Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALRQ01000029 Streptococcus agalactiae STIR-CD-23 ctg120003587151, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000027 Streptococcus agalactiae STIR-CD-23 ctg120003587149, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000033 Streptococcus agalactiae STIR-CD-23 ctg120003587155, whole genome shotgun sequence 1 crisprs cas9,cas1,cas2,csn2 1 2 0 0
NZ_ALRQ01000047 Streptococcus agalactiae STIR-CD-23 ctg120003587169, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000005 Streptococcus agalactiae STIR-CD-23 ctg120003587126, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRQ01000028 Streptococcus agalactiae STIR-CD-23 ctg120003587150, whole genome shotgun sequence 0 crisprs csm6 0 0 0 0
NZ_ALRQ01000015 Streptococcus agalactiae STIR-CD-23 ctg120003587136, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_ALRQ01000003 Streptococcus agalactiae STIR-CD-23 ctg120003587124, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000038 Streptococcus agalactiae STIR-CD-23 ctg120003587160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000036 Streptococcus agalactiae STIR-CD-23 ctg120003587158, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALRQ01000017 Streptococcus agalactiae STIR-CD-23 ctg120003587138, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000004 Streptococcus agalactiae STIR-CD-23 ctg120003587125, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000030 Streptococcus agalactiae STIR-CD-23 ctg120003587152, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRQ01000016 Streptococcus agalactiae STIR-CD-23 ctg120003587137, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000025 Streptococcus agalactiae STIR-CD-23 ctg120003587147, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000026 Streptococcus agalactiae STIR-CD-23 ctg120003587148, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000024 Streptococcus agalactiae STIR-CD-23 ctg120003587146, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRQ01000012 Streptococcus agalactiae STIR-CD-23 ctg120003587133, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000007 Streptococcus agalactiae STIR-CD-23 ctg120003587128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000042 Streptococcus agalactiae STIR-CD-23 ctg120003587164, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000008 Streptococcus agalactiae STIR-CD-23 ctg120003587129, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000023 Streptococcus agalactiae STIR-CD-23 ctg120003587145, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000040 Streptococcus agalactiae STIR-CD-23 ctg120003587162, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALRQ01000043 Streptococcus agalactiae STIR-CD-23 ctg120003587165, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRQ01000039 Streptococcus agalactiae STIR-CD-23 ctg120003587161, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 0
NZ_ALRQ01000035 Streptococcus agalactiae STIR-CD-23 ctg120003587157, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000044 Streptococcus agalactiae STIR-CD-23 ctg120003587166, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000018 Streptococcus agalactiae STIR-CD-23 ctg120003587139, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000049 Streptococcus agalactiae STIR-CD-23 ctg120003587171, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000013 Streptococcus agalactiae STIR-CD-23 ctg120003587134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000046 Streptococcus agalactiae STIR-CD-23 ctg120003587168, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRQ01000010 Streptococcus agalactiae STIR-CD-23 ctg120003587131, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000022 Streptococcus agalactiae STIR-CD-23 ctg120003587144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000011 Streptococcus agalactiae STIR-CD-23 ctg120003587132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000034 Streptococcus agalactiae STIR-CD-23 ctg120003587156, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000048 Streptococcus agalactiae STIR-CD-23 ctg120003587170, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_ALRQ01000009 Streptococcus agalactiae STIR-CD-23 ctg120003587130, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000019 Streptococcus agalactiae STIR-CD-23 ctg120003587140, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000014 Streptococcus agalactiae STIR-CD-23 ctg120003587135, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000021 Streptococcus agalactiae STIR-CD-23 ctg120003587143, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000037 Streptococcus agalactiae STIR-CD-23 ctg120003587159, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000041 Streptococcus agalactiae STIR-CD-23 ctg120003587163, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000045 Streptococcus agalactiae STIR-CD-23 ctg120003587167, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRQ01000020 Streptococcus agalactiae STIR-CD-23 ctg120003587141, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000001 Streptococcus agalactiae STIR-CD-23 ctg120003587121, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRQ01000032 Streptococcus agalactiae STIR-CD-23 ctg120003587154, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_ALRQ01000006 Streptococcus agalactiae STIR-CD-23 ctg120003587127, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRQ01000002 Streptococcus agalactiae STIR-CD-23 ctg120003587122, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRQ01000031 Streptococcus agalactiae STIR-CD-23 ctg120003587153, whole genome shotgun sequence 1 crisprs NA 0 1 0 0
NZ_ALRQ01000050 Streptococcus agalactiae STIR-CD-23 ctg120003587172, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ALRQ01000039
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 85678 : 95951 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALRQ01000030
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 195 : 8685 12 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALRQ01000033
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRQ01000033_1 16530-16831 TypeII II-A
4 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ALRQ01000033_1 1.2|16634|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT 16634-16662 29 NZ_ALRQ01000046.1 25406-25434 0 1.0

1. spacer 1.2|16634|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT matches to position: 25406-25434, mismatch: 0, identity: 1.0

atgcgttcattttgtaagaaatctatcaa	CRISPR spacer
atgcgttcattttgtaagaaatctatcaa	Protospacer
*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRQ01000033_1 1.2|16634|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT 16634-16662 29 MK308676 Vibrio phage vB_VmeM-Yong MS31, complete genome 172843-172871 7 0.759
NZ_ALRQ01000033_1 1.2|16634|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT 16634-16662 29 MK308675 Vibrio phage vB_VmeM-Yong XC32, complete genome 172842-172870 7 0.759
NZ_ALRQ01000033_1 1.2|16634|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT 16634-16662 29 MK308677 Vibrio phage vB_VmeM-Yong MS32, complete genome 172843-172871 7 0.759
NZ_ALRQ01000033_1 1.2|16634|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT 16634-16662 29 MK308674 Vibrio phage vB_VmeM-Yong XC31, complete genome 172842-172870 7 0.759
NZ_ALRQ01000033_1 1.2|16634|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT 16634-16662 29 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 429648-429676 7 0.759
NZ_ALRQ01000033_1 1.2|16634|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT 16634-16662 29 MN855763 Myoviridae sp. isolate 210, complete genome 13489-13517 7 0.759
NZ_ALRQ01000033_1 1.3|16700|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT 16700-16728 29 NZ_CP017657 Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence 56273-56301 8 0.724
NZ_ALRQ01000033_1 1.3|16700|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT 16700-16728 29 NZ_CP017649 Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence 58336-58364 8 0.724
NZ_ALRQ01000033_1 1.3|16700|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT 16700-16728 29 NZ_CP050915 Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence 22391-22419 8 0.724
NZ_ALRQ01000033_1 1.3|16700|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT 16700-16728 29 NZ_CP020580 Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence 55464-55492 8 0.724
NZ_ALRQ01000033_1 1.3|16700|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT 16700-16728 29 NZ_CP020582 Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence 16314-16342 8 0.724

1. spacer 1.2|16634|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT matches to MK308676 (Vibrio phage vB_VmeM-Yong MS31, complete genome) position: , mismatch: 7, identity: 0.759

atgcgttcattttgtaagaaatctatcaa	CRISPR spacer
atgcgttcattttctaagaaatttggacg	Protospacer
************* ********.*.   .

2. spacer 1.2|16634|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT matches to MK308675 (Vibrio phage vB_VmeM-Yong XC32, complete genome) position: , mismatch: 7, identity: 0.759

atgcgttcattttgtaagaaatctatcaa	CRISPR spacer
atgcgttcattttctaagaaatttggacg	Protospacer
************* ********.*.   .

3. spacer 1.2|16634|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT matches to MK308677 (Vibrio phage vB_VmeM-Yong MS32, complete genome) position: , mismatch: 7, identity: 0.759

atgcgttcattttgtaagaaatctatcaa	CRISPR spacer
atgcgttcattttctaagaaatttggacg	Protospacer
************* ********.*.   .

4. spacer 1.2|16634|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT matches to MK308674 (Vibrio phage vB_VmeM-Yong XC31, complete genome) position: , mismatch: 7, identity: 0.759

atgcgttcattttgtaagaaatctatcaa	CRISPR spacer
atgcgttcattttctaagaaatttggacg	Protospacer
************* ********.*.   .

5. spacer 1.2|16634|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 7, identity: 0.759

atgcgttcattttgtaagaaatctatcaa	CRISPR spacer
aagtacgtattttgcaagaaatctatcaa	Protospacer
* *... .******.**************

6. spacer 1.2|16634|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT matches to MN855763 (Myoviridae sp. isolate 210, complete genome) position: , mismatch: 7, identity: 0.759

atgcgttcattttgtaagaaatctatcaa	CRISPR spacer
atgcgttcattttgaaagaaaaacaaaat	Protospacer
************** ******  .*  * 

7. spacer 1.3|16700|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT matches to NZ_CP017657 (Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

tgttgtagaatcatatcgaccatataacc	CRISPR spacer
ggttgtagaatcaaatcgaccaagcattt	Protospacer
 ************ ******** ..* ..

8. spacer 1.3|16700|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT matches to NZ_CP017649 (Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

tgttgtagaatcatatcgaccatataacc	CRISPR spacer
ggttgtagaatcaaatcgaccaagcattt	Protospacer
 ************ ******** ..* ..

9. spacer 1.3|16700|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT matches to NZ_CP050915 (Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.724

tgttgtagaatcatatcgaccatataacc	CRISPR spacer
ggttgtagaatcaaatcgaccaagcattt	Protospacer
 ************ ******** ..* ..

10. spacer 1.3|16700|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT matches to NZ_CP020580 (Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence) position: , mismatch: 8, identity: 0.724

tgttgtagaatcatatcgaccatataacc	CRISPR spacer
ggttgtagaatcaaatcgaccaagcattt	Protospacer
 ************ ******** ..* ..

11. spacer 1.3|16700|29|NZ_ALRQ01000033|CRISPRCasFinder,CRT matches to NZ_CP020582 (Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence) position: , mismatch: 8, identity: 0.724

tgttgtagaatcatatcgaccatataacc	CRISPR spacer
ggttgtagaatcaaatcgaccaagcattt	Protospacer
 ************ ******** ..* ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ALRQ01000045
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 32305 : 44370 8 Gordonia_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALRQ01000024
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1211 : 10213 7 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALRQ01000046
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALRQ01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 13694 9 Streptococcus_phage(100.0%) holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ALRQ01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 40466 : 47670 8 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_2 55972 : 70461 20 Streptococcus_phage(72.73%) integrase attL 49681:49694|attR 65184:65197
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ALRQ01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 2861 6 Streptococcus_phage(100.0%) tail,head,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_ALRQ01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 31914 : 40902 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_ALRQ01000036
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALRQ01000036.1|WP_000384271.1|16045_16372_-|hypothetical-protein 16045_16372_- 108 aa aa AcrIIA21 NA NA No NA
12. NZ_ALRQ01000031
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRQ01000031_1 29329-29415 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRQ01000031_1 1.1|29353|39|NZ_ALRQ01000031|CRISPRCasFinder 29353-29391 39 DQ535032 Lactococcus lactis phage KSY1, complete genome 76516-76554 11 0.718
NZ_ALRQ01000031_1 1.1|29353|39|NZ_ALRQ01000031|CRISPRCasFinder 29353-29391 39 NC_009817 Lactococcus phage KSY1, complete genome 76516-76554 11 0.718

1. spacer 1.1|29353|39|NZ_ALRQ01000031|CRISPRCasFinder matches to DQ535032 (Lactococcus lactis phage KSY1, complete genome) position: , mismatch: 11, identity: 0.718

gttaaagcagaccaagatgctaaagttaagttggctaag	CRISPR spacer
gaacaagcagaacaagatgctaaagttgagttattgtat	Protospacer
*   ******* ***************.****. .  * 

2. spacer 1.1|29353|39|NZ_ALRQ01000031|CRISPRCasFinder matches to NC_009817 (Lactococcus phage KSY1, complete genome) position: , mismatch: 11, identity: 0.718

gttaaagcagaccaagatgctaaagttaagttggctaag	CRISPR spacer
gaacaagcagaacaagatgctaaagttgagttattgtat	Protospacer
*   ******* ***************.****. .  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_ALRQ01000043
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3237 : 11319 8 Staphylococcus_phage(50.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage