Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALRR01000024 Streptococcus agalactiae STIR-CD-24 ctg7180000001936, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000027 Streptococcus agalactiae STIR-CD-24 ctg7180000001939, whole genome shotgun sequence 0 crisprs csm6 0 0 0 0
NZ_ALRR01000036 Streptococcus agalactiae STIR-CD-24 ctg7180000001948, whole genome shotgun sequence 1 crisprs cas3 0 1 2 0
NZ_ALRR01000042 Streptococcus agalactiae STIR-CD-24 ctg7180000001954, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000013 Streptococcus agalactiae STIR-CD-24 ctg7180000001925, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000032 Streptococcus agalactiae STIR-CD-24 ctg7180000001944, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000025 Streptococcus agalactiae STIR-CD-24 ctg7180000001937, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALRR01000039 Streptococcus agalactiae STIR-CD-24 ctg7180000001951, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRR01000014 Streptococcus agalactiae STIR-CD-24 ctg7180000001926, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000033 Streptococcus agalactiae STIR-CD-24 ctg7180000001945, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000023 Streptococcus agalactiae STIR-CD-24 ctg7180000001935, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALRR01000041 Streptococcus agalactiae STIR-CD-24 ctg7180000001953, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000001 Streptococcus agalactiae STIR-CD-24 ctg7180000001913, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000043 Streptococcus agalactiae STIR-CD-24 ctg7180000001955, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000009 Streptococcus agalactiae STIR-CD-24 ctg7180000001921, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000030 Streptococcus agalactiae STIR-CD-24 ctg7180000001942, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000018 Streptococcus agalactiae STIR-CD-24 ctg7180000001930, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000037 Streptococcus agalactiae STIR-CD-24 ctg7180000001949, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 1 2 0 0
NZ_ALRR01000011 Streptococcus agalactiae STIR-CD-24 ctg7180000001923, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000004 Streptococcus agalactiae STIR-CD-24 ctg7180000001916, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000010 Streptococcus agalactiae STIR-CD-24 ctg7180000001922, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000022 Streptococcus agalactiae STIR-CD-24 ctg7180000001934, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000005 Streptococcus agalactiae STIR-CD-24 ctg7180000001917, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000017 Streptococcus agalactiae STIR-CD-24 ctg7180000001929, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRR01000029 Streptococcus agalactiae STIR-CD-24 ctg7180000001941, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000016 Streptococcus agalactiae STIR-CD-24 ctg7180000001928, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000012 Streptococcus agalactiae STIR-CD-24 ctg7180000001924, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000019 Streptococcus agalactiae STIR-CD-24 ctg7180000001931, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRR01000002 Streptococcus agalactiae STIR-CD-24 ctg7180000001914, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000006 Streptococcus agalactiae STIR-CD-24 ctg7180000001918, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRR01000015 Streptococcus agalactiae STIR-CD-24 ctg7180000001927, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRR01000028 Streptococcus agalactiae STIR-CD-24 ctg7180000001940, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000026 Streptococcus agalactiae STIR-CD-24 ctg7180000001938, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000021 Streptococcus agalactiae STIR-CD-24 ctg7180000001933, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_ALRR01000031 Streptococcus agalactiae STIR-CD-24 ctg7180000001943, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000038 Streptococcus agalactiae STIR-CD-24 ctg7180000001950, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000034 Streptococcus agalactiae STIR-CD-24 ctg7180000001946, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 0
NZ_ALRR01000008 Streptococcus agalactiae STIR-CD-24 ctg7180000001920, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000020 Streptococcus agalactiae STIR-CD-24 ctg7180000001932, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000007 Streptococcus agalactiae STIR-CD-24 ctg7180000001919, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000040 Streptococcus agalactiae STIR-CD-24 ctg7180000001952, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000003 Streptococcus agalactiae STIR-CD-24 ctg7180000001915, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRR01000035 Streptococcus agalactiae STIR-CD-24 ctg7180000001947, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ALRR01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 184 : 8674 12 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALRR01000017
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4500 : 12582 8 Staphylococcus_phage(50.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALRR01000036
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRR01000036_1 101342-101428 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRR01000036_1 1.1|101366|39|NZ_ALRR01000036|CRISPRCasFinder 101366-101404 39 DQ535032 Lactococcus lactis phage KSY1, complete genome 76516-76554 11 0.718
NZ_ALRR01000036_1 1.1|101366|39|NZ_ALRR01000036|CRISPRCasFinder 101366-101404 39 NC_009817 Lactococcus phage KSY1, complete genome 76516-76554 11 0.718

1. spacer 1.1|101366|39|NZ_ALRR01000036|CRISPRCasFinder matches to DQ535032 (Lactococcus lactis phage KSY1, complete genome) position: , mismatch: 11, identity: 0.718

gttaaagcagaccaagatgctaaagttaagttggctaag	CRISPR spacer
gaacaagcagaacaagatgctaaagttgagttattgtat	Protospacer
*   ******* ***************.****. .  * 

2. spacer 1.1|101366|39|NZ_ALRR01000036|CRISPRCasFinder matches to NC_009817 (Lactococcus phage KSY1, complete genome) position: , mismatch: 11, identity: 0.718

gttaaagcagaccaagatgctaaagttaagttggctaag	CRISPR spacer
gaacaagcagaacaagatgctaaagttgagttattgtat	Protospacer
*   ******* ***************.****. .  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 41559 : 48763 8 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_2 57065 : 72681 22 Streptococcus_phage(61.54%) integrase attL 59644:59663|attR 73519:73538
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ALRR01000034
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 138120 : 148393 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALRR01000037
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRR01000037_1 43694-43995 TypeII II-A
4 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ALRR01000037_1 1.3|43863|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder 43863-43891 29 NZ_ALRR01000019.1 129477-129505 0 1.0

1. spacer 1.3|43863|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder matches to position: 129477-129505, mismatch: 0, identity: 1.0

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
ttgatagatttcttacaaaatgaacgcat	Protospacer
*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRR01000037_1 1.3|43863|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder 43863-43891 29 MK308676 Vibrio phage vB_VmeM-Yong MS31, complete genome 172843-172871 7 0.759
NZ_ALRR01000037_1 1.3|43863|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder 43863-43891 29 MK308675 Vibrio phage vB_VmeM-Yong XC32, complete genome 172842-172870 7 0.759
NZ_ALRR01000037_1 1.3|43863|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder 43863-43891 29 MK308677 Vibrio phage vB_VmeM-Yong MS32, complete genome 172843-172871 7 0.759
NZ_ALRR01000037_1 1.3|43863|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder 43863-43891 29 MK308674 Vibrio phage vB_VmeM-Yong XC31, complete genome 172842-172870 7 0.759
NZ_ALRR01000037_1 1.3|43863|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder 43863-43891 29 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 429648-429676 7 0.759
NZ_ALRR01000037_1 1.3|43863|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder 43863-43891 29 MN855763 Myoviridae sp. isolate 210, complete genome 13489-13517 7 0.759
NZ_ALRR01000037_1 1.2|43797|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder 43797-43825 29 NZ_CP017657 Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence 56273-56301 8 0.724
NZ_ALRR01000037_1 1.2|43797|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder 43797-43825 29 NZ_CP017649 Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence 58336-58364 8 0.724
NZ_ALRR01000037_1 1.2|43797|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder 43797-43825 29 NZ_CP050915 Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence 22391-22419 8 0.724
NZ_ALRR01000037_1 1.2|43797|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder 43797-43825 29 NZ_CP020580 Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence 55464-55492 8 0.724
NZ_ALRR01000037_1 1.2|43797|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder 43797-43825 29 NZ_CP020582 Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence 16314-16342 8 0.724

1. spacer 1.3|43863|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder matches to MK308676 (Vibrio phage vB_VmeM-Yong MS31, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

2. spacer 1.3|43863|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder matches to MK308675 (Vibrio phage vB_VmeM-Yong XC32, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

3. spacer 1.3|43863|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder matches to MK308677 (Vibrio phage vB_VmeM-Yong MS32, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

4. spacer 1.3|43863|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder matches to MK308674 (Vibrio phage vB_VmeM-Yong XC31, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

5. spacer 1.3|43863|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
ttgatagatttcttgcaaaatacgtactt	Protospacer
**************.******. ...* *

6. spacer 1.3|43863|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder matches to MN855763 (Myoviridae sp. isolate 210, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
attttgtttttctttcaaaatgaacgcat	Protospacer
 *  *.  ****** **************

7. spacer 1.2|43797|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017657 (Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

8. spacer 1.2|43797|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017649 (Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

9. spacer 1.2|43797|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050915 (Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

10. spacer 1.2|43797|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020580 (Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

11. spacer 1.2|43797|29|NZ_ALRR01000037|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020582 (Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALRR01000019
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALRR01000039
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8691 : 20756 8 Microbacterium_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ALRR01000023
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALRR01000023.1|WP_000384271.1|65822_66149_+|hypothetical-protein 65822_66149_+ 108 aa aa AcrIIA21 NA NA No NA
9. NZ_ALRR01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13816 : 22804 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage