| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_ALRS01000013 | Streptococcus agalactiae STIR-CD-27 ctg120003502108, whole genome shotgun sequence | 1 crisprs | 0 | 1 | 2 | 0 | |
| NZ_ALRS01000024 | Streptococcus agalactiae STIR-CD-27 ctg120003502119, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000016 | Streptococcus agalactiae STIR-CD-27 ctg120003502111, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000033 | Streptococcus agalactiae STIR-CD-27 ctg120003502128, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000001 | Streptococcus agalactiae STIR-CD-27 ctg120003502096, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000037 | Streptococcus agalactiae STIR-CD-27 ctg120003502132, whole genome shotgun sequence | 1 crisprs | 1 | 2 | 0 | 0 | |
| NZ_ALRS01000012 | Streptococcus agalactiae STIR-CD-27 ctg120003502107, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000017 | Streptococcus agalactiae STIR-CD-27 ctg120003502112, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000015 | Streptococcus agalactiae STIR-CD-27 ctg120003502110, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000027 | Streptococcus agalactiae STIR-CD-27 ctg120003502122, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000031 | Streptococcus agalactiae STIR-CD-27 ctg120003502126, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000032 | Streptococcus agalactiae STIR-CD-27 ctg120003502127, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRS01000028 | Streptococcus agalactiae STIR-CD-27 ctg120003502123, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000008 | Streptococcus agalactiae STIR-CD-27 ctg120003502103, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000002 | Streptococcus agalactiae STIR-CD-27 ctg120003502097, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000035 | Streptococcus agalactiae STIR-CD-27 ctg120003502130, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000039 | Streptococcus agalactiae STIR-CD-27 ctg120003502134, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRS01000025 | Streptococcus agalactiae STIR-CD-27 ctg120003502120, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000007 | Streptococcus agalactiae STIR-CD-27 ctg120003502102, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000036 | Streptococcus agalactiae STIR-CD-27 ctg120003502131, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000021 | Streptococcus agalactiae STIR-CD-27 ctg120003502116, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRS01000044 | Streptococcus agalactiae STIR-CD-27 ctg120003502139, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRS01000030 | Streptococcus agalactiae STIR-CD-27 ctg120003502125, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000019 | Streptococcus agalactiae STIR-CD-27 ctg120003502114, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000011 | Streptococcus agalactiae STIR-CD-27 ctg120003502106, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000040 | Streptococcus agalactiae STIR-CD-27 ctg120003502135, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000014 | Streptococcus agalactiae STIR-CD-27 ctg120003502109, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRS01000009 | Streptococcus agalactiae STIR-CD-27 ctg120003502104, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000020 | Streptococcus agalactiae STIR-CD-27 ctg120003502115, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000005 | Streptococcus agalactiae STIR-CD-27 ctg120003502100, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000018 | Streptococcus agalactiae STIR-CD-27 ctg120003502113, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000022 | Streptococcus agalactiae STIR-CD-27 ctg120003502117, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000043 | Streptococcus agalactiae STIR-CD-27 ctg120003502138, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000026 | Streptococcus agalactiae STIR-CD-27 ctg120003502121, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000038 | Streptococcus agalactiae STIR-CD-27 ctg120003502133, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRS01000006 | Streptococcus agalactiae STIR-CD-27 ctg120003502101, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000023 | Streptococcus agalactiae STIR-CD-27 ctg120003502118, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000004 | Streptococcus agalactiae STIR-CD-27 ctg120003502099, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000010 | Streptococcus agalactiae STIR-CD-27 ctg120003502105, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000034 | Streptococcus agalactiae STIR-CD-27 ctg120003502129, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000003 | Streptococcus agalactiae STIR-CD-27 ctg120003502098, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000029 | Streptococcus agalactiae STIR-CD-27 ctg120003502124, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000042 | Streptococcus agalactiae STIR-CD-27 ctg120003502137, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRS01000041 | Streptococcus agalactiae STIR-CD-27 ctg120003502136, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 1 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_ALRS01000013_1 | 100186-100224 | 39 | DQ535032 | Lactococcus lactis phage KSY1, complete genome | 76516-76554 | 11 | 0.718 | |
| NZ_ALRS01000013_1 | 100186-100224 | 39 | NC_009817 | Lactococcus phage KSY1, complete genome | 76516-76554 | 11 | 0.718 |
gttaaagcagaccaagatgctaaagttaagttggctaag CRISPR spacer gaacaagcagaacaagatgctaaagttgagttattgtat Protospacer * ******* ***************.****. . *
gttaaagcagaccaagatgctaaagttaagttggctaag CRISPR spacer gaacaagcagaacaagatgctaaagttgagttattgtat Protospacer * ******* ***************.****. . *
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 40379 : 47583 | 8 | Streptococcus_phage(16.67%) | NA | ||
| DBSCAN-SWA_2 | 55885 : 71501 | 22 | Streptococcus_phage(61.54%) | attL 58464:58483|attR 72339:72358 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 3510 : 11592 | 8 | Staphylococcus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 8047 : 20112 | 8 | Microbacterium_phage(14.29%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_ALRS01000037_1 | 16668-16969 | TypeII |
II-A
|
4 spacers
|
csn2,cas2,cas1,cas9 |
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_ALRS01000037_1 | 16772-16800 | 29 | NZ_ALRS01000042.1 | 24427-24455 | 0 | 1.0 |
atgcgttcattttgtaagaaatctatcaa CRISPR spacer atgcgttcattttgtaagaaatctatcaa Protospacer *****************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_ALRS01000037_1 | 16772-16800 | 29 | MK308676 | Vibrio phage vB_VmeM-Yong MS31, complete genome | 172843-172871 | 7 | 0.759 | |
| NZ_ALRS01000037_1 | 16772-16800 | 29 | MK308675 | Vibrio phage vB_VmeM-Yong XC32, complete genome | 172842-172870 | 7 | 0.759 | |
| NZ_ALRS01000037_1 | 16772-16800 | 29 | MK308677 | Vibrio phage vB_VmeM-Yong MS32, complete genome | 172843-172871 | 7 | 0.759 | |
| NZ_ALRS01000037_1 | 16772-16800 | 29 | MK308674 | Vibrio phage vB_VmeM-Yong XC31, complete genome | 172842-172870 | 7 | 0.759 | |
| NZ_ALRS01000037_1 | 16772-16800 | 29 | NZ_CP053657 | Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence | 429648-429676 | 7 | 0.759 | |
| NZ_ALRS01000037_1 | 16772-16800 | 29 | MN855763 | Myoviridae sp. isolate 210, complete genome | 13489-13517 | 7 | 0.759 | |
| NZ_ALRS01000037_1 | 16838-16866 | 29 | NZ_CP017657 | Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence | 56273-56301 | 8 | 0.724 | |
| NZ_ALRS01000037_1 | 16838-16866 | 29 | NZ_CP017649 | Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence | 58336-58364 | 8 | 0.724 | |
| NZ_ALRS01000037_1 | 16838-16866 | 29 | NZ_CP050915 | Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence | 22391-22419 | 8 | 0.724 | |
| NZ_ALRS01000037_1 | 16838-16866 | 29 | NZ_CP020580 | Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence | 55464-55492 | 8 | 0.724 | |
| NZ_ALRS01000037_1 | 16838-16866 | 29 | NZ_CP020582 | Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence | 16314-16342 | 8 | 0.724 |
atgcgttcattttgtaagaaatctatcaa CRISPR spacer atgcgttcattttctaagaaatttggacg Protospacer ************* ********.*. .
atgcgttcattttgtaagaaatctatcaa CRISPR spacer atgcgttcattttctaagaaatttggacg Protospacer ************* ********.*. .
atgcgttcattttgtaagaaatctatcaa CRISPR spacer atgcgttcattttctaagaaatttggacg Protospacer ************* ********.*. .
atgcgttcattttgtaagaaatctatcaa CRISPR spacer atgcgttcattttctaagaaatttggacg Protospacer ************* ********.*. .
atgcgttcattttgtaagaaatctatcaa CRISPR spacer aagtacgtattttgcaagaaatctatcaa Protospacer * *... .******.**************
atgcgttcattttgtaagaaatctatcaa CRISPR spacer atgcgttcattttgaaagaaaaacaaaat Protospacer ************** ****** .* *
tgttgtagaatcatatcgaccatataacc CRISPR spacer ggttgtagaatcaaatcgaccaagcattt Protospacer ************ ******** ..* ..
tgttgtagaatcatatcgaccatataacc CRISPR spacer ggttgtagaatcaaatcgaccaagcattt Protospacer ************ ******** ..* ..
tgttgtagaatcatatcgaccatataacc CRISPR spacer ggttgtagaatcaaatcgaccaagcattt Protospacer ************ ******** ..* ..
tgttgtagaatcatatcgaccatataacc CRISPR spacer ggttgtagaatcaaatcgaccaagcattt Protospacer ************ ******** ..* ..
tgttgtagaatcatatcgaccatataacc CRISPR spacer ggttgtagaatcaaatcgaccaagcattt Protospacer ************ ******** ..* ..
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 85592 : 95865 | 9 | Streptococcus_phage(57.14%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 5548 : 43892 | 38 | Streptococcus_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 95018 : 104006 | 8 | Bacillus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 4949 : 13439 | 12 | Streptococcus_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 108 aa aa | AcrIIA21 | NA | NA | No | NA |