU01000104_1 1.2|988|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 988-1017 30 MK449000 Streptococcus phage Javan64, complete genome 15281-15310 8 0.733
NZ_ALRU01000104_1 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1186-1215 30 MG592660 Vibrio phage 1.293.O._10N.261.52.E1, partial genome 7362-7391 8 0.733
NZ_ALRU01000104_1 1.7|1318|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1318-1347 30 NZ_CP017461 Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence 54424-54453 8 0.733
NZ_ALRU01000104_1 1.7|1318|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1318-1347 30 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 115731-115760 8 0.733
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 NC_014260 Enterobacteria phage IME08, complete genome 88967-88996 8 0.733
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MN850621 Escherichia phage dhabil, complete genome 126317-126346 8 0.733
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MN850609 Escherichia phage dhaeg, complete genome 76845-76874 8 0.733
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 HM071924 Enterobacteria phage IME08, complete sequence 88967-88996 8 0.733
NZ_ALRU01000104_1 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1516-1545 30 MH051917 Enterobacteria phage vB_EcoM_IME341, complete genome 85432-85461 8 0.733
NZ_ALRU01000104_1 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1582-1611 30 NZ_MF925335 Edwardsiella tarda strain 150611-1 plasmid p150611 1B-1, complete sequence 2614-2643 8 0.733
NZ_ALRU01000104_1 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 1582-1611 30 NC_011668 Shewanella baltica OS223 plasmid pS22302, complete sequence 56767-56796 8 0.733
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NC_018878 Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence 27063-27092 8 0.733
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NC_048665 Clostridium phage phiCDHM14, complete genome 22262-22291 8 0.733
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 KU057941 Clostridium phage CDSH1, complete genome 28658-28687 8 0.733
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 MK473382 Clostridium phage JD032, complete genome 12174-12203 8 0.733
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 LN881738 Escherichia phage slur17, complete genome 33369-33398 8 0.733
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NC_028905 Clostridium phage phiCD111, complete genome 28432-28461 8 0.733
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 HG796225 Clostridium phage phiCDHM13 complete genome 21762-21791 8 0.733
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 LN681538 Clostridium phage phiCD481-1, complete genome 21502-21531 8 0.733
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 HG798901 Clostridium phage phiCDHM11 complete genome 21762-21791 8 0.733
NZ_ALRU01000104_1 1.2|988|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 988-1017 30 NZ_MG205641 Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence 30654-30683 9 0.7
NZ_ALRU01000104_1 1.2|988|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 988-1017 30 NZ_MG205643 Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence 23758-23787 9 0.7
NZ_ALRU01000104_1 1.2|988|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT 988-1017 30 NZ_MG205642 Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence 30654-30683 9 0.7
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NC_028838 Clostridium phage phiCD506, complete genome 22083-22112 9 0.7
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 HM568888 Clostridium phage phiCD38-2, complete genome 28154-28183 9 0.7
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NC_028958 Clostridium phage phiCD146, complete genome 27716-27745 9 0.7
NZ_ALRU01000104_1 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT 1780-1809 30 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 640927-640956 10 0.667

1. spacer 1.4|1120|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 0, identity: 1.0

tgaattccacgccaccaagtaaacctgtga	CRISPR spacer
tgaattccacgccaccaagtaaacctgtga	Protospacer
******************************

2. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 0, identity: 1.0

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaacagccttgatgacttaat	Protospacer
******************************

3. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448771 (Streptococcus phage Javan481, complete genome) position: , mismatch: 0, identity: 1.0

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaacagccttgatgacttaat	Protospacer
******************************

4. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 0, identity: 1.0

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaacagccttgatgacttaat	Protospacer
******************************

5. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448774 (Streptococcus phage Javan487, complete genome) position: , mismatch: 0, identity: 1.0

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaacagccttgatgacttaat	Protospacer
******************************

6. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 0, identity: 1.0

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaacagccttgatgacttaat	Protospacer
******************************

7. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448958 (Streptococcus phage Javan486, complete genome) position: , mismatch: 0, identity: 1.0

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaacagccttgatgacttaat	Protospacer
******************************

8. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 0, identity: 1.0

aagtgccacagtttgtggctgattggattg	CRISPR spacer
aagtgccacagtttgtggctgattggattg	Protospacer
******************************

9. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 0, identity: 1.0

aagtgccacagtttgtggctgattggattg	CRISPR spacer
aagtgccacagtttgtggctgattggattg	Protospacer
******************************

10. spacer 1.12|1648|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448711 (Streptococcus phage Javan235, complete genome) position: , mismatch: 0, identity: 1.0

tcagcgagatgctctaagtaagcatgttga	CRISPR spacer
tcagcgagatgctctaagtaagcatgttga	Protospacer
******************************

11. spacer 1.13|1714|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448711 (Streptococcus phage Javan235, complete genome) position: , mismatch: 0, identity: 1.0

tcagcgagatgctctaagtaagcatgttga	CRISPR spacer
tcagcgagatgctctaagtaagcatgttga	Protospacer
******************************

12. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to MK448790 (Streptococcus phage Javan515, complete genome) position: , mismatch: 0, identity: 1.0

tcttctttttaattcttctaacactccatc	CRISPR spacer
tcttctttttaattcttctaacactccatc	Protospacer
******************************

13. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to MK448957 (Streptococcus phage Javan484, complete genome) position: , mismatch: 0, identity: 1.0

tcttctttttaattcttctaacactccatc	CRISPR spacer
tcttctttttaattcttctaacactccatc	Protospacer
******************************

14. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448850 (Streptococcus phage Javan132, complete genome) position: , mismatch: 1, identity: 0.967

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaacagccttgatgatttaat	Protospacer
************************.*****

15. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 1, identity: 0.967

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaacagccttgatgatttaat	Protospacer
************************.*****

16. spacer 1.4|1120|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448845 (Streptococcus phage Javan118, complete genome) position: , mismatch: 2, identity: 0.933

tgaattccacgccaccaagtaaacctgtga	CRISPR spacer
tgaattccacaccaccaattaaacctgtga	Protospacer
**********.******* ***********

17. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448681 (Streptococcus phage Javan141, complete genome) position: , mismatch: 2, identity: 0.933

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaatagccttgacgacttaat	Protospacer
************.********.********

18. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 2, identity: 0.933

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaacagccttgacgacttgat	Protospacer
*********************.*****.**

19. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448672 (Streptococcus phage Javan117, complete genome) position: , mismatch: 2, identity: 0.933

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaacagccttgacgacttgat	Protospacer
*********************.*****.**

20. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448849 (Streptococcus phage Javan128, complete genome) position: , mismatch: 2, identity: 0.933

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaacagccttgacgacttgat	Protospacer
*********************.*****.**

21. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 2, identity: 0.933

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaacagtcttgatgatttaat	Protospacer
***************.********.*****

22. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448933 (Streptococcus phage Javan420, complete genome) position: , mismatch: 2, identity: 0.933

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
accagaaacaaacagccttgacgacttaat	Protospacer
** ******************.********

23. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448845 (Streptococcus phage Javan118, complete genome) position: , mismatch: 2, identity: 0.933

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaatagccttgacgacttaat	Protospacer
************.********.********

24. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 2, identity: 0.933

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
acaagaaacaaatagccttgacgacttaat	Protospacer
************.********.********

25. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448704 (Streptococcus phage Javan213, complete genome) position: , mismatch: 2, identity: 0.933

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatttgtggctgattggattg	Protospacer
 *********.*******************

26. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448734 (Streptococcus phage Javan347, complete genome) position: , mismatch: 2, identity: 0.933

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacagtttgtggcggattggattg	Protospacer
 ****************** **********

27. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448876 (Streptococcus phage Javan214, complete genome) position: , mismatch: 2, identity: 0.933

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatttgtggctgattggattg	Protospacer
 *********.*******************

28. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to HG424323 (Streptococcus phage 20617 complete prophage genome) position: , mismatch: 2, identity: 0.933

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaactct	Protospacer
.************** **************

29. spacer 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 2, identity: 0.933

ttctatcttctgaagatatttcacaagtga	CRISPR spacer
ttttatcttctgaggatatttcacaagtga	Protospacer
**.**********.****************

30. spacer 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 2, identity: 0.933

ttctatcttctgaagatatttcacaagtga	CRISPR spacer
ttttatcttctgaggatatttcacaagtga	Protospacer
**.**********.****************

31. spacer 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 2, identity: 0.933

ttctatcttctgaagatatttcacaagtga	CRISPR spacer
ttttatcttctgaggatatttcacaagtga	Protospacer
**.**********.****************

32. spacer 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 2, identity: 0.933

ttctatcttctgaagatatttcacaagtga	CRISPR spacer
ttttatcttctgaggatatttcacaagtga	Protospacer
**.**********.****************

33. spacer 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 2, identity: 0.933

ttctatcttctgaagatatttcacaagtga	CRISPR spacer
ttttatcttctgaggatatttcacaagtga	Protospacer
**.**********.****************

34. spacer 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 2, identity: 0.933

ttctatcttctgaagatatttcacaagtga	CRISPR spacer
ttttatcttctgaggatatttcacaagtga	Protospacer
**.**********.****************

35. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 3, identity: 0.9

aagtgccacagtttgtggctgattggattg	CRISPR spacer
aagtgccacagtttgttgctgattggtatg	Protospacer
**************** *********  **

36. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448822 (Streptococcus phage Javan629, complete genome) position: , mismatch: 3, identity: 0.9

aagtgccacagtttgtggctgattggattg	CRISPR spacer
aagtgccacagtttgttgctgattggtatg	Protospacer
**************** *********  **

37. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH892366 (Streptococcus phage SW18, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

38. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH937501 (Streptococcus phage CHPC1073, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

39. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH973662 (Streptococcus phage SW7, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

40. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH892373 (Streptococcus phage SW27, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

41. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705256 (Streptococcus phage P3681, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

42. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MF161328 (Streptococcus phage D4276, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccttcaacagtaaccct	Protospacer
.**************.***********.**

43. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KX879643 (Streptococcus phage CHPC1151, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

44. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH937458 (Streptococcus phage CHPC572, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

45. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH892363 (Streptococcus phage SW14, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

46. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705252 (Streptococcus phage P0092, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

47. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH937506 (Streptococcus phage CHPC1148, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaaccgtaactct	Protospacer
.************** ***** ********

48. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH937486 (Streptococcus phage CHPC1027, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

49. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH937471 (Streptococcus phage CHPC927, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

50. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705282 (Streptococcus phage P8921, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

51. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705253 (Streptococcus phage P0093, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

52. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705287 (Streptococcus phage P9854, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

53. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH892367 (Streptococcus phage SW19, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

54. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH892355 (Streptococcus phage SW4, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

55. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705263 (Streptococcus phage P7133, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

56. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH937467 (Streptococcus phage CHPC877, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

57. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705254 (Streptococcus phage P0094, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

58. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705264 (Streptococcus phage P7134, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

59. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705260 (Streptococcus phage P5651, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

60. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705284 (Streptococcus phage P9851, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

61. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH973663 (Streptococcus phage SW24, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

62. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705272 (Streptococcus phage P7601, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

63. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH937488 (Streptococcus phage CHPC1033, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

64. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705271 (Streptococcus phage P7574, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

65. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705265 (Streptococcus phage P7151, complete genome) position: , mismatch: 3, identity: 0.9

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tattcaaggactaccatcaacagtaaccct	Protospacer
.************** ***********.**

66. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 4, identity: 0.867

aagtgccacagtttgtggctgattggattg	CRISPR spacer
aagtgccacggtttgtggctgattggtacg	Protospacer
*********.****************  .*

67. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 4, identity: 0.867

aagtgccacagtttgtggctgattggattg	CRISPR spacer
aagtgccacggtttgtggctgattggtacg	Protospacer
*********.****************  .*

68. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 4, identity: 0.867

aagtgccacagtttgtggctgattggattg	CRISPR spacer
aagtgccacggtttgtggctgattggtacg	Protospacer
*********.****************  .*

69. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to HG424323 (Streptococcus phage 20617 complete prophage genome) position: , mismatch: 4, identity: 0.867

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagttccacaatttgtggctgattggattt	Protospacer
 *** *****.****************** 

70. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 4, identity: 0.867

aagtgccacagtttgtggctgattggattg	CRISPR spacer
aagtgccacggtttgtggctgattggtacg	Protospacer
*********.****************  .*

71. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 4, identity: 0.867

aagtgccacagtttgtggctgattggattg	CRISPR spacer
aagtgccacggtttgtggctgattggtacg	Protospacer
*********.****************  .*

72. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448755 (Streptococcus phage Javan423, complete genome) position: , mismatch: 4, identity: 0.867

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccgaagtttgtggctgattggatag	Protospacer
 ******. ******************* *

73. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448756 (Streptococcus phage Javan425, complete genome) position: , mismatch: 4, identity: 0.867

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccgaagtttgtggctgattggatag	Protospacer
 ******. ******************* *

74. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448707 (Streptococcus phage Javan227, complete genome) position: , mismatch: 4, identity: 0.867

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatttgtggctgattggtatg	Protospacer
 *********.***************  **

75. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448954 (Streptococcus phage Javan476, complete genome) position: , mismatch: 4, identity: 0.867

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgcctcagtttgtggctgattgggtag	Protospacer
 ****** ******************.* *

76. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK449012 (Streptococcus phage Javan94, complete genome) position: , mismatch: 4, identity: 0.867

aagtgccacagtttgtggctgattggattg	CRISPR spacer
aagttccacaatttgtggctgattggtatg	Protospacer
**** *****.***************  **

77. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448680 (Streptococcus phage Javan139, complete genome) position: , mismatch: 4, identity: 0.867

aagtgccacagtttgtggctgattggattg	CRISPR spacer
aagtcccgcagtttgtggctgattggctag	Protospacer
**** **.****************** * *

78. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NC_000872 (Streptococcus phage Sfi21, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

79. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
cagtgccaaagtttgtggcggattggtatg	Protospacer
 ******* ********** ******  **

80. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705273 (Streptococcus phage P7602, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

81. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH937473 (Streptococcus phage CHPC929, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

82. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH892360 (Streptococcus phage SW11, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

83. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH892353 (Streptococcus phage SW2, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtaccgcagtttgtggctgattggtatg	Protospacer
 ***.**.******************  **

84. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705277 (Streptococcus phage P7951, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

85. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NC_000871 (Streptococcus phage Sfi19, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

86. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH937464 (Streptococcus phage CHPC869, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

87. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH937480 (Streptococcus phage CHPC954, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

88. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448753 (Streptococcus phage Javan407, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacagtttgtggcggagtggtatg	Protospacer
 ****************** ** ***  **

89. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH937475 (Streptococcus phage CHPC931, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

90. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MF417967 (Uncultured Caudovirales phage clone 3S_16, partial genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
caatcccgcagtttgtggcggattggattg	Protospacer
 *.* **.*********** **********

91. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to AF158601 (Streptococcus thermophilus bacteriophage SFi18 lysin, gp111, gp183, gp47, gp54, gp71, gp145, gp69, gp40, gp229, gp157, gp233, putative helicase, gp151, gp271, putative primase, gp143, gp106, gp89, gp57, gp51, gp66, gp192, putative DNA binding protein, gp99, and gp235 genes, complete cds) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

92. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705268 (Streptococcus phage P7571, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

93. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705269 (Streptococcus phage P7572, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

94. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705281 (Streptococcus phage P7955, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

95. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to AF115103 (Streptococcus thermophilus bacteriophage Sfi21, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

96. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NC_013645 (Streptococcus phage Abc2, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
cagtgccgcagtttgtggcggattgggtag	Protospacer
 ******.*********** ******.* *

97. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to AF115102 (Streptococcus thermophilus bacteriophage Sfi19, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

98. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to FJ226752 (Streptococcus phage ALQ13.2, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

99. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NC_002214 (Streptococcus thermophilus bacteriophage Sfi11, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

100. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705272 (Streptococcus phage P7601, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

101. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY705271 (Streptococcus phage P7574, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

102. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH937505 (Streptococcus phage CHPC1109, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

103. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH937469 (Streptococcus phage CHPC919, complete genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

104. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH937491 (Streptococcus phage CHPC1037, partial genome) position: , mismatch: 5, identity: 0.833

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tagtgccacaatatgtggctgattggtatg	Protospacer
 *********.* *************  **

105. spacer 1.12|1648|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448750 (Streptococcus phage Javan393, complete genome) position: , mismatch: 5, identity: 0.833

tcagcgagatgctctaagtaagcatgttga	CRISPR spacer
ttctcgagatgcactaagtaaacatgttga	Protospacer
*.  ******** ********.********

106. spacer 1.13|1714|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448750 (Streptococcus phage Javan393, complete genome) position: , mismatch: 5, identity: 0.833

tcagcgagatgctctaagtaagcatgttga	CRISPR spacer
ttctcgagatgcactaagtaaacatgttga	Protospacer
*.  ******** ********.********

107. spacer 1.2|988|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045273 (Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence) position: , mismatch: 6, identity: 0.8

tgacagatgaaacaaaaaaagtctacctaa	CRISPR spacer
ttaaggaaaaaacataaaaagtctacctaa	Protospacer
* * .** .***** ***************

108. spacer 1.7|1318|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KY065466 (Streptococcus phage IPP25, complete genome) position: , mismatch: 6, identity: 0.8

caaccctatgtttgataatattttagacgt	CRISPR spacer
aaaagctatgcttaataatattttagacgg	Protospacer
 **  *****.**.*************** 

109. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448896 (Streptococcus phage Javan278, complete genome) position: , mismatch: 6, identity: 0.8

aagtgccacagtttgtggctgattggattg	CRISPR spacer
tcattccgcagtttgtggccgattggattg	Protospacer
  .* **.***********.**********

110. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448757 (Streptococcus phage Javan427, complete genome) position: , mismatch: 6, identity: 0.8

aagtgccacagtttgtggctgattggattg	CRISPR spacer
aagttaagaagtttgtggctgaatggattg	Protospacer
****   . ************* *******

111. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448890 (Streptococcus phage Javan264, complete genome) position: , mismatch: 6, identity: 0.8

cattcaaggactaccctcaacagtaactct	CRISPR spacer
tatcaacggtctaccctcaacagtaacact	Protospacer
.**. * ** ***************** **

112. spacer 1.12|1648|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KJ018211 (Shewanella sp. phage 1/40, complete genome) position: , mismatch: 6, identity: 0.8

tcagcga-gatgctctaagtaagcatgttga	CRISPR spacer
-cagtagtgatgctataagtaagcatgtaga	Protospacer
 ***... ****** ************* **

113. spacer 1.13|1714|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to KJ018211 (Shewanella sp. phage 1/40, complete genome) position: , mismatch: 6, identity: 0.8

tcagcga-gatgctctaagtaagcatgttga	CRISPR spacer
-cagtagtgatgctataagtaagcatgtaga	Protospacer
 ***... ****** ************* **

114. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NC_018685 (Bacillus thuringiensis MC28 plasmid pMC95, complete sequence) position: , mismatch: 6, identity: 0.8

tcttctttttaattcttctaacactccatc	CRISPR spacer
actattttttaattcttctaacattccttt	Protospacer
 ** .******************.*** *.

115. spacer 1.1|922|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to JX006077 (Saccharomonospora phage PIS 136, complete genome) position: , mismatch: 7, identity: 0.767

gatctcacgcatcttgttgtcacggaacat	CRISPR spacer
cagctcacgcaacttcttgtcacggatccg	Protospacer
 * ******** *** ********** *  

116. spacer 1.8|1384|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MN602266 (Bacteriophage DSS3_VP1, complete genome) position: , mismatch: 7, identity: 0.767

aagtgaagttgaattttatttgagatacta	CRISPR spacer
ctttcaagttgaatttcatttgagaaacaa	Protospacer
   * ***********.******** ** *

117. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006727 (Leptospira interrogans serovar Linhai str. 56609 plasmid lcp3, complete sequence) position: , mismatch: 7, identity: 0.767

aagtgccacagtttgtggctgattggattg	CRISPR spacer
aagtgccaaagattgtggctgatgcgaagc	Protospacer
******** ** ***********  **   

118. spacer 1.9|1450|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK448885 (Streptococcus phage Javan252, complete genome) position: , mismatch: 7, identity: 0.767

aagtgccacagtttgtggctgattggattg	CRISPR spacer
ctattccgaagtttgtggcggattggattg	Protospacer
  .* **. ********** **********

119. spacer 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MN399336 (Edwardsiella phage vB_EtaM_ET-ABTNL-9, complete genome) position: , mismatch: 7, identity: 0.767

ttctatcttctgaagatatttcacaagtga	CRISPR spacer
gtaagttttctgaagatagtacacaagtga	Protospacer
 *  .*.*********** * *********

120. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NZ_CP034168 (Enterococcus avium strain 352 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

tcttctttttaattcttctaacactccatc	CRISPR spacer
attggtttttaattcttctaatactgcatt	Protospacer
 .*  ****************.*** ***.

121. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NZ_CP053971 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

tcttctttttaattcttctaacactccatc	CRISPR spacer
tcttgtttttaactcttctaacaaagcgcc	Protospacer
**** *******.**********   *..*

122. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NZ_CP013278 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence) position: , mismatch: 7, identity: 0.767

tcttctttttaattcttctaacactccatc	CRISPR spacer
tcttgtttttaactcttctaacaaagcgcc	Protospacer
**** *******.**********   *..*

123. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NC_018509 (Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence) position: , mismatch: 7, identity: 0.767

tcttctttttaattcttctaacactccatc	CRISPR spacer
tcttgtttttaactcttctaacaaagcgcc	Protospacer
**** *******.**********   *..*

124. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NZ_CP039724 (Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

tcttctttttaattcttctaacactccatc	CRISPR spacer
tcttgtttttaactcttctaacaaagcgcc	Protospacer
**** *******.**********   *..*

125. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NZ_CP051859 (Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence) position: , mismatch: 7, identity: 0.767

tcttctttttaattcttctaacactccatc	CRISPR spacer
tcttgtttttaactcttctaacaaagcgcc	Protospacer
**** *******.**********   *..*

126. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NZ_CP009347 (Bacillus thuringiensis HD1002 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.767

tcttctttttaattcttctaacactccatc	CRISPR spacer
tcttgtttttaactcttctaacaaagcgcc	Protospacer
**** *******.**********   *..*

127. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NC_015417 (Clostridium botulinum BKT015925 plasmid p1BKT015925, complete sequence) position: , mismatch: 7, identity: 0.767

tcttctttttaattcttctaacactccatc	CRISPR spacer
ttccttttttaattcttctaatactcgttc	Protospacer
*....****************.****  **

128. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NZ_CP045025 (Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

tcttctttttaattcttctaacactccatc	CRISPR spacer
tcttgtttttaactcttctaacaaagcgcc	Protospacer
**** *******.**********   *..*

129. spacer 1.2|988|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045270 (Bacillus megaterium strain FDU301 plasmid pFDU301H, complete sequence) position: , mismatch: 8, identity: 0.733

tgacagatgaaacaaaaaaagtctacctaa	CRISPR spacer
ccattcatgaaacagaaaaagtctacctct	Protospacer
. *.  ********.*************  

130. spacer 1.2|988|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MK449000 (Streptococcus phage Javan64, complete genome) position: , mismatch: 8, identity: 0.733

tgacagatgaaacaaaaaaagtctacctaa---	CRISPR spacer
tgaaagatgaaacaaaaaaag---atgtgggtt	Protospacer
*** *****************   *. *..   

131. spacer 1.5|1186|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MG592660 (Vibrio phage 1.293.O._10N.261.52.E1, partial genome) position: , mismatch: 8, identity: 0.733

acaagaaacaaacagccttgatgacttaat	CRISPR spacer
aggccaaacaatcagcctagatgacttacg	Protospacer
* .  ****** ****** *********  

132. spacer 1.7|1318|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017461 (Staphylococcus nepalensis strain JS1 plasmid pSNJS101, complete sequence) position: , mismatch: 8, identity: 0.733

caaccctatgtttgataatattttagacgt	CRISPR spacer
cgtacctatgtttgatgatattttagtacc	Protospacer
*.  ************.*********   .

133. spacer 1.7|1318|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 8, identity: 0.733

caaccctatgtttgataatattttagacgt	CRISPR spacer
ataccctatgttcgataatatttcactcag	Protospacer
  **********.**********.*  *. 

134. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NC_014260 (Enterobacteria phage IME08, complete genome) position: , mismatch: 8, identity: 0.733

cattcaaggactaccctcaacagtaactct	CRISPR spacer
gattcaagaactaccctaaacagtgaaggg	Protospacer
 *******.******** ******.*    

135. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MN850621 (Escherichia phage dhabil, complete genome) position: , mismatch: 8, identity: 0.733

cattcaaggactaccctcaacagtaactct	CRISPR spacer
gattcaagaactaccctaaacagtgaaggg	Protospacer
 *******.******** ******.*    

136. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MN850609 (Escherichia phage dhaeg, complete genome) position: , mismatch: 8, identity: 0.733

cattcaaggactaccctcaacagtaactct	CRISPR spacer
gattcaagaactaccctaaacagtgaaggg	Protospacer
 *******.******** ******.*    

137. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to HM071924 (Enterobacteria phage IME08, complete sequence) position: , mismatch: 8, identity: 0.733

cattcaaggactaccctcaacagtaactct	CRISPR spacer
gattcaagaactaccctaaacagtgaaggg	Protospacer
 *******.******** ******.*    

138. spacer 1.10|1516|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to MH051917 (Enterobacteria phage vB_EcoM_IME341, complete genome) position: , mismatch: 8, identity: 0.733

cattcaaggactaccctcaacagtaactct	CRISPR spacer
gattcaagaactaccctaaacagtgaaggg	Protospacer
 *******.******** ******.*    

139. spacer 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF925335 (Edwardsiella tarda strain 150611-1 plasmid p150611 1B-1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctatcttctgaagatatttcacaagtga	CRISPR spacer
gactttcatctgaagatatttcacaaaatg	Protospacer
  ** ** ******************.  .

140. spacer 1.11|1582|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NC_011668 (Shewanella baltica OS223 plasmid pS22302, complete sequence) position: , mismatch: 8, identity: 0.733

ttctatcttctgaagatatttcacaagtga	CRISPR spacer
attcgacttctgaagatattgcacaagcca	Protospacer
 *... ************** ******. *

141. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NC_018878 (Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence) position: , mismatch: 8, identity: 0.733

tcttctttttaattcttctaacactccatc	CRISPR spacer
ctgtagtttaaattcatctaacactccatt	Protospacer
.. *  *** ***** *************.

142. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NC_048665 (Clostridium phage phiCDHM14, complete genome) position: , mismatch: 8, identity: 0.733

tcttctttttaattcttctaacactccatc	CRISPR spacer
ttttcttttcaattcttctaacatattagt	Protospacer
*.*******.*************. ..* .

143. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to KU057941 (Clostridium phage CDSH1, complete genome) position: , mismatch: 8, identity: 0.733

tcttctttttaattcttctaacactccatc	CRISPR spacer
ttttcttttcaattcttctaacatattagt	Protospacer
*.*******.*************. ..* .

144. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to MK473382 (Clostridium phage JD032, complete genome) position: , mismatch: 8, identity: 0.733

tcttctttttaattcttctaacactccatc	CRISPR spacer
ttttcttttcaattcttctaacatattagt	Protospacer
*.*******.*************. ..* .

145. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to LN881738 (Escherichia phage slur17, complete genome) position: , mismatch: 8, identity: 0.733

tcttctttttaattcttctaacactccatc	CRISPR spacer
ttttcttttcaattcttctaacatattagt	Protospacer
*.*******.*************. ..* .

146. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NC_028905 (Clostridium phage phiCD111, complete genome) position: , mismatch: 8, identity: 0.733

tcttctttttaattcttctaacactccatc	CRISPR spacer
ttttcttttcaattcttctaacatattagt	Protospacer
*.*******.*************. ..* .

147. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to HG796225 (Clostridium phage phiCDHM13 complete genome) position: , mismatch: 8, identity: 0.733

tcttctttttaattcttctaacactccatc	CRISPR spacer
ttttcttttcaattcttctaacatattagt	Protospacer
*.*******.*************. ..* .

148. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to LN681538 (Clostridium phage phiCD481-1, complete genome) position: , mismatch: 8, identity: 0.733

tcttctttttaattcttctaacactccatc	CRISPR spacer
ttttcttttcaattcttctaacatattagt	Protospacer
*.*******.*************. ..* .

149. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to HG798901 (Clostridium phage phiCDHM11 complete genome) position: , mismatch: 8, identity: 0.733

tcttctttttaattcttctaacactccatc	CRISPR spacer
ttttcttttcaattcttctaacatattagt	Protospacer
*.*******.*************. ..* .

150. spacer 1.2|988|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG205641 (Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence) position: , mismatch: 9, identity: 0.7

tgacagatgaaacaaaaaaagtctacctaa	CRISPR spacer
cttcagatgaaacagaaaaagtatacagtt	Protospacer
.  ***********.******* ***    

151. spacer 1.2|988|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 9, identity: 0.7

tgacagatgaaacaaaaaaagtctacctaa	CRISPR spacer
cttcagatgaaacagaaaaagtatacagtt	Protospacer
.  ***********.******* ***    

152. spacer 1.2|988|30|NZ_ALRU01000104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG205642 (Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence) position: , mismatch: 9, identity: 0.7

tgacagatgaaacaaaaaaagtctacctaa	CRISPR spacer
cttcagatgaaacagaaaaagtatacagtt	Protospacer
.  ***********.******* ***    

153. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NC_028838 (Clostridium phage phiCD506, complete genome) position: , mismatch: 9, identity: 0.7

tcttctttttaattcttctaacactccatc	CRISPR spacer
ctttcttttcaattcttctaacatattagt	Protospacer
..*******.*************. ..* .

154. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to HM568888 (Clostridium phage phiCD38-2, complete genome) position: , mismatch: 9, identity: 0.7

tcttctttttaattcttctaacactccatc	CRISPR spacer
ctttcttttcaattcttctaacatattagt	Protospacer
..*******.*************. ..* .

155. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NC_028958 (Clostridium phage phiCD146, complete genome) position: , mismatch: 9, identity: 0.7

tcttctttttaattcttctaacactccatc	CRISPR spacer
ctttcttttcaattcttctaacatattagt	Protospacer
..*******.*************. ..* .

156. spacer 1.14|1780|30|NZ_ALRU01000104|CRISPRCasFinder,CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 10, identity: 0.667

tcttctttttaattcttctaacactccatc	CRISPR spacer
aagaatttttaattcttctaagactctcat	Protospacer
     **************** ****.  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALRU01000133
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 20079 : 27283 8 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_2 35603 : 43259 9 Streptococcus_phage(66.67%) integrase attL 29294:29307|attR 45216:45229
DBSCAN-SWA_3 46356 : 53217 9 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ALRU01000086
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1626 : 8360 9 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage