| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_ALRR01000024 | Streptococcus agalactiae STIR-CD-24 ctg7180000001936, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000027 | Streptococcus agalactiae STIR-CD-24 ctg7180000001939, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000036 | Streptococcus agalactiae STIR-CD-24 ctg7180000001948, whole genome shotgun sequence | 1 crisprs | 0 | 1 | 2 | 0 | |
| NZ_ALRR01000042 | Streptococcus agalactiae STIR-CD-24 ctg7180000001954, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000013 | Streptococcus agalactiae STIR-CD-24 ctg7180000001925, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000032 | Streptococcus agalactiae STIR-CD-24 ctg7180000001944, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000025 | Streptococcus agalactiae STIR-CD-24 ctg7180000001937, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000039 | Streptococcus agalactiae STIR-CD-24 ctg7180000001951, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRR01000014 | Streptococcus agalactiae STIR-CD-24 ctg7180000001926, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000033 | Streptococcus agalactiae STIR-CD-24 ctg7180000001945, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000023 | Streptococcus agalactiae STIR-CD-24 ctg7180000001935, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 1 | |
| NZ_ALRR01000041 | Streptococcus agalactiae STIR-CD-24 ctg7180000001953, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000001 | Streptococcus agalactiae STIR-CD-24 ctg7180000001913, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000043 | Streptococcus agalactiae STIR-CD-24 ctg7180000001955, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000009 | Streptococcus agalactiae STIR-CD-24 ctg7180000001921, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000030 | Streptococcus agalactiae STIR-CD-24 ctg7180000001942, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000018 | Streptococcus agalactiae STIR-CD-24 ctg7180000001930, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000037 | Streptococcus agalactiae STIR-CD-24 ctg7180000001949, whole genome shotgun sequence | 1 crisprs | 1 | 2 | 0 | 0 | |
| NZ_ALRR01000011 | Streptococcus agalactiae STIR-CD-24 ctg7180000001923, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000004 | Streptococcus agalactiae STIR-CD-24 ctg7180000001916, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000010 | Streptococcus agalactiae STIR-CD-24 ctg7180000001922, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000022 | Streptococcus agalactiae STIR-CD-24 ctg7180000001934, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000005 | Streptococcus agalactiae STIR-CD-24 ctg7180000001917, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000017 | Streptococcus agalactiae STIR-CD-24 ctg7180000001929, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRR01000029 | Streptococcus agalactiae STIR-CD-24 ctg7180000001941, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000016 | Streptococcus agalactiae STIR-CD-24 ctg7180000001928, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000012 | Streptococcus agalactiae STIR-CD-24 ctg7180000001924, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000019 | Streptococcus agalactiae STIR-CD-24 ctg7180000001931, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000002 | Streptococcus agalactiae STIR-CD-24 ctg7180000001914, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000006 | Streptococcus agalactiae STIR-CD-24 ctg7180000001918, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRR01000015 | Streptococcus agalactiae STIR-CD-24 ctg7180000001927, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRR01000028 | Streptococcus agalactiae STIR-CD-24 ctg7180000001940, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000026 | Streptococcus agalactiae STIR-CD-24 ctg7180000001938, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000021 | Streptococcus agalactiae STIR-CD-24 ctg7180000001933, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000031 | Streptococcus agalactiae STIR-CD-24 ctg7180000001943, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000038 | Streptococcus agalactiae STIR-CD-24 ctg7180000001950, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000034 | Streptococcus agalactiae STIR-CD-24 ctg7180000001946, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRR01000008 | Streptococcus agalactiae STIR-CD-24 ctg7180000001920, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000020 | Streptococcus agalactiae STIR-CD-24 ctg7180000001932, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000007 | Streptococcus agalactiae STIR-CD-24 ctg7180000001919, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000040 | Streptococcus agalactiae STIR-CD-24 ctg7180000001952, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000003 | Streptococcus agalactiae STIR-CD-24 ctg7180000001915, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRR01000035 | Streptococcus agalactiae STIR-CD-24 ctg7180000001947, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 184 : 8674 | 12 | Streptococcus_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 4500 : 12582 | 8 | Staphylococcus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_ALRR01000036_1 | 101366-101404 | 39 | DQ535032 | Lactococcus lactis phage KSY1, complete genome | 76516-76554 | 11 | 0.718 | |
| NZ_ALRR01000036_1 | 101366-101404 | 39 | NC_009817 | Lactococcus phage KSY1, complete genome | 76516-76554 | 11 | 0.718 |
gttaaagcagaccaagatgctaaagttaagttggctaag CRISPR spacer gaacaagcagaacaagatgctaaagttgagttattgtat Protospacer * ******* ***************.****. . *
gttaaagcagaccaagatgctaaagttaagttggctaag CRISPR spacer gaacaagcagaacaagatgctaaagttgagttattgtat Protospacer * ******* ***************.****. . *
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 41559 : 48763 | 8 | Streptococcus_phage(16.67%) | NA | ||
| DBSCAN-SWA_2 | 57065 : 72681 | 22 | Streptococcus_phage(61.54%) | attL 59644:59663|attR 73519:73538 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 138120 : 148393 | 9 | Streptococcus_phage(57.14%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_ALRR01000037_1 | 43694-43995 | TypeII |
II-A
|
4 spacers
|
csn2,cas2,cas1,cas9 |
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_ALRR01000037_1 | 43863-43891 | 29 | NZ_ALRR01000019.1 | 129477-129505 | 0 | 1.0 |
ttgatagatttcttacaaaatgaacgcat CRISPR spacer ttgatagatttcttacaaaatgaacgcat Protospacer *****************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_ALRR01000037_1 | 43863-43891 | 29 | MK308676 | Vibrio phage vB_VmeM-Yong MS31, complete genome | 172843-172871 | 7 | 0.759 | |
| NZ_ALRR01000037_1 | 43863-43891 | 29 | MK308675 | Vibrio phage vB_VmeM-Yong XC32, complete genome | 172842-172870 | 7 | 0.759 | |
| NZ_ALRR01000037_1 | 43863-43891 | 29 | MK308677 | Vibrio phage vB_VmeM-Yong MS32, complete genome | 172843-172871 | 7 | 0.759 | |
| NZ_ALRR01000037_1 | 43863-43891 | 29 | MK308674 | Vibrio phage vB_VmeM-Yong XC31, complete genome | 172842-172870 | 7 | 0.759 | |
| NZ_ALRR01000037_1 | 43863-43891 | 29 | NZ_CP053657 | Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence | 429648-429676 | 7 | 0.759 | |
| NZ_ALRR01000037_1 | 43863-43891 | 29 | MN855763 | Myoviridae sp. isolate 210, complete genome | 13489-13517 | 7 | 0.759 | |
| NZ_ALRR01000037_1 | 43797-43825 | 29 | NZ_CP017657 | Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence | 56273-56301 | 8 | 0.724 | |
| NZ_ALRR01000037_1 | 43797-43825 | 29 | NZ_CP017649 | Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence | 58336-58364 | 8 | 0.724 | |
| NZ_ALRR01000037_1 | 43797-43825 | 29 | NZ_CP050915 | Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence | 22391-22419 | 8 | 0.724 | |
| NZ_ALRR01000037_1 | 43797-43825 | 29 | NZ_CP020580 | Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence | 55464-55492 | 8 | 0.724 | |
| NZ_ALRR01000037_1 | 43797-43825 | 29 | NZ_CP020582 | Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence | 16314-16342 | 8 | 0.724 |
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer ttgatagatttcttgcaaaatacgtactt Protospacer **************.******. ...* *
ttgatagatttcttacaaaatgaacgcat CRISPR spacer attttgtttttctttcaaaatgaacgcat Protospacer * *. ****** **************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 8691 : 20756 | 8 | Microbacterium_phage(14.29%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 108 aa aa | AcrIIA21 | NA | NA | No | NA |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 13816 : 22804 | 8 | Bacillus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|