| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_ALRQ01000023 | Streptococcus agalactiae STIR-CD-23 ctg120003587145, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000003 | Streptococcus agalactiae STIR-CD-23 ctg120003587124, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000035 | Streptococcus agalactiae STIR-CD-23 ctg120003587157, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000030 | Streptococcus agalactiae STIR-CD-23 ctg120003587152, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRQ01000015 | Streptococcus agalactiae STIR-CD-23 ctg120003587136, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 2 | 0 | |
| NZ_ALRQ01000004 | Streptococcus agalactiae STIR-CD-23 ctg120003587125, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000005 | Streptococcus agalactiae STIR-CD-23 ctg120003587126, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRQ01000006 | Streptococcus agalactiae STIR-CD-23 ctg120003587127, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRQ01000009 | Streptococcus agalactiae STIR-CD-23 ctg120003587130, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000012 | Streptococcus agalactiae STIR-CD-23 ctg120003587133, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000016 | Streptococcus agalactiae STIR-CD-23 ctg120003587137, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000020 | Streptococcus agalactiae STIR-CD-23 ctg120003587141, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000049 | Streptococcus agalactiae STIR-CD-23 ctg120003587171, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000043 | Streptococcus agalactiae STIR-CD-23 ctg120003587165, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRQ01000037 | Streptococcus agalactiae STIR-CD-23 ctg120003587159, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000044 | Streptococcus agalactiae STIR-CD-23 ctg120003587166, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000011 | Streptococcus agalactiae STIR-CD-23 ctg120003587132, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000039 | Streptococcus agalactiae STIR-CD-23 ctg120003587161, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRQ01000041 | Streptococcus agalactiae STIR-CD-23 ctg120003587163, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000028 | Streptococcus agalactiae STIR-CD-23 ctg120003587150, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000024 | Streptococcus agalactiae STIR-CD-23 ctg120003587146, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRQ01000019 | Streptococcus agalactiae STIR-CD-23 ctg120003587140, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000022 | Streptococcus agalactiae STIR-CD-23 ctg120003587144, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000040 | Streptococcus agalactiae STIR-CD-23 ctg120003587162, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000050 | Streptococcus agalactiae STIR-CD-23 ctg120003587172, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000034 | Streptococcus agalactiae STIR-CD-23 ctg120003587156, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000008 | Streptococcus agalactiae STIR-CD-23 ctg120003587129, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000027 | Streptococcus agalactiae STIR-CD-23 ctg120003587149, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000002 | Streptococcus agalactiae STIR-CD-23 ctg120003587122, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRQ01000001 | Streptococcus agalactiae STIR-CD-23 ctg120003587121, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000047 | Streptococcus agalactiae STIR-CD-23 ctg120003587169, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000010 | Streptococcus agalactiae STIR-CD-23 ctg120003587131, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000014 | Streptococcus agalactiae STIR-CD-23 ctg120003587135, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000048 | Streptococcus agalactiae STIR-CD-23 ctg120003587170, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000007 | Streptococcus agalactiae STIR-CD-23 ctg120003587128, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000025 | Streptococcus agalactiae STIR-CD-23 ctg120003587147, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000033 | Streptococcus agalactiae STIR-CD-23 ctg120003587155, whole genome shotgun sequence | 1 crisprs | 1 | 2 | 0 | 0 | |
| NZ_ALRQ01000032 | Streptococcus agalactiae STIR-CD-23 ctg120003587154, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000013 | Streptococcus agalactiae STIR-CD-23 ctg120003587134, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000045 | Streptococcus agalactiae STIR-CD-23 ctg120003587167, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRQ01000031 | Streptococcus agalactiae STIR-CD-23 ctg120003587153, whole genome shotgun sequence | 1 crisprs | 0 | 1 | 0 | 0 | |
| NZ_ALRQ01000021 | Streptococcus agalactiae STIR-CD-23 ctg120003587143, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000042 | Streptococcus agalactiae STIR-CD-23 ctg120003587164, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000046 | Streptococcus agalactiae STIR-CD-23 ctg120003587168, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000026 | Streptococcus agalactiae STIR-CD-23 ctg120003587148, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000017 | Streptococcus agalactiae STIR-CD-23 ctg120003587138, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000038 | Streptococcus agalactiae STIR-CD-23 ctg120003587160, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000018 | Streptococcus agalactiae STIR-CD-23 ctg120003587139, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000029 | Streptococcus agalactiae STIR-CD-23 ctg120003587151, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRQ01000036 | Streptococcus agalactiae STIR-CD-23 ctg120003587158, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 1 |
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_ALRQ01000033_1 | 16530-16831 | TypeII |
II-A
|
4 spacers
|
csn2,cas2,cas1,cas9 |
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_ALRQ01000033_1 | 16634-16662 | 29 | NZ_ALRQ01000046.1 | 25406-25434 | 0 | 1.0 |
atgcgttcattttgtaagaaatctatcaa CRISPR spacer atgcgttcattttgtaagaaatctatcaa Protospacer *****************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_ALRQ01000033_1 | 16634-16662 | 29 | MK308676 | Vibrio phage vB_VmeM-Yong MS31, complete genome | 172843-172871 | 7 | 0.759 | |
| NZ_ALRQ01000033_1 | 16634-16662 | 29 | MK308675 | Vibrio phage vB_VmeM-Yong XC32, complete genome | 172842-172870 | 7 | 0.759 | |
| NZ_ALRQ01000033_1 | 16634-16662 | 29 | MK308677 | Vibrio phage vB_VmeM-Yong MS32, complete genome | 172843-172871 | 7 | 0.759 | |
| NZ_ALRQ01000033_1 | 16634-16662 | 29 | MK308674 | Vibrio phage vB_VmeM-Yong XC31, complete genome | 172842-172870 | 7 | 0.759 | |
| NZ_ALRQ01000033_1 | 16634-16662 | 29 | NZ_CP053657 | Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence | 429648-429676 | 7 | 0.759 | |
| NZ_ALRQ01000033_1 | 16634-16662 | 29 | MN855763 | Myoviridae sp. isolate 210, complete genome | 13489-13517 | 7 | 0.759 | |
| NZ_ALRQ01000033_1 | 16700-16728 | 29 | NZ_CP017657 | Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence | 56273-56301 | 8 | 0.724 | |
| NZ_ALRQ01000033_1 | 16700-16728 | 29 | NZ_CP017649 | Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence | 58336-58364 | 8 | 0.724 | |
| NZ_ALRQ01000033_1 | 16700-16728 | 29 | NZ_CP050915 | Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence | 22391-22419 | 8 | 0.724 | |
| NZ_ALRQ01000033_1 | 16700-16728 | 29 | NZ_CP020580 | Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence | 55464-55492 | 8 | 0.724 | |
| NZ_ALRQ01000033_1 | 16700-16728 | 29 | NZ_CP020582 | Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence | 16314-16342 | 8 | 0.724 |
atgcgttcattttgtaagaaatctatcaa CRISPR spacer atgcgttcattttctaagaaatttggacg Protospacer ************* ********.*. .
atgcgttcattttgtaagaaatctatcaa CRISPR spacer atgcgttcattttctaagaaatttggacg Protospacer ************* ********.*. .
atgcgttcattttgtaagaaatctatcaa CRISPR spacer atgcgttcattttctaagaaatttggacg Protospacer ************* ********.*. .
atgcgttcattttgtaagaaatctatcaa CRISPR spacer atgcgttcattttctaagaaatttggacg Protospacer ************* ********.*. .
atgcgttcattttgtaagaaatctatcaa CRISPR spacer aagtacgtattttgcaagaaatctatcaa Protospacer * *... .******.**************
atgcgttcattttgtaagaaatctatcaa CRISPR spacer atgcgttcattttgaaagaaaaacaaaat Protospacer ************** ****** .* *
tgttgtagaatcatatcgaccatataacc CRISPR spacer ggttgtagaatcaaatcgaccaagcattt Protospacer ************ ******** ..* ..
tgttgtagaatcatatcgaccatataacc CRISPR spacer ggttgtagaatcaaatcgaccaagcattt Protospacer ************ ******** ..* ..
tgttgtagaatcatatcgaccatataacc CRISPR spacer ggttgtagaatcaaatcgaccaagcattt Protospacer ************ ******** ..* ..
tgttgtagaatcatatcgaccatataacc CRISPR spacer ggttgtagaatcaaatcgaccaagcattt Protospacer ************ ******** ..* ..
tgttgtagaatcatatcgaccatataacc CRISPR spacer ggttgtagaatcaaatcgaccaagcattt Protospacer ************ ******** ..* ..
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 3237 : 11319 | 8 | Staphylococcus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 32305 : 44370 | 8 | Gordonia_phage(14.29%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 195 : 8685 | 12 | Streptococcus_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 0 : 2861 | 6 | Streptococcus_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 31914 : 40902 | 8 | Bacillus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 0 : 13694 | 9 | Streptococcus_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 85678 : 95951 | 9 | Streptococcus_phage(57.14%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 1211 : 10213 | 7 | Streptococcus_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 40466 : 47670 | 8 | Streptococcus_phage(16.67%) | NA | ||
| DBSCAN-SWA_2 | 55972 : 70461 | 20 | Streptococcus_phage(72.73%) | attL 49681:49694|attR 65184:65197 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 108 aa aa | AcrIIA21 | NA | NA | No | NA |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_ALRQ01000031_1 | 29353-29391 | 39 | DQ535032 | Lactococcus lactis phage KSY1, complete genome | 76516-76554 | 11 | 0.718 | |
| NZ_ALRQ01000031_1 | 29353-29391 | 39 | NC_009817 | Lactococcus phage KSY1, complete genome | 76516-76554 | 11 | 0.718 |
gttaaagcagaccaagatgctaaagttaagttggctaag CRISPR spacer gaacaagcagaacaagatgctaaagttgagttattgtat Protospacer * ******* ***************.****. . *
gttaaagcagaccaagatgctaaagttaagttggctaag CRISPR spacer gaacaagcagaacaagatgctaaagttgagttattgtat Protospacer * ******* ***************.****. . *
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|