| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_ALRO01000002 | Streptococcus agalactiae STIR-CD-21 ctg7180000002702, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000031 | Streptococcus agalactiae STIR-CD-21 ctg7180000002731, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000018 | Streptococcus agalactiae STIR-CD-21 ctg7180000002718, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRO01000012 | Streptococcus agalactiae STIR-CD-21 ctg7180000002712, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000011 | Streptococcus agalactiae STIR-CD-21 ctg7180000002711, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000035 | Streptococcus agalactiae STIR-CD-21 ctg7180000002735, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000010 | Streptococcus agalactiae STIR-CD-21 ctg7180000002710, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000029 | Streptococcus agalactiae STIR-CD-21 ctg7180000002729, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000037 | Streptococcus agalactiae STIR-CD-21 ctg7180000002737, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000036 | Streptococcus agalactiae STIR-CD-21 ctg7180000002736, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRO01000016 | Streptococcus agalactiae STIR-CD-21 ctg7180000002716, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000028 | Streptococcus agalactiae STIR-CD-21 ctg7180000002728, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000053 | Streptococcus agalactiae STIR-CD-21 ctg7180000002753, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000003 | Streptococcus agalactiae STIR-CD-21 ctg7180000002703, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000014 | Streptococcus agalactiae STIR-CD-21 ctg7180000002714, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000052 | Streptococcus agalactiae STIR-CD-21 ctg7180000002752, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRO01000039 | Streptococcus agalactiae STIR-CD-21 ctg7180000002739, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000034 | Streptococcus agalactiae STIR-CD-21 ctg7180000002734, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000051 | Streptococcus agalactiae STIR-CD-21 ctg7180000002751, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000048 | Streptococcus agalactiae STIR-CD-21 ctg7180000002748, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRO01000022 | Streptococcus agalactiae STIR-CD-21 ctg7180000002722, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000050 | Streptococcus agalactiae STIR-CD-21 ctg7180000002750, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000015 | Streptococcus agalactiae STIR-CD-21 ctg7180000002715, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000030 | Streptococcus agalactiae STIR-CD-21 ctg7180000002730, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000044 | Streptococcus agalactiae STIR-CD-21 ctg7180000002744, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 1 | |
| NZ_ALRO01000047 | Streptococcus agalactiae STIR-CD-21 ctg7180000002747, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000008 | Streptococcus agalactiae STIR-CD-21 ctg7180000002708, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000004 | Streptococcus agalactiae STIR-CD-21 ctg7180000002704, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000006 | Streptococcus agalactiae STIR-CD-21 ctg7180000002706, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000023 | Streptococcus agalactiae STIR-CD-21 ctg7180000002723, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000049 | Streptococcus agalactiae STIR-CD-21 ctg7180000002749, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000007 | Streptococcus agalactiae STIR-CD-21 ctg7180000002707, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000027 | Streptococcus agalactiae STIR-CD-21 ctg7180000002727, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000041 | Streptococcus agalactiae STIR-CD-21 ctg7180000002741, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000020 | Streptococcus agalactiae STIR-CD-21 ctg7180000002720, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000024 | Streptococcus agalactiae STIR-CD-21 ctg7180000002724, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRO01000013 | Streptococcus agalactiae STIR-CD-21 ctg7180000002713, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000021 | Streptococcus agalactiae STIR-CD-21 ctg7180000002721, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000046 | Streptococcus agalactiae STIR-CD-21 ctg7180000002746, whole genome shotgun sequence | 1 crisprs | 1 | 2 | 0 | 0 | |
| NZ_ALRO01000033 | Streptococcus agalactiae STIR-CD-21 ctg7180000002733, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000038 | Streptococcus agalactiae STIR-CD-21 ctg7180000002738, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 2 | 0 | |
| NZ_ALRO01000042 | Streptococcus agalactiae STIR-CD-21 ctg7180000002742, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000017 | Streptococcus agalactiae STIR-CD-21 ctg7180000002717, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000043 | Streptococcus agalactiae STIR-CD-21 ctg7180000002743, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_ALRO01000032 | Streptococcus agalactiae STIR-CD-21 ctg7180000002732, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000001 | Streptococcus agalactiae STIR-CD-21 ctg7180000002701, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000005 | Streptococcus agalactiae STIR-CD-21 ctg7180000002705, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000045 | Streptococcus agalactiae STIR-CD-21 ctg7180000002745, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000040 | Streptococcus agalactiae STIR-CD-21 ctg7180000002740, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000026 | Streptococcus agalactiae STIR-CD-21 ctg7180000002726, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000025 | Streptococcus agalactiae STIR-CD-21 ctg7180000002725, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000019 | Streptococcus agalactiae STIR-CD-21 ctg7180000002719, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_ALRO01000009 | Streptococcus agalactiae STIR-CD-21 ctg7180000002709, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 4924 : 45545 | 39 | Streptococcus_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 108 aa aa | AcrIIA21 | NA | NA | No | NA |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 8769 : 20834 | 8 | Microbacterium_phage(14.29%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 115467 : 123549 | 8 | Staphylococcus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 1622 : 10112 | 12 | Streptococcus_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 13570 : 22558 | 8 | Bacillus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 73248 : 83521 | 9 | Streptococcus_phage(57.14%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 30298 : 45914 | 22 | Streptococcus_phage(61.54%) | attL 29442:29461|attR 43317:43336 | ||
| DBSCAN-SWA_2 | 54215 : 61419 | 8 | uncultured_Caudovirales_phage(16.67%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_ALRO01000046_1 | 44455-44756 | TypeII |
II-A
|
4 spacers
|
csn2,cas2,cas1,cas9 |
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_ALRO01000046_1 | 44624-44652 | 29 | NZ_ALRO01000042.1 | 105339-105367 | 0 | 1.0 |
ttgatagatttcttacaaaatgaacgcat CRISPR spacer ttgatagatttcttacaaaatgaacgcat Protospacer *****************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_ALRO01000046_1 | 44624-44652 | 29 | MK308676 | Vibrio phage vB_VmeM-Yong MS31, complete genome | 172843-172871 | 7 | 0.759 | |
| NZ_ALRO01000046_1 | 44624-44652 | 29 | MK308675 | Vibrio phage vB_VmeM-Yong XC32, complete genome | 172842-172870 | 7 | 0.759 | |
| NZ_ALRO01000046_1 | 44624-44652 | 29 | MK308677 | Vibrio phage vB_VmeM-Yong MS32, complete genome | 172843-172871 | 7 | 0.759 | |
| NZ_ALRO01000046_1 | 44624-44652 | 29 | MK308674 | Vibrio phage vB_VmeM-Yong XC31, complete genome | 172842-172870 | 7 | 0.759 | |
| NZ_ALRO01000046_1 | 44624-44652 | 29 | NZ_CP053657 | Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence | 429648-429676 | 7 | 0.759 | |
| NZ_ALRO01000046_1 | 44624-44652 | 29 | MN855763 | Myoviridae sp. isolate 210, complete genome | 13489-13517 | 7 | 0.759 | |
| NZ_ALRO01000046_1 | 44558-44586 | 29 | NZ_CP017657 | Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence | 56273-56301 | 8 | 0.724 | |
| NZ_ALRO01000046_1 | 44558-44586 | 29 | NZ_CP017649 | Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence | 58336-58364 | 8 | 0.724 | |
| NZ_ALRO01000046_1 | 44558-44586 | 29 | NZ_CP050915 | Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence | 22391-22419 | 8 | 0.724 | |
| NZ_ALRO01000046_1 | 44558-44586 | 29 | NZ_CP020580 | Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence | 55464-55492 | 8 | 0.724 | |
| NZ_ALRO01000046_1 | 44558-44586 | 29 | NZ_CP020582 | Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence | 16314-16342 | 8 | 0.724 |
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer cgtccaaatttcttagaaaatgaacgcat Protospacer . .*.******** *************
ttgatagatttcttacaaaatgaacgcat CRISPR spacer ttgatagatttcttgcaaaatacgtactt Protospacer **************.******. ...* *
ttgatagatttcttacaaaatgaacgcat CRISPR spacer attttgtttttctttcaaaatgaacgcat Protospacer * *. ****** **************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
ggttatatggtcgatatgattctacaaca CRISPR spacer aaatgcttggtcgatttgattctacaacc Protospacer .. *.. ******** ************
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|