| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_ALRP01000040 | Streptococcus agalactiae STIR-CD-22 ctg7180000002346, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000053 | Streptococcus agalactiae STIR-CD-22 ctg7180000002359, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000026 | Streptococcus agalactiae STIR-CD-22 ctg7180000002332, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000010 | Streptococcus agalactiae STIR-CD-22 ctg7180000002316, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRP01000002 | Streptococcus agalactiae STIR-CD-22 ctg7180000002308, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000013 | Streptococcus agalactiae STIR-CD-22 ctg7180000002319, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000003 | Streptococcus agalactiae STIR-CD-22 ctg7180000002309, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000044 | Streptococcus agalactiae STIR-CD-22 ctg7180000002350, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000009 | Streptococcus agalactiae STIR-CD-22 ctg7180000002315, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000048 | Streptococcus agalactiae STIR-CD-22 ctg7180000002354, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000001 | Streptococcus agalactiae STIR-CD-22 ctg7180000002307, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000016 | Streptococcus agalactiae STIR-CD-22 ctg7180000002322, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRP01000038 | Streptococcus agalactiae STIR-CD-22 ctg7180000002344, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000051 | Streptococcus agalactiae STIR-CD-22 ctg7180000002357, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000024 | Streptococcus agalactiae STIR-CD-22 ctg7180000002330, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000006 | Streptococcus agalactiae STIR-CD-22 ctg7180000002312, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRP01000025 | Streptococcus agalactiae STIR-CD-22 ctg7180000002331, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000022 | Streptococcus agalactiae STIR-CD-22 ctg7180000002328, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000032 | Streptococcus agalactiae STIR-CD-22 ctg7180000002338, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000036 | Streptococcus agalactiae STIR-CD-22 ctg7180000002342, whole genome shotgun sequence | 1 crisprs | 0 | 1 | 2 | 0 | |
| NZ_ALRP01000007 | Streptococcus agalactiae STIR-CD-22 ctg7180000002313, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000015 | Streptococcus agalactiae STIR-CD-22 ctg7180000002321, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000005 | Streptococcus agalactiae STIR-CD-22 ctg7180000002311, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000021 | Streptococcus agalactiae STIR-CD-22 ctg7180000002327, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000046 | Streptococcus agalactiae STIR-CD-22 ctg7180000002352, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000035 | Streptococcus agalactiae STIR-CD-22 ctg7180000002341, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000023 | Streptococcus agalactiae STIR-CD-22 ctg7180000002329, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRP01000020 | Streptococcus agalactiae STIR-CD-22 ctg7180000002326, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000018 | Streptococcus agalactiae STIR-CD-22 ctg7180000002324, whole genome shotgun sequence | 1 crisprs | 1 | 2 | 0 | 0 | |
| NZ_ALRP01000052 | Streptococcus agalactiae STIR-CD-22 ctg7180000002358, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000031 | Streptococcus agalactiae STIR-CD-22 ctg7180000002337, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000039 | Streptococcus agalactiae STIR-CD-22 ctg7180000002345, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000030 | Streptococcus agalactiae STIR-CD-22 ctg7180000002336, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000027 | Streptococcus agalactiae STIR-CD-22 ctg7180000002333, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000034 | Streptococcus agalactiae STIR-CD-22 ctg7180000002340, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000029 | Streptococcus agalactiae STIR-CD-22 ctg7180000002335, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000011 | Streptococcus agalactiae STIR-CD-22 ctg7180000002317, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000033 | Streptococcus agalactiae STIR-CD-22 ctg7180000002339, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000047 | Streptococcus agalactiae STIR-CD-22 ctg7180000002353, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000008 | Streptococcus agalactiae STIR-CD-22 ctg7180000002314, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000045 | Streptococcus agalactiae STIR-CD-22 ctg7180000002351, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRP01000037 | Streptococcus agalactiae STIR-CD-22 ctg7180000002343, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000028 | Streptococcus agalactiae STIR-CD-22 ctg7180000002334, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000004 | Streptococcus agalactiae STIR-CD-22 ctg7180000002310, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000014 | Streptococcus agalactiae STIR-CD-22 ctg7180000002320, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000042 | Streptococcus agalactiae STIR-CD-22 ctg7180000002348, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000050 | Streptococcus agalactiae STIR-CD-22 ctg7180000002356, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRP01000012 | Streptococcus agalactiae STIR-CD-22 ctg7180000002318, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000017 | Streptococcus agalactiae STIR-CD-22 ctg7180000002323, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000041 | Streptococcus agalactiae STIR-CD-22 ctg7180000002347, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000019 | Streptococcus agalactiae STIR-CD-22 ctg7180000002325, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000043 | Streptococcus agalactiae STIR-CD-22 ctg7180000002349, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRP01000049 | Streptococcus agalactiae STIR-CD-22 ctg7180000002355, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 1 | |
| NZ_ALRP01000054 | Streptococcus agalactiae STIR-CD-22 ctg7180000002360, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_ALRP01000018_1 | 44520-44821 | TypeII |
II-A
|
4 spacers
|
csn2,cas2,cas1,cas9 |
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_ALRP01000018_1 | 44689-44717 | 29 | NZ_ALRP01000027.1 | 25412-25440 | 0 | 1.0 |
ttgatagatttcttacaaaatgaacgcat CRISPR spacer ttgatagatttcttacaaaatgaacgcat Protospacer *****************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_ALRP01000018_1 | 44689-44717 | 29 | MK308676 | Vibrio phage vB_VmeM-Yong MS31, complete genome | 172843-172871 | 7 | 0.759 | |
| NZ_ALRP01000018_1 | 44689-44717 | 29 | MK308675 | Vibrio phage vB_VmeM-Yong XC32, complete genome | 172842-172870 | 7 | 0.759 | |
| NZ_ALRP01000018_1 | 44689-44717 | 29 | MK308677 | Vibrio phage vB_VmeM-Yong MS32, complete genome | 172843-172871 | 7 | 0.759 | |
| NZ_ALRP01000018_1 | 44689-44717 | 29 | MK308674 | Vibrio phage vB_VmeM-Yong XC31, complete genome | 172842-172870 | 7 | 0.759 | |
| NZ_ALRP01000018_1 | 44689-44717 | 29 | NZ_CP053657 | Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence | 429648-429676 | 7 | 0.759 | |
| NZ_ALRP01000018_1 | 44689-44717 | 29 | MN855763 | Myoviridae sp. isolate 210, complete genome | 13489-13517 | 7 | 0.759 | |
| NZ_ALRP01000018_1 | 44623-44651 | 29 | NZ_CP017657 | Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence | 56273-56301 | 8 | 0.724 | |
| NZ_ALRP01000018_1 | 44623-44651 | 29 | NZ_CP017649 | Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence | 58336-58364 | 8 | 0.724 | |
| NZ_ALRP01000018_1 | 44623-44651 | 29 | NZ_CP050915 | Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence | 22391-22419 | 8 | 0.724 | |
| NZ_ALRP01000018_1 | 44623-44651 | 29 | NZ_CP020580 | Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence | 55464-55492 | 8 | 0.724 | |
| NZ_ALRP01000018_1 | 44623-44651 | 29 | NZ_CP020582 | Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence | 16314-16342 | 8 | 0.724 |
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer ttgatagatttcttgcaaaatacgtactt Protospacer **************.******. ...* *
ttgatagatttcttacaaaatgaacgcat CRISPR spacer attttgtttttctttcaaaatgaacgcat Protospacer * *. ****** **************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 146428 : 154510 | 8 | Staphylococcus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 73231 : 83504 | 9 | Streptococcus_phage(57.14%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 1633 : 10123 | 12 | Streptococcus_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_ALRP01000036_1 | 99558-99596 | 39 | DQ535032 | Lactococcus lactis phage KSY1, complete genome | 76516-76554 | 11 | 0.718 | |
| NZ_ALRP01000036_1 | 99558-99596 | 39 | NC_009817 | Lactococcus phage KSY1, complete genome | 76516-76554 | 11 | 0.718 |
gttaaagcagaccaagatgctaaagttaagttggctaag CRISPR spacer gaacaagcagaacaagatgctaaagttgagttattgtat Protospacer * ******* ***************.****. . *
gttaaagcagaccaagatgctaaagttaagttggctaag CRISPR spacer gaacaagcagaacaagatgctaaagttgagttattgtat Protospacer * ******* ***************.****. . *
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 39751 : 46955 | 8 | Streptococcus_phage(16.67%) | NA | ||
| DBSCAN-SWA_2 | 55257 : 70873 | 22 | Streptococcus_phage(61.54%) | attL 57836:57855|attR 71711:71730 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 1582 : 13647 | 8 | Microbacterium_phage(14.29%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 65254 : 74242 | 8 | Bacillus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 108 aa aa | AcrIIA21 | NA | NA | No | NA |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 787 : 31523 | 27 | Streptococcus_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|