Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALRS01000006 Streptococcus agalactiae STIR-CD-27 ctg120003502101, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000042 Streptococcus agalactiae STIR-CD-27 ctg120003502137, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRS01000007 Streptococcus agalactiae STIR-CD-27 ctg120003502102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000039 Streptococcus agalactiae STIR-CD-27 ctg120003502134, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 0
NZ_ALRS01000015 Streptococcus agalactiae STIR-CD-27 ctg120003502110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000016 Streptococcus agalactiae STIR-CD-27 ctg120003502111, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_ALRS01000003 Streptococcus agalactiae STIR-CD-27 ctg120003502098, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000023 Streptococcus agalactiae STIR-CD-27 ctg120003502118, whole genome shotgun sequence 0 crisprs csm6 0 0 0 0
NZ_ALRS01000011 Streptococcus agalactiae STIR-CD-27 ctg120003502106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000024 Streptococcus agalactiae STIR-CD-27 ctg120003502119, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000044 Streptococcus agalactiae STIR-CD-27 ctg120003502139, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRS01000032 Streptococcus agalactiae STIR-CD-27 ctg120003502127, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRS01000014 Streptococcus agalactiae STIR-CD-27 ctg120003502109, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRS01000021 Streptococcus agalactiae STIR-CD-27 ctg120003502116, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRS01000033 Streptococcus agalactiae STIR-CD-27 ctg120003502128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000026 Streptococcus agalactiae STIR-CD-27 ctg120003502121, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000019 Streptococcus agalactiae STIR-CD-27 ctg120003502114, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000034 Streptococcus agalactiae STIR-CD-27 ctg120003502129, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000035 Streptococcus agalactiae STIR-CD-27 ctg120003502130, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000005 Streptococcus agalactiae STIR-CD-27 ctg120003502100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000037 Streptococcus agalactiae STIR-CD-27 ctg120003502132, whole genome shotgun sequence 1 crisprs cas9,cas1,cas2,csn2 1 2 0 0
NZ_ALRS01000002 Streptococcus agalactiae STIR-CD-27 ctg120003502097, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000031 Streptococcus agalactiae STIR-CD-27 ctg120003502126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000030 Streptococcus agalactiae STIR-CD-27 ctg120003502125, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_ALRS01000012 Streptococcus agalactiae STIR-CD-27 ctg120003502107, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000008 Streptococcus agalactiae STIR-CD-27 ctg120003502103, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000001 Streptococcus agalactiae STIR-CD-27 ctg120003502096, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000025 Streptococcus agalactiae STIR-CD-27 ctg120003502120, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000013 Streptococcus agalactiae STIR-CD-27 ctg120003502108, whole genome shotgun sequence 1 crisprs cas3 0 1 2 0
NZ_ALRS01000029 Streptococcus agalactiae STIR-CD-27 ctg120003502124, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000017 Streptococcus agalactiae STIR-CD-27 ctg120003502112, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALRS01000018 Streptococcus agalactiae STIR-CD-27 ctg120003502113, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000010 Streptococcus agalactiae STIR-CD-27 ctg120003502105, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000009 Streptococcus agalactiae STIR-CD-27 ctg120003502104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000004 Streptococcus agalactiae STIR-CD-27 ctg120003502099, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000041 Streptococcus agalactiae STIR-CD-27 ctg120003502136, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALRS01000020 Streptococcus agalactiae STIR-CD-27 ctg120003502115, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000043 Streptococcus agalactiae STIR-CD-27 ctg120003502138, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000036 Streptococcus agalactiae STIR-CD-27 ctg120003502131, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000027 Streptococcus agalactiae STIR-CD-27 ctg120003502122, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000040 Streptococcus agalactiae STIR-CD-27 ctg120003502135, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000038 Streptococcus agalactiae STIR-CD-27 ctg120003502133, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRS01000028 Streptococcus agalactiae STIR-CD-27 ctg120003502123, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRS01000022 Streptococcus agalactiae STIR-CD-27 ctg120003502117, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ALRS01000041
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALRS01000041.1|WP_000384271.1|63060_63387_+|hypothetical-protein 63060_63387_+ 108 aa aa AcrIIA21 NA NA No NA
2. NZ_ALRS01000042
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALRS01000013
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRS01000013_1 100162-100248 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRS01000013_1 1.1|100186|39|NZ_ALRS01000013|CRISPRCasFinder 100186-100224 39 DQ535032 Lactococcus lactis phage KSY1, complete genome 76516-76554 11 0.718
NZ_ALRS01000013_1 1.1|100186|39|NZ_ALRS01000013|CRISPRCasFinder 100186-100224 39 NC_009817 Lactococcus phage KSY1, complete genome 76516-76554 11 0.718

1. spacer 1.1|100186|39|NZ_ALRS01000013|CRISPRCasFinder matches to DQ535032 (Lactococcus lactis phage KSY1, complete genome) position: , mismatch: 11, identity: 0.718

gttaaagcagaccaagatgctaaagttaagttggctaag	CRISPR spacer
gaacaagcagaacaagatgctaaagttgagttattgtat	Protospacer
*   ******* ***************.****. .  * 

2. spacer 1.1|100186|39|NZ_ALRS01000013|CRISPRCasFinder matches to NC_009817 (Lactococcus phage KSY1, complete genome) position: , mismatch: 11, identity: 0.718

gttaaagcagaccaagatgctaaagttaagttggctaag	CRISPR spacer
gaacaagcagaacaagatgctaaagttgagttattgtat	Protospacer
*   ******* ***************.****. .  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 40379 : 47583 8 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_2 55885 : 71501 22 Streptococcus_phage(61.54%) integrase attL 58464:58483|attR 72339:72358
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ALRS01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3510 : 11592 8 Staphylococcus_phage(50.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALRS01000039
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 85592 : 95865 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALRS01000038
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8047 : 20112 8 Microbacterium_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALRS01000032
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5548 : 43892 38 Streptococcus_phage(100.0%) protease,portal,tail,terminase,head,capsid,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ALRS01000037
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRS01000037_1 16668-16969 TypeII II-A
4 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ALRS01000037_1 1.2|16772|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT 16772-16800 29 NZ_ALRS01000042.1 24427-24455 0 1.0

1. spacer 1.2|16772|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT matches to position: 24427-24455, mismatch: 0, identity: 1.0

atgcgttcattttgtaagaaatctatcaa	CRISPR spacer
atgcgttcattttgtaagaaatctatcaa	Protospacer
*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRS01000037_1 1.2|16772|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT 16772-16800 29 MK308676 Vibrio phage vB_VmeM-Yong MS31, complete genome 172843-172871 7 0.759
NZ_ALRS01000037_1 1.2|16772|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT 16772-16800 29 MK308675 Vibrio phage vB_VmeM-Yong XC32, complete genome 172842-172870 7 0.759
NZ_ALRS01000037_1 1.2|16772|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT 16772-16800 29 MK308677 Vibrio phage vB_VmeM-Yong MS32, complete genome 172843-172871 7 0.759
NZ_ALRS01000037_1 1.2|16772|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT 16772-16800 29 MK308674 Vibrio phage vB_VmeM-Yong XC31, complete genome 172842-172870 7 0.759
NZ_ALRS01000037_1 1.2|16772|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT 16772-16800 29 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 429648-429676 7 0.759
NZ_ALRS01000037_1 1.2|16772|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT 16772-16800 29 MN855763 Myoviridae sp. isolate 210, complete genome 13489-13517 7 0.759
NZ_ALRS01000037_1 1.3|16838|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT 16838-16866 29 NZ_CP017657 Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence 56273-56301 8 0.724
NZ_ALRS01000037_1 1.3|16838|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT 16838-16866 29 NZ_CP017649 Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence 58336-58364 8 0.724
NZ_ALRS01000037_1 1.3|16838|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT 16838-16866 29 NZ_CP050915 Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence 22391-22419 8 0.724
NZ_ALRS01000037_1 1.3|16838|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT 16838-16866 29 NZ_CP020580 Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence 55464-55492 8 0.724
NZ_ALRS01000037_1 1.3|16838|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT 16838-16866 29 NZ_CP020582 Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence 16314-16342 8 0.724

1. spacer 1.2|16772|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT matches to MK308676 (Vibrio phage vB_VmeM-Yong MS31, complete genome) position: , mismatch: 7, identity: 0.759

atgcgttcattttgtaagaaatctatcaa	CRISPR spacer
atgcgttcattttctaagaaatttggacg	Protospacer
************* ********.*.   .

2. spacer 1.2|16772|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT matches to MK308675 (Vibrio phage vB_VmeM-Yong XC32, complete genome) position: , mismatch: 7, identity: 0.759

atgcgttcattttgtaagaaatctatcaa	CRISPR spacer
atgcgttcattttctaagaaatttggacg	Protospacer
************* ********.*.   .

3. spacer 1.2|16772|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT matches to MK308677 (Vibrio phage vB_VmeM-Yong MS32, complete genome) position: , mismatch: 7, identity: 0.759

atgcgttcattttgtaagaaatctatcaa	CRISPR spacer
atgcgttcattttctaagaaatttggacg	Protospacer
************* ********.*.   .

4. spacer 1.2|16772|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT matches to MK308674 (Vibrio phage vB_VmeM-Yong XC31, complete genome) position: , mismatch: 7, identity: 0.759

atgcgttcattttgtaagaaatctatcaa	CRISPR spacer
atgcgttcattttctaagaaatttggacg	Protospacer
************* ********.*.   .

5. spacer 1.2|16772|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 7, identity: 0.759

atgcgttcattttgtaagaaatctatcaa	CRISPR spacer
aagtacgtattttgcaagaaatctatcaa	Protospacer
* *... .******.**************

6. spacer 1.2|16772|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT matches to MN855763 (Myoviridae sp. isolate 210, complete genome) position: , mismatch: 7, identity: 0.759

atgcgttcattttgtaagaaatctatcaa	CRISPR spacer
atgcgttcattttgaaagaaaaacaaaat	Protospacer
************** ******  .*  * 

7. spacer 1.3|16838|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017657 (Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

tgttgtagaatcatatcgaccatataacc	CRISPR spacer
ggttgtagaatcaaatcgaccaagcattt	Protospacer
 ************ ******** ..* ..

8. spacer 1.3|16838|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017649 (Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

tgttgtagaatcatatcgaccatataacc	CRISPR spacer
ggttgtagaatcaaatcgaccaagcattt	Protospacer
 ************ ******** ..* ..

9. spacer 1.3|16838|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050915 (Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.724

tgttgtagaatcatatcgaccatataacc	CRISPR spacer
ggttgtagaatcaaatcgaccaagcattt	Protospacer
 ************ ******** ..* ..

10. spacer 1.3|16838|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020580 (Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence) position: , mismatch: 8, identity: 0.724

tgttgtagaatcatatcgaccatataacc	CRISPR spacer
ggttgtagaatcaaatcgaccaagcattt	Protospacer
 ************ ******** ..* ..

11. spacer 1.3|16838|29|NZ_ALRS01000037|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020582 (Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence) position: , mismatch: 8, identity: 0.724

tgttgtagaatcatatcgaccatataacc	CRISPR spacer
ggttgtagaatcaaatcgaccaagcattt	Protospacer
 ************ ******** ..* ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ALRS01000030
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRS01000030_1 1662-1776 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_ALRS01000021
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4949 : 13439 12 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_ALRS01000044
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 95018 : 104006 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage