Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALRT01000013 Streptococcus agalactiae STIR-CD-28 ctg120003208957, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000033 Streptococcus agalactiae STIR-CD-28 ctg120003208977, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000017 Streptococcus agalactiae STIR-CD-28 ctg120003208961, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_ALRT01000019 Streptococcus agalactiae STIR-CD-28 ctg120003208963, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000023 Streptococcus agalactiae STIR-CD-28 ctg120003208967, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000012 Streptococcus agalactiae STIR-CD-28 ctg120003208956, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000004 Streptococcus agalactiae STIR-CD-28 ctg120003208948, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000002 Streptococcus agalactiae STIR-CD-28 ctg120003208946, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRT01000027 Streptococcus agalactiae STIR-CD-28 ctg120003208971, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALRT01000011 Streptococcus agalactiae STIR-CD-28 ctg120003208955, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000038 Streptococcus agalactiae STIR-CD-28 ctg120003208982, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 1 2 0 0
NZ_ALRT01000016 Streptococcus agalactiae STIR-CD-28 ctg120003208960, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000007 Streptococcus agalactiae STIR-CD-28 ctg120003208951, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000015 Streptococcus agalactiae STIR-CD-28 ctg120003208959, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000024 Streptococcus agalactiae STIR-CD-28 ctg120003208968, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000008 Streptococcus agalactiae STIR-CD-28 ctg120003208952, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000006 Streptococcus agalactiae STIR-CD-28 ctg120003208950, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000005 Streptococcus agalactiae STIR-CD-28 ctg120003208949, whole genome shotgun sequence 1 crisprs cas3 0 1 2 0
NZ_ALRT01000040 Streptococcus agalactiae STIR-CD-28 ctg120003208984, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRT01000025 Streptococcus agalactiae STIR-CD-28 ctg120003208969, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000030 Streptococcus agalactiae STIR-CD-28 ctg120003208974, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000032 Streptococcus agalactiae STIR-CD-28 ctg120003208976, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000041 Streptococcus agalactiae STIR-CD-28 ctg120003208985, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000003 Streptococcus agalactiae STIR-CD-28 ctg120003208947, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000035 Streptococcus agalactiae STIR-CD-28 ctg120003208979, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRT01000022 Streptococcus agalactiae STIR-CD-28 ctg120003208966, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALRT01000036 Streptococcus agalactiae STIR-CD-28 ctg120003208980, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRT01000026 Streptococcus agalactiae STIR-CD-28 ctg120003208970, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000021 Streptococcus agalactiae STIR-CD-28 ctg120003208965, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000028 Streptococcus agalactiae STIR-CD-28 ctg120003208972, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000034 Streptococcus agalactiae STIR-CD-28 ctg120003208978, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRT01000010 Streptococcus agalactiae STIR-CD-28 ctg120003208954, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000020 Streptococcus agalactiae STIR-CD-28 ctg120003208964, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_ALRT01000001 Streptococcus agalactiae STIR-CD-28 ctg120003208576, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000029 Streptococcus agalactiae STIR-CD-28 ctg120003208973, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000009 Streptococcus agalactiae STIR-CD-28 ctg120003208953, whole genome shotgun sequence 0 crisprs csm6 0 0 0 0
NZ_ALRT01000014 Streptococcus agalactiae STIR-CD-28 ctg120003208958, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRT01000039 Streptococcus agalactiae STIR-CD-28 ctg120003208983, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRT01000018 Streptococcus agalactiae STIR-CD-28 ctg120003208962, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRT01000037 Streptococcus agalactiae STIR-CD-28 ctg120003208981, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRT01000031 Streptococcus agalactiae STIR-CD-28 ctg120003208975, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ALRT01000005
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRT01000005_1 99845-99931 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRT01000005_1 1.1|99869|39|NZ_ALRT01000005|CRISPRCasFinder 99869-99907 39 DQ535032 Lactococcus lactis phage KSY1, complete genome 76516-76554 11 0.718
NZ_ALRT01000005_1 1.1|99869|39|NZ_ALRT01000005|CRISPRCasFinder 99869-99907 39 NC_009817 Lactococcus phage KSY1, complete genome 76516-76554 11 0.718

1. spacer 1.1|99869|39|NZ_ALRT01000005|CRISPRCasFinder matches to DQ535032 (Lactococcus lactis phage KSY1, complete genome) position: , mismatch: 11, identity: 0.718

gttaaagcagaccaagatgctaaagttaagttggctaag	CRISPR spacer
gaacaagcagaacaagatgctaaagttgagttattgtat	Protospacer
*   ******* ***************.****. .  * 

2. spacer 1.1|99869|39|NZ_ALRT01000005|CRISPRCasFinder matches to NC_009817 (Lactococcus phage KSY1, complete genome) position: , mismatch: 11, identity: 0.718

gttaaagcagaccaagatgctaaagttaagttggctaag	CRISPR spacer
gaacaagcagaacaagatgctaaagttgagttattgtat	Protospacer
*   ******* ***************.****. .  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 40062 : 47266 8 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_2 55568 : 71184 22 Streptococcus_phage(61.54%) integrase attL 58147:58166|attR 72022:72041
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALRT01000017
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRT01000017_1 1110-1312 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALRT01000035
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15504 : 25777 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ALRT01000036
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 33 : 35015 35 Streptococcus_phage(100.0%) head,protease,holin,capsid,tail,portal,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALRT01000040
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 44535 : 53523 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALRT01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 508 : 8998 12 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALRT01000037
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ALRT01000038
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRT01000038_1 44454-44755 TypeII II-A
4 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ALRT01000038_1 1.3|44623|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder 44623-44651 29 NZ_ALRT01000037.1 24910-24938 0 1.0

1. spacer 1.3|44623|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder matches to position: 24910-24938, mismatch: 0, identity: 1.0

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
ttgatagatttcttacaaaatgaacgcat	Protospacer
*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRT01000038_1 1.3|44623|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder 44623-44651 29 MK308676 Vibrio phage vB_VmeM-Yong MS31, complete genome 172843-172871 7 0.759
NZ_ALRT01000038_1 1.3|44623|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder 44623-44651 29 MK308675 Vibrio phage vB_VmeM-Yong XC32, complete genome 172842-172870 7 0.759
NZ_ALRT01000038_1 1.3|44623|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder 44623-44651 29 MK308677 Vibrio phage vB_VmeM-Yong MS32, complete genome 172843-172871 7 0.759
NZ_ALRT01000038_1 1.3|44623|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder 44623-44651 29 MK308674 Vibrio phage vB_VmeM-Yong XC31, complete genome 172842-172870 7 0.759
NZ_ALRT01000038_1 1.3|44623|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder 44623-44651 29 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 429648-429676 7 0.759
NZ_ALRT01000038_1 1.3|44623|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder 44623-44651 29 MN855763 Myoviridae sp. isolate 210, complete genome 13489-13517 7 0.759
NZ_ALRT01000038_1 1.2|44557|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder 44557-44585 29 NZ_CP017657 Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence 56273-56301 8 0.724
NZ_ALRT01000038_1 1.2|44557|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder 44557-44585 29 NZ_CP017649 Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence 58336-58364 8 0.724
NZ_ALRT01000038_1 1.2|44557|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder 44557-44585 29 NZ_CP050915 Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence 22391-22419 8 0.724
NZ_ALRT01000038_1 1.2|44557|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder 44557-44585 29 NZ_CP020580 Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence 55464-55492 8 0.724
NZ_ALRT01000038_1 1.2|44557|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder 44557-44585 29 NZ_CP020582 Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence 16314-16342 8 0.724

1. spacer 1.3|44623|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder matches to MK308676 (Vibrio phage vB_VmeM-Yong MS31, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

2. spacer 1.3|44623|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder matches to MK308675 (Vibrio phage vB_VmeM-Yong XC32, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

3. spacer 1.3|44623|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder matches to MK308677 (Vibrio phage vB_VmeM-Yong MS32, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

4. spacer 1.3|44623|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder matches to MK308674 (Vibrio phage vB_VmeM-Yong XC31, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

5. spacer 1.3|44623|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
ttgatagatttcttgcaaaatacgtactt	Protospacer
**************.******. ...* *

6. spacer 1.3|44623|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder matches to MN855763 (Myoviridae sp. isolate 210, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
attttgtttttctttcaaaatgaacgcat	Protospacer
 *  *.  ****** **************

7. spacer 1.2|44557|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017657 (Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

8. spacer 1.2|44557|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017649 (Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

9. spacer 1.2|44557|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050915 (Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

10. spacer 1.2|44557|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020580 (Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

11. spacer 1.2|44557|29|NZ_ALRT01000038|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020582 (Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ALRT01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 146404 : 154486 8 Staphylococcus_phage(50.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_ALRT01000039
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 42896 : 54961 8 Gordonia_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_ALRT01000027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALRT01000027.1|WP_000384271.1|15642_15969_-|hypothetical-protein 15642_15969_- 108 aa aa AcrIIA21 NA NA No NA