| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_ALRT01000013 | Streptococcus agalactiae STIR-CD-28 ctg120003208957, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000033 | Streptococcus agalactiae STIR-CD-28 ctg120003208977, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000017 | Streptococcus agalactiae STIR-CD-28 ctg120003208961, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000019 | Streptococcus agalactiae STIR-CD-28 ctg120003208963, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000023 | Streptococcus agalactiae STIR-CD-28 ctg120003208967, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000012 | Streptococcus agalactiae STIR-CD-28 ctg120003208956, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000004 | Streptococcus agalactiae STIR-CD-28 ctg120003208948, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000002 | Streptococcus agalactiae STIR-CD-28 ctg120003208946, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRT01000027 | Streptococcus agalactiae STIR-CD-28 ctg120003208971, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 1 | |
| NZ_ALRT01000011 | Streptococcus agalactiae STIR-CD-28 ctg120003208955, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000038 | Streptococcus agalactiae STIR-CD-28 ctg120003208982, whole genome shotgun sequence | 1 crisprs | 1 | 2 | 0 | 0 | |
| NZ_ALRT01000016 | Streptococcus agalactiae STIR-CD-28 ctg120003208960, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000007 | Streptococcus agalactiae STIR-CD-28 ctg120003208951, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000015 | Streptococcus agalactiae STIR-CD-28 ctg120003208959, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000024 | Streptococcus agalactiae STIR-CD-28 ctg120003208968, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000008 | Streptococcus agalactiae STIR-CD-28 ctg120003208952, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000006 | Streptococcus agalactiae STIR-CD-28 ctg120003208950, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000005 | Streptococcus agalactiae STIR-CD-28 ctg120003208949, whole genome shotgun sequence | 1 crisprs | 0 | 1 | 2 | 0 | |
| NZ_ALRT01000040 | Streptococcus agalactiae STIR-CD-28 ctg120003208984, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRT01000025 | Streptococcus agalactiae STIR-CD-28 ctg120003208969, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000030 | Streptococcus agalactiae STIR-CD-28 ctg120003208974, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000032 | Streptococcus agalactiae STIR-CD-28 ctg120003208976, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000041 | Streptococcus agalactiae STIR-CD-28 ctg120003208985, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000003 | Streptococcus agalactiae STIR-CD-28 ctg120003208947, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000035 | Streptococcus agalactiae STIR-CD-28 ctg120003208979, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRT01000022 | Streptococcus agalactiae STIR-CD-28 ctg120003208966, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000036 | Streptococcus agalactiae STIR-CD-28 ctg120003208980, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRT01000026 | Streptococcus agalactiae STIR-CD-28 ctg120003208970, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000021 | Streptococcus agalactiae STIR-CD-28 ctg120003208965, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000028 | Streptococcus agalactiae STIR-CD-28 ctg120003208972, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000034 | Streptococcus agalactiae STIR-CD-28 ctg120003208978, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000010 | Streptococcus agalactiae STIR-CD-28 ctg120003208954, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000020 | Streptococcus agalactiae STIR-CD-28 ctg120003208964, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000001 | Streptococcus agalactiae STIR-CD-28 ctg120003208576, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000029 | Streptococcus agalactiae STIR-CD-28 ctg120003208973, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000009 | Streptococcus agalactiae STIR-CD-28 ctg120003208953, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000014 | Streptococcus agalactiae STIR-CD-28 ctg120003208958, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRT01000039 | Streptococcus agalactiae STIR-CD-28 ctg120003208983, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRT01000018 | Streptococcus agalactiae STIR-CD-28 ctg120003208962, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000037 | Streptococcus agalactiae STIR-CD-28 ctg120003208981, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRT01000031 | Streptococcus agalactiae STIR-CD-28 ctg120003208975, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_ALRT01000005_1 | 99869-99907 | 39 | DQ535032 | Lactococcus lactis phage KSY1, complete genome | 76516-76554 | 11 | 0.718 | |
| NZ_ALRT01000005_1 | 99869-99907 | 39 | NC_009817 | Lactococcus phage KSY1, complete genome | 76516-76554 | 11 | 0.718 |
gttaaagcagaccaagatgctaaagttaagttggctaag CRISPR spacer gaacaagcagaacaagatgctaaagttgagttattgtat Protospacer * ******* ***************.****. . *
gttaaagcagaccaagatgctaaagttaagttggctaag CRISPR spacer gaacaagcagaacaagatgctaaagttgagttattgtat Protospacer * ******* ***************.****. . *
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 40062 : 47266 | 8 | Streptococcus_phage(16.67%) | NA | ||
| DBSCAN-SWA_2 | 55568 : 71184 | 22 | Streptococcus_phage(61.54%) | attL 58147:58166|attR 72022:72041 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 15504 : 25777 | 9 | Streptococcus_phage(57.14%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 33 : 35015 | 35 | Streptococcus_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 44535 : 53523 | 8 | Bacillus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 508 : 8998 | 12 | Streptococcus_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_ALRT01000038_1 | 44454-44755 | TypeII |
II-A
|
4 spacers
|
csn2,cas2,cas1,cas9 |
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_ALRT01000038_1 | 44623-44651 | 29 | NZ_ALRT01000037.1 | 24910-24938 | 0 | 1.0 |
ttgatagatttcttacaaaatgaacgcat CRISPR spacer ttgatagatttcttacaaaatgaacgcat Protospacer *****************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_ALRT01000038_1 | 44623-44651 | 29 | MK308676 | Vibrio phage vB_VmeM-Yong MS31, complete genome | 172843-172871 | 7 | 0.759 | |
| NZ_ALRT01000038_1 | 44623-44651 | 29 | MK308675 | Vibrio phage vB_VmeM-Yong XC32, complete genome | 172842-172870 | 7 | 0.759 | |
| NZ_ALRT01000038_1 | 44623-44651 | 29 | MK308677 | Vibrio phage vB_VmeM-Yong MS32, complete genome | 172843-172871 | 7 | 0.759 | |
| NZ_ALRT01000038_1 | 44623-44651 | 29 | MK308674 | Vibrio phage vB_VmeM-Yong XC31, complete genome | 172842-172870 | 7 | 0.759 | |
| NZ_ALRT01000038_1 | 44623-44651 | 29 | NZ_CP053657 | Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence | 429648-429676 | 7 | 0.759 | |
| NZ_ALRT01000038_1 | 44623-44651 | 29 | MN855763 | Myoviridae sp. isolate 210, complete genome | 13489-13517 | 7 | 0.759 | |
| NZ_ALRT01000038_1 | 44557-44585 | 29 | NZ_CP017657 | Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence | 56273-56301 | 8 | 0.724 | |
| NZ_ALRT01000038_1 | 44557-44585 | 29 | NZ_CP017649 | Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence | 58336-58364 | 8 | 0.724 | |
| NZ_ALRT01000038_1 | 44557-44585 | 29 | NZ_CP050915 | Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence | 22391-22419 | 8 | 0.724 | |
| NZ_ALRT01000038_1 | 44557-44585 | 29 | NZ_CP020580 | Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence | 55464-55492 | 8 | 0.724 | |
| NZ_ALRT01000038_1 | 44557-44585 | 29 | NZ_CP020582 | Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence | 16314-16342 | 8 | 0.724 |
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer ttgatagatttcttgcaaaatacgtactt Protospacer **************.******. ...* *
ttgatagatttcttacaaaatgaacgcat CRISPR spacer attttgtttttctttcaaaatgaacgcat Protospacer * *. ****** **************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 146404 : 154486 | 8 | Staphylococcus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 42896 : 54961 | 8 | Gordonia_phage(14.29%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 108 aa aa | AcrIIA21 | NA | NA | No | NA |