Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALRP01000046 Streptococcus agalactiae STIR-CD-22 ctg7180000002352, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000054 Streptococcus agalactiae STIR-CD-22 ctg7180000002360, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000004 Streptococcus agalactiae STIR-CD-22 ctg7180000002310, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000052 Streptococcus agalactiae STIR-CD-22 ctg7180000002358, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000038 Streptococcus agalactiae STIR-CD-22 ctg7180000002344, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000012 Streptococcus agalactiae STIR-CD-22 ctg7180000002318, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000044 Streptococcus agalactiae STIR-CD-22 ctg7180000002350, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALRP01000036 Streptococcus agalactiae STIR-CD-22 ctg7180000002342, whole genome shotgun sequence 1 crisprs cas3 0 1 2 0
NZ_ALRP01000049 Streptococcus agalactiae STIR-CD-22 ctg7180000002355, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALRP01000035 Streptococcus agalactiae STIR-CD-22 ctg7180000002341, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000015 Streptococcus agalactiae STIR-CD-22 ctg7180000002321, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000051 Streptococcus agalactiae STIR-CD-22 ctg7180000002357, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000027 Streptococcus agalactiae STIR-CD-22 ctg7180000002333, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRP01000019 Streptococcus agalactiae STIR-CD-22 ctg7180000002325, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000030 Streptococcus agalactiae STIR-CD-22 ctg7180000002336, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000007 Streptococcus agalactiae STIR-CD-22 ctg7180000002313, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000017 Streptococcus agalactiae STIR-CD-22 ctg7180000002323, whole genome shotgun sequence 0 crisprs csm6 0 0 0 0
NZ_ALRP01000037 Streptococcus agalactiae STIR-CD-22 ctg7180000002343, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000005 Streptococcus agalactiae STIR-CD-22 ctg7180000002311, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000010 Streptococcus agalactiae STIR-CD-22 ctg7180000002316, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRP01000020 Streptococcus agalactiae STIR-CD-22 ctg7180000002326, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000032 Streptococcus agalactiae STIR-CD-22 ctg7180000002338, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000029 Streptococcus agalactiae STIR-CD-22 ctg7180000002335, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000014 Streptococcus agalactiae STIR-CD-22 ctg7180000002320, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000033 Streptococcus agalactiae STIR-CD-22 ctg7180000002339, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000025 Streptococcus agalactiae STIR-CD-22 ctg7180000002331, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000028 Streptococcus agalactiae STIR-CD-22 ctg7180000002334, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRP01000023 Streptococcus agalactiae STIR-CD-22 ctg7180000002329, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRP01000040 Streptococcus agalactiae STIR-CD-22 ctg7180000002346, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000034 Streptococcus agalactiae STIR-CD-22 ctg7180000002340, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000024 Streptococcus agalactiae STIR-CD-22 ctg7180000002330, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000001 Streptococcus agalactiae STIR-CD-22 ctg7180000002307, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000042 Streptococcus agalactiae STIR-CD-22 ctg7180000002348, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000050 Streptococcus agalactiae STIR-CD-22 ctg7180000002356, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRP01000002 Streptococcus agalactiae STIR-CD-22 ctg7180000002308, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000011 Streptococcus agalactiae STIR-CD-22 ctg7180000002317, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000043 Streptococcus agalactiae STIR-CD-22 ctg7180000002349, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000031 Streptococcus agalactiae STIR-CD-22 ctg7180000002337, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000039 Streptococcus agalactiae STIR-CD-22 ctg7180000002345, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000026 Streptococcus agalactiae STIR-CD-22 ctg7180000002332, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000006 Streptococcus agalactiae STIR-CD-22 ctg7180000002312, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRP01000016 Streptococcus agalactiae STIR-CD-22 ctg7180000002322, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRP01000053 Streptococcus agalactiae STIR-CD-22 ctg7180000002359, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000003 Streptococcus agalactiae STIR-CD-22 ctg7180000002309, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000022 Streptococcus agalactiae STIR-CD-22 ctg7180000002328, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000013 Streptococcus agalactiae STIR-CD-22 ctg7180000002319, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000048 Streptococcus agalactiae STIR-CD-22 ctg7180000002354, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000047 Streptococcus agalactiae STIR-CD-22 ctg7180000002353, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_ALRP01000008 Streptococcus agalactiae STIR-CD-22 ctg7180000002314, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000021 Streptococcus agalactiae STIR-CD-22 ctg7180000002327, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRP01000009 Streptococcus agalactiae STIR-CD-22 ctg7180000002315, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRP01000045 Streptococcus agalactiae STIR-CD-22 ctg7180000002351, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRP01000018 Streptococcus agalactiae STIR-CD-22 ctg7180000002324, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 1 2 0 0
NZ_ALRP01000041 Streptococcus agalactiae STIR-CD-22 ctg7180000002347, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ALRP01000036
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRP01000036_1 99534-99620 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRP01000036_1 1.1|99558|39|NZ_ALRP01000036|CRISPRCasFinder 99558-99596 39 DQ535032 Lactococcus lactis phage KSY1, complete genome 76516-76554 11 0.718
NZ_ALRP01000036_1 1.1|99558|39|NZ_ALRP01000036|CRISPRCasFinder 99558-99596 39 NC_009817 Lactococcus phage KSY1, complete genome 76516-76554 11 0.718

1. spacer 1.1|99558|39|NZ_ALRP01000036|CRISPRCasFinder matches to DQ535032 (Lactococcus lactis phage KSY1, complete genome) position: , mismatch: 11, identity: 0.718

gttaaagcagaccaagatgctaaagttaagttggctaag	CRISPR spacer
gaacaagcagaacaagatgctaaagttgagttattgtat	Protospacer
*   ******* ***************.****. .  * 

2. spacer 1.1|99558|39|NZ_ALRP01000036|CRISPRCasFinder matches to NC_009817 (Lactococcus phage KSY1, complete genome) position: , mismatch: 11, identity: 0.718

gttaaagcagaccaagatgctaaagttaagttggctaag	CRISPR spacer
gaacaagcagaacaagatgctaaagttgagttattgtat	Protospacer
*   ******* ***************.****. .  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 39751 : 46955 8 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_2 55257 : 70873 22 Streptococcus_phage(61.54%) integrase attL 57836:57855|attR 71711:71730
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALRP01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 65254 : 74242 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALRP01000049
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALRP01000049.1|WP_000384271.1|63079_63406_+|hypothetical-protein 63079_63406_+ 108 aa aa AcrIIA21 NA NA No NA
4. NZ_ALRP01000016
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1633 : 10123 12 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALRP01000023
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1582 : 13647 8 Microbacterium_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALRP01000027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALRP01000045
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 146428 : 154510 8 Staphylococcus_phage(50.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ALRP01000050
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 73231 : 83504 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ALRP01000018
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRP01000018_1 44520-44821 TypeII II-A
4 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ALRP01000018_1 1.3|44689|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder 44689-44717 29 NZ_ALRP01000027.1 25412-25440 0 1.0

1. spacer 1.3|44689|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder matches to position: 25412-25440, mismatch: 0, identity: 1.0

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
ttgatagatttcttacaaaatgaacgcat	Protospacer
*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRP01000018_1 1.3|44689|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder 44689-44717 29 MK308676 Vibrio phage vB_VmeM-Yong MS31, complete genome 172843-172871 7 0.759
NZ_ALRP01000018_1 1.3|44689|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder 44689-44717 29 MK308675 Vibrio phage vB_VmeM-Yong XC32, complete genome 172842-172870 7 0.759
NZ_ALRP01000018_1 1.3|44689|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder 44689-44717 29 MK308677 Vibrio phage vB_VmeM-Yong MS32, complete genome 172843-172871 7 0.759
NZ_ALRP01000018_1 1.3|44689|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder 44689-44717 29 MK308674 Vibrio phage vB_VmeM-Yong XC31, complete genome 172842-172870 7 0.759
NZ_ALRP01000018_1 1.3|44689|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder 44689-44717 29 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 429648-429676 7 0.759
NZ_ALRP01000018_1 1.3|44689|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder 44689-44717 29 MN855763 Myoviridae sp. isolate 210, complete genome 13489-13517 7 0.759
NZ_ALRP01000018_1 1.2|44623|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder 44623-44651 29 NZ_CP017657 Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence 56273-56301 8 0.724
NZ_ALRP01000018_1 1.2|44623|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder 44623-44651 29 NZ_CP017649 Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence 58336-58364 8 0.724
NZ_ALRP01000018_1 1.2|44623|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder 44623-44651 29 NZ_CP050915 Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence 22391-22419 8 0.724
NZ_ALRP01000018_1 1.2|44623|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder 44623-44651 29 NZ_CP020580 Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence 55464-55492 8 0.724
NZ_ALRP01000018_1 1.2|44623|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder 44623-44651 29 NZ_CP020582 Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence 16314-16342 8 0.724

1. spacer 1.3|44689|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK308676 (Vibrio phage vB_VmeM-Yong MS31, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

2. spacer 1.3|44689|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK308675 (Vibrio phage vB_VmeM-Yong XC32, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

3. spacer 1.3|44689|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK308677 (Vibrio phage vB_VmeM-Yong MS32, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

4. spacer 1.3|44689|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder matches to MK308674 (Vibrio phage vB_VmeM-Yong XC31, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

5. spacer 1.3|44689|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
ttgatagatttcttgcaaaatacgtactt	Protospacer
**************.******. ...* *

6. spacer 1.3|44689|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder matches to MN855763 (Myoviridae sp. isolate 210, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
attttgtttttctttcaaaatgaacgcat	Protospacer
 *  *.  ****** **************

7. spacer 1.2|44623|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017657 (Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

8. spacer 1.2|44623|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017649 (Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

9. spacer 1.2|44623|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050915 (Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

10. spacer 1.2|44623|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020580 (Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

11. spacer 1.2|44623|29|NZ_ALRP01000018|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020582 (Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_ALRP01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 787 : 31523 27 Streptococcus_phage(100.0%) terminase,head,portal,capsid,tail,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage