Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALRO01000042 Streptococcus agalactiae STIR-CD-21 ctg7180000002742, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRO01000046 Streptococcus agalactiae STIR-CD-21 ctg7180000002746, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 1 2 0 0
NZ_ALRO01000007 Streptococcus agalactiae STIR-CD-21 ctg7180000002707, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000017 Streptococcus agalactiae STIR-CD-21 ctg7180000002717, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000051 Streptococcus agalactiae STIR-CD-21 ctg7180000002751, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALRO01000002 Streptococcus agalactiae STIR-CD-21 ctg7180000002702, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000018 Streptococcus agalactiae STIR-CD-21 ctg7180000002718, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRO01000015 Streptococcus agalactiae STIR-CD-21 ctg7180000002715, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000019 Streptococcus agalactiae STIR-CD-21 ctg7180000002719, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000052 Streptococcus agalactiae STIR-CD-21 ctg7180000002752, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRO01000040 Streptococcus agalactiae STIR-CD-21 ctg7180000002740, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_ALRO01000012 Streptococcus agalactiae STIR-CD-21 ctg7180000002712, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000010 Streptococcus agalactiae STIR-CD-21 ctg7180000002710, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000035 Streptococcus agalactiae STIR-CD-21 ctg7180000002735, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000030 Streptococcus agalactiae STIR-CD-21 ctg7180000002730, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000006 Streptococcus agalactiae STIR-CD-21 ctg7180000002706, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000049 Streptococcus agalactiae STIR-CD-21 ctg7180000002749, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_ALRO01000028 Streptococcus agalactiae STIR-CD-21 ctg7180000002728, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000041 Streptococcus agalactiae STIR-CD-21 ctg7180000002741, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000031 Streptococcus agalactiae STIR-CD-21 ctg7180000002731, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALRO01000036 Streptococcus agalactiae STIR-CD-21 ctg7180000002736, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRO01000020 Streptococcus agalactiae STIR-CD-21 ctg7180000002720, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000011 Streptococcus agalactiae STIR-CD-21 ctg7180000002711, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000001 Streptococcus agalactiae STIR-CD-21 ctg7180000002701, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000009 Streptococcus agalactiae STIR-CD-21 ctg7180000002709, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000025 Streptococcus agalactiae STIR-CD-21 ctg7180000002725, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000027 Streptococcus agalactiae STIR-CD-21 ctg7180000002727, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000022 Streptococcus agalactiae STIR-CD-21 ctg7180000002722, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000026 Streptococcus agalactiae STIR-CD-21 ctg7180000002726, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000032 Streptococcus agalactiae STIR-CD-21 ctg7180000002732, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000047 Streptococcus agalactiae STIR-CD-21 ctg7180000002747, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_ALRO01000005 Streptococcus agalactiae STIR-CD-21 ctg7180000002705, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000008 Streptococcus agalactiae STIR-CD-21 ctg7180000002708, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000021 Streptococcus agalactiae STIR-CD-21 ctg7180000002721, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000048 Streptococcus agalactiae STIR-CD-21 ctg7180000002748, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRO01000016 Streptococcus agalactiae STIR-CD-21 ctg7180000002716, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000003 Streptococcus agalactiae STIR-CD-21 ctg7180000002703, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000004 Streptococcus agalactiae STIR-CD-21 ctg7180000002704, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000045 Streptococcus agalactiae STIR-CD-21 ctg7180000002745, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000029 Streptococcus agalactiae STIR-CD-21 ctg7180000002729, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000053 Streptococcus agalactiae STIR-CD-21 ctg7180000002753, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000024 Streptococcus agalactiae STIR-CD-21 ctg7180000002724, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRO01000023 Streptococcus agalactiae STIR-CD-21 ctg7180000002723, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000037 Streptococcus agalactiae STIR-CD-21 ctg7180000002737, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000050 Streptococcus agalactiae STIR-CD-21 ctg7180000002750, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000034 Streptococcus agalactiae STIR-CD-21 ctg7180000002734, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000043 Streptococcus agalactiae STIR-CD-21 ctg7180000002743, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALRO01000033 Streptococcus agalactiae STIR-CD-21 ctg7180000002733, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000014 Streptococcus agalactiae STIR-CD-21 ctg7180000002714, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000039 Streptococcus agalactiae STIR-CD-21 ctg7180000002739, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALRO01000013 Streptococcus agalactiae STIR-CD-21 ctg7180000002713, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALRO01000044 Streptococcus agalactiae STIR-CD-21 ctg7180000002744, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALRO01000038 Streptococcus agalactiae STIR-CD-21 ctg7180000002738, whole genome shotgun sequence 0 crisprs NA 0 0 2 0

Results visualization

1. NZ_ALRO01000018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1622 : 10112 12 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALRO01000049
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRO01000049_1 1668-1783 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALRO01000048
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4924 : 45545 39 Streptococcus_phage(100.0%) terminase,head,capsid,tail,portal,protease,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ALRO01000046
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALRO01000046_1 44455-44756 TypeII II-A
4 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ALRO01000046_1 1.3|44624|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder 44624-44652 29 NZ_ALRO01000042.1 105339-105367 0 1.0

1. spacer 1.3|44624|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder matches to position: 105339-105367, mismatch: 0, identity: 1.0

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
ttgatagatttcttacaaaatgaacgcat	Protospacer
*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALRO01000046_1 1.3|44624|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder 44624-44652 29 MK308676 Vibrio phage vB_VmeM-Yong MS31, complete genome 172843-172871 7 0.759
NZ_ALRO01000046_1 1.3|44624|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder 44624-44652 29 MK308675 Vibrio phage vB_VmeM-Yong XC32, complete genome 172842-172870 7 0.759
NZ_ALRO01000046_1 1.3|44624|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder 44624-44652 29 MK308677 Vibrio phage vB_VmeM-Yong MS32, complete genome 172843-172871 7 0.759
NZ_ALRO01000046_1 1.3|44624|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder 44624-44652 29 MK308674 Vibrio phage vB_VmeM-Yong XC31, complete genome 172842-172870 7 0.759
NZ_ALRO01000046_1 1.3|44624|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder 44624-44652 29 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 429648-429676 7 0.759
NZ_ALRO01000046_1 1.3|44624|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder 44624-44652 29 MN855763 Myoviridae sp. isolate 210, complete genome 13489-13517 7 0.759
NZ_ALRO01000046_1 1.2|44558|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder 44558-44586 29 NZ_CP017657 Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence 56273-56301 8 0.724
NZ_ALRO01000046_1 1.2|44558|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder 44558-44586 29 NZ_CP017649 Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence 58336-58364 8 0.724
NZ_ALRO01000046_1 1.2|44558|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder 44558-44586 29 NZ_CP050915 Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence 22391-22419 8 0.724
NZ_ALRO01000046_1 1.2|44558|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder 44558-44586 29 NZ_CP020580 Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence 55464-55492 8 0.724
NZ_ALRO01000046_1 1.2|44558|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder 44558-44586 29 NZ_CP020582 Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence 16314-16342 8 0.724

1. spacer 1.3|44624|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder matches to MK308676 (Vibrio phage vB_VmeM-Yong MS31, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

2. spacer 1.3|44624|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder matches to MK308675 (Vibrio phage vB_VmeM-Yong XC32, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

3. spacer 1.3|44624|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder matches to MK308677 (Vibrio phage vB_VmeM-Yong MS32, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

4. spacer 1.3|44624|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder matches to MK308674 (Vibrio phage vB_VmeM-Yong XC31, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
cgtccaaatttcttagaaaatgaacgcat	Protospacer
.   .*.******** *************

5. spacer 1.3|44624|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
ttgatagatttcttgcaaaatacgtactt	Protospacer
**************.******. ...* *

6. spacer 1.3|44624|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder matches to MN855763 (Myoviridae sp. isolate 210, complete genome) position: , mismatch: 7, identity: 0.759

ttgatagatttcttacaaaatgaacgcat	CRISPR spacer
attttgtttttctttcaaaatgaacgcat	Protospacer
 *  *.  ****** **************

7. spacer 1.2|44558|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017657 (Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

8. spacer 1.2|44558|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017649 (Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

9. spacer 1.2|44558|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050915 (Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

10. spacer 1.2|44558|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020580 (Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

11. spacer 1.2|44558|29|NZ_ALRO01000046|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020582 (Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence) position: , mismatch: 8, identity: 0.724

ggttatatggtcgatatgattctacaaca	CRISPR spacer
aaatgcttggtcgatttgattctacaacc	Protospacer
.. *.. ******** ************ 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALRO01000024
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 115467 : 123549 8 Staphylococcus_phage(50.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALRO01000038
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 30298 : 45914 22 Streptococcus_phage(61.54%) integrase attL 29442:29461|attR 43317:43336
DBSCAN-SWA_2 54215 : 61419 8 uncultured_Caudovirales_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALRO01000052
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13570 : 22558 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ALRO01000044
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALRO01000044.1|WP_000384271.1|17127_17454_-|hypothetical-protein 17127_17454_- 108 aa aa AcrIIA21 NA NA No NA
9. NZ_ALRO01000042
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_ALRO01000043
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 73248 : 83521 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_ALRO01000036
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8769 : 20834 8 Microbacterium_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage