Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALQY01000050 Streptococcus agalactiae LMG 15092 ctg120000785211, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000057 Streptococcus agalactiae LMG 15092 ctg120000785218, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000036 Streptococcus agalactiae LMG 15092 ctg120000785197, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000022 Streptococcus agalactiae LMG 15092 ctg120000785183, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000059 Streptococcus agalactiae LMG 15092 ctg120000785220, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000063 Streptococcus agalactiae LMG 15092 ctg120000785224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000008 Streptococcus agalactiae LMG 15092 ctg120000785169, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000058 Streptococcus agalactiae LMG 15092 ctg120000785219, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000079 Streptococcus agalactiae LMG 15092 ctg120000785240, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALQY01000017 Streptococcus agalactiae LMG 15092 ctg120000785178, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000005 Streptococcus agalactiae LMG 15092 ctg120000785166, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_ALQY01000069 Streptococcus agalactiae LMG 15092 ctg120000785230, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALQY01000025 Streptococcus agalactiae LMG 15092 ctg120000785186, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000070 Streptococcus agalactiae LMG 15092 ctg120000785231, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALQY01000020 Streptococcus agalactiae LMG 15092 ctg120000785181, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000043 Streptococcus agalactiae LMG 15092 ctg120000785204, whole genome shotgun sequence 1 crisprs NA 0 1 0 0
NZ_ALQY01000016 Streptococcus agalactiae LMG 15092 ctg120000785177, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000034 Streptococcus agalactiae LMG 15092 ctg120000785195, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000014 Streptococcus agalactiae LMG 15092 ctg120000785175, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000035 Streptococcus agalactiae LMG 15092 ctg120000785196, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000033 Streptococcus agalactiae LMG 15092 ctg120000785194, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000027 Streptococcus agalactiae LMG 15092 ctg120000785188, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000045 Streptococcus agalactiae LMG 15092 ctg120000785206, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_ALQY01000011 Streptococcus agalactiae LMG 15092 ctg120000785172, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000023 Streptococcus agalactiae LMG 15092 ctg120000785184, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000037 Streptococcus agalactiae LMG 15092 ctg120000785198, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000041 Streptococcus agalactiae LMG 15092 ctg120000785202, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000075 Streptococcus agalactiae LMG 15092 ctg120000785236, whole genome shotgun sequence 0 crisprs csm6 0 0 0 0
NZ_ALQY01000040 Streptococcus agalactiae LMG 15092 ctg120000785201, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000055 Streptococcus agalactiae LMG 15092 ctg120000785216, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALQY01000048 Streptococcus agalactiae LMG 15092 ctg120000785209, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000071 Streptococcus agalactiae LMG 15092 ctg120000785232, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000080 Streptococcus agalactiae LMG 15092 ctg120000785241, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000029 Streptococcus agalactiae LMG 15092 ctg120000785190, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000054 Streptococcus agalactiae LMG 15092 ctg120000785215, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000028 Streptococcus agalactiae LMG 15092 ctg120000785189, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000049 Streptococcus agalactiae LMG 15092 ctg120000785210, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALQY01000064 Streptococcus agalactiae LMG 15092 ctg120000785225, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALQY01000030 Streptococcus agalactiae LMG 15092 ctg120000785191, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000072 Streptococcus agalactiae LMG 15092 ctg120000785233, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000076 Streptococcus agalactiae LMG 15092 ctg120000785237, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000067 Streptococcus agalactiae LMG 15092 ctg120000785228, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000051 Streptococcus agalactiae LMG 15092 ctg120000785212, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000021 Streptococcus agalactiae LMG 15092 ctg120000785182, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000003 Streptococcus agalactiae LMG 15092 ctg120000785164, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000044 Streptococcus agalactiae LMG 15092 ctg120000785205, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000078 Streptococcus agalactiae LMG 15092 ctg120000785239, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALQY01000060 Streptococcus agalactiae LMG 15092 ctg120000785221, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000031 Streptococcus agalactiae LMG 15092 ctg120000785192, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_ALQY01000019 Streptococcus agalactiae LMG 15092 ctg120000785180, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000001 Streptococcus agalactiae LMG 15092 ctg120000785162, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000061 Streptococcus agalactiae LMG 15092 ctg120000785222, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000012 Streptococcus agalactiae LMG 15092 ctg120000785173, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000018 Streptococcus agalactiae LMG 15092 ctg120000785179, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000052 Streptococcus agalactiae LMG 15092 ctg120000785213, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALQY01000002 Streptococcus agalactiae LMG 15092 ctg120000785163, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000053 Streptococcus agalactiae LMG 15092 ctg120000785214, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000042 Streptococcus agalactiae LMG 15092 ctg120000785203, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000073 Streptococcus agalactiae LMG 15092 ctg120000785234, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000004 Streptococcus agalactiae LMG 15092 ctg120000785165, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000068 Streptococcus agalactiae LMG 15092 ctg120000785229, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000077 Streptococcus agalactiae LMG 15092 ctg120000785238, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000010 Streptococcus agalactiae LMG 15092 ctg120000785171, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALQY01000007 Streptococcus agalactiae LMG 15092 ctg120000785168, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000066 Streptococcus agalactiae LMG 15092 ctg120000785227, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1 0 11 0 0
NZ_ALQY01000074 Streptococcus agalactiae LMG 15092 ctg120000785235, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALQY01000032 Streptococcus agalactiae LMG 15092 ctg120000785193, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000065 Streptococcus agalactiae LMG 15092 ctg120000785226, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000062 Streptococcus agalactiae LMG 15092 ctg120000785223, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000024 Streptococcus agalactiae LMG 15092 ctg120000785185, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000056 Streptococcus agalactiae LMG 15092 ctg120000785217, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_ALQY01000046 Streptococcus agalactiae LMG 15092 ctg120000785207, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000039 Streptococcus agalactiae LMG 15092 ctg120000785200, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000009 Streptococcus agalactiae LMG 15092 ctg120000785170, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000013 Streptococcus agalactiae LMG 15092 ctg120000785174, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000015 Streptococcus agalactiae LMG 15092 ctg120000785176, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000038 Streptococcus agalactiae LMG 15092 ctg120000785199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000047 Streptococcus agalactiae LMG 15092 ctg120000785208, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_ALQY01000006 Streptococcus agalactiae LMG 15092 ctg120000785167, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALQY01000026 Streptococcus agalactiae LMG 15092 ctg120000785187, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ALQY01000064
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 566 : 9760 19 Streptococcus_phage(86.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALQY01000069
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15497 : 25770 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALQY01000066
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALQY01000066_1 12699-13460 TypeII-A II-A
11 spacers
csn2,cas2,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALQY01000066_1 1.6|13065|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13065-13094 30 MK448965 Streptococcus phage Javan506, complete genome 7621-7650 1 0.967
NZ_ALQY01000066_1 1.6|13065|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13065-13094 30 MK448959 Streptococcus phage Javan488, complete genome 7621-7650 1 0.967
NZ_ALQY01000066_1 1.6|13065|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13065-13094 30 MK448949 Streptococcus phage Javan460, complete genome 7621-7650 1 0.967
NZ_ALQY01000066_1 1.6|13065|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13065-13094 30 MK448676 Streptococcus phage Javan131, complete genome 9133-9162 1 0.967
NZ_ALQY01000066_1 1.5|12999|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 12999-13028 30 MK448729 Streptococcus phage Javan31, complete genome 8801-8830 2 0.933
NZ_ALQY01000066_1 1.5|12999|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 12999-13028 30 MK448691 Streptococcus phage Javan17, complete genome 8801-8830 2 0.933
NZ_ALQY01000066_1 1.5|12999|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 12999-13028 30 MK448948 Streptococcus phage Javan46, complete genome 8801-8830 2 0.933
NZ_ALQY01000066_1 1.5|12999|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 12999-13028 30 MK448768 Streptococcus phage Javan47, complete genome 9946-9975 2 0.933
NZ_ALQY01000066_1 1.10|13329|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13329-13358 30 MK448925 Streptococcus phage Javan386, complete genome 12569-12598 3 0.9
NZ_ALQY01000066_1 1.13|12822|26|NZ_ALQY01000066|PILER-CR 12822-12847 26 NZ_CP015352 Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence 15244-15269 4 0.846
NZ_ALQY01000066_1 1.13|12822|26|NZ_ALQY01000066|PILER-CR 12822-12847 26 MH491968 Escherichia phage LL5, complete genome 49605-49630 4 0.846
NZ_ALQY01000066_1 1.5|12999|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 12999-13028 30 MK448822 Streptococcus phage Javan629, complete genome 7026-7055 5 0.833
NZ_ALQY01000066_1 1.2|12801|30|NZ_ALQY01000066|CRT,CRISPRCasFinder 12801-12830 30 NZ_CP015352 Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence 15243-15272 6 0.8
NZ_ALQY01000066_1 1.6|13065|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13065-13094 30 MK448738 Streptococcus phage Javan355, complete genome 10242-10271 6 0.8
NZ_ALQY01000066_1 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13263-13292 30 MT188223 Acinetobacter phage vB_AbaM_D22, complete genome 51368-51397 6 0.8
NZ_ALQY01000066_1 1.2|12801|30|NZ_ALQY01000066|CRT,CRISPRCasFinder 12801-12830 30 MH491968 Escherichia phage LL5, complete genome 49602-49631 7 0.767
NZ_ALQY01000066_1 1.3|12867|30|NZ_ALQY01000066|CRT,CRISPRCasFinder 12867-12896 30 NZ_CP032532 Bacillus megaterium NCT-2 plasmid pNCT2_4, complete sequence 43049-43078 7 0.767
NZ_ALQY01000066_1 1.4|12933|30|NZ_ALQY01000066|CRT,CRISPRCasFinder 12933-12962 30 NZ_CP015165 Acetobacter ascendens strain LMG 1590 plasmid unnamed1, complete sequence 23900-23929 7 0.767
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_LS450957 Chlamydia abortus strain 15-49d3 plasmid II 6487-6516 7 0.767
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_LS450959 Chlamydia abortus strain 15-70d24 plasmid II 162-191 7 0.767
NZ_ALQY01000066_1 1.8|13197|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13197-13226 30 KY653116 Staphylococcus phage IME1318_01, complete genome 39586-39615 7 0.767
NZ_ALQY01000066_1 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13263-13292 30 NZ_AP014820 Geminocystis sp. NIES-3708 plasmid pGM05, complete sequence 4072-4101 7 0.767
NZ_ALQY01000066_1 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13263-13292 30 NC_011887 Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence 10603-10632 7 0.767
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_CP051210 Acinetobacter sp. NEB149 plasmid pMsp65, complete sequence 61277-61306 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_CP041047 Citrobacter sp. CF971 plasmid pBM527-1, complete sequence 2073-2102 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_CP024317 Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-lp72, complete sequence 61291-61320 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_CP024391 Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp72, complete sequence 12230-12259 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_CP035634 Enterobacter cloacae strain EN3600 plasmid unnamed2, complete sequence 104354-104383 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_CP024206 Borrelia miyamotoi strain Izh-5 plasmid pIzh5-lp72, complete sequence 61297-61326 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_CP024334 Borrelia miyamotoi strain Yekat-1 plasmid pYkt1-lp72, complete sequence 12242-12271 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_CP022359 Shewanella bicestrii strain JAB-1 plasmid pSHE-CTX-M, complete sequence 99042-99071 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_CP033130 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA23_010062, complete sequence 297834-297863 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_CP040888 Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_1, complete sequence 301785-301814 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NC_008573 Shewanella sp. ANA-3 plasmid unnamed1, complete sequence 224374-224403 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_CP010351 Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence 227868-227897 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_CP024352 Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp72, complete sequence 61307-61336 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 CP052287 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence 24188-24217 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_CP021873 Borrelia miyamotoi strain CA17-2241 plasmid lp72, complete sequence 60899-60928 8 0.733
NZ_ALQY01000066_1 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13131-13160 30 NZ_CP024372 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-lp72, complete sequence 61285-61314 8 0.733
NZ_ALQY01000066_1 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13263-13292 30 NZ_CP050419 Acinetobacter baumannii strain PM193665 plasmid pPM193665_4, complete sequence 5602-5631 8 0.733
NZ_ALQY01000066_1 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13263-13292 30 NZ_CP050429 Acinetobacter baumannii strain PM194188 plasmid pPM194122_4, complete sequence 5602-5631 8 0.733
NZ_ALQY01000066_1 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13263-13292 30 NZ_CP050387 Acinetobacter baumannii strain VB82 plasmid pVB82_2, complete sequence 5602-5631 8 0.733
NZ_ALQY01000066_1 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13263-13292 30 NZ_CP012955 Acinetobacter baumannii strain D36 plasmid pD36-3 clone GC1, complete sequence 7473-7502 8 0.733
NZ_ALQY01000066_1 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13263-13292 30 NZ_CP040260 Acinetobacter baumannii strain P7774 plasmid unnamed1, complete sequence 140590-140619 8 0.733
NZ_ALQY01000066_1 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13263-13292 30 NZ_CP014857 Lysinibacillus sphaericus III(3)7 plasmid, complete sequence 154310-154339 8 0.733
NZ_ALQY01000066_1 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13263-13292 30 NC_010381 Lysinibacillus sphaericus C3-41 plasmid pBsph, complete sequence 20295-20324 8 0.733
NZ_ALQY01000066_1 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13263-13292 30 MT075580 Lysinibacillus sphaericus strain SSII-1 plasmid pSSII-1, complete sequence 69734-69763 8 0.733
NZ_ALQY01000066_1 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13263-13292 30 NZ_CP014644 Lysinibacillus sphaericus strain OT4b.25 plasmid unnamed, complete sequence 102656-102685 8 0.733
NZ_ALQY01000066_1 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13263-13292 30 MT254578 Bacillus phage Izhevsk, complete genome 126680-126709 8 0.733
NZ_ALQY01000066_1 1.11|13395|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13395-13424 30 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1408323-1408352 8 0.733
NZ_ALQY01000066_1 1.4|12933|30|NZ_ALQY01000066|CRT,CRISPRCasFinder 12933-12962 30 MG945605 UNVERIFIED: Microviridae sp. isolate 4475-1711, complete genome 5075-5104 9 0.7
NZ_ALQY01000066_1 1.4|12933|30|NZ_ALQY01000066|CRT,CRISPRCasFinder 12933-12962 30 NC_012854 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence 20840-20869 9 0.7
NZ_ALQY01000066_1 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR 13263-13292 30 MG945191 UNVERIFIED: Microviridae sp. isolate 696-1711, complete genome 1746-1775 9 0.7
NZ_ALQY01000066_1 1.3|12867|30|NZ_ALQY01000066|CRT,CRISPRCasFinder 12867-12896 30 LC425518 Uncultured phage DNA, contig: NODE577 14282-14311 10 0.667

1. spacer 1.6|13065|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MK448965 (Streptococcus phage Javan506, complete genome) position: , mismatch: 1, identity: 0.967

cttaaaatgaattggaataccgtcatcgga	CRISPR spacer
cttaaaatgaactggaataccgtcatcgga	Protospacer
***********.******************

2. spacer 1.6|13065|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MK448959 (Streptococcus phage Javan488, complete genome) position: , mismatch: 1, identity: 0.967

cttaaaatgaattggaataccgtcatcgga	CRISPR spacer
cttaaaatgaactggaataccgtcatcgga	Protospacer
***********.******************

3. spacer 1.6|13065|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MK448949 (Streptococcus phage Javan460, complete genome) position: , mismatch: 1, identity: 0.967

cttaaaatgaattggaataccgtcatcgga	CRISPR spacer
cttaaaatgaactggaataccgtcatcgga	Protospacer
***********.******************

4. spacer 1.6|13065|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MK448676 (Streptococcus phage Javan131, complete genome) position: , mismatch: 1, identity: 0.967

cttaaaatgaattggaataccgtcatcgga	CRISPR spacer
cttaaaatgaactggaataccgtcatcgga	Protospacer
***********.******************

5. spacer 1.5|12999|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 2, identity: 0.933

agaaaaagcaaggtcagcagtgcaacaaga	CRISPR spacer
agaagaggcaaggtcagcagtgcaacaaga	Protospacer
****.*.***********************

6. spacer 1.5|12999|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 2, identity: 0.933

agaaaaagcaaggtcagcagtgcaacaaga	CRISPR spacer
agaagaggcaaggtcagcagtgcaacaaga	Protospacer
****.*.***********************

7. spacer 1.5|12999|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 2, identity: 0.933

agaaaaagcaaggtcagcagtgcaacaaga	CRISPR spacer
agaagaggcaaggtcagcagtgcaacaaga	Protospacer
****.*.***********************

8. spacer 1.5|12999|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 2, identity: 0.933

agaaaaagcaaggtcagcagtgcaacaaga	CRISPR spacer
agaagaggcaaggtcagcagtgcaacaaga	Protospacer
****.*.***********************

9. spacer 1.10|13329|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MK448925 (Streptococcus phage Javan386, complete genome) position: , mismatch: 3, identity: 0.9

tcccctgatgtgcacatatgcttgtgtctg	CRISPR spacer
ccctctgatatgcacatatgcttgtgtctg	Protospacer
.**.*****.********************

10. spacer 1.13|12822|26|NZ_ALQY01000066|PILER-CR matches to NZ_CP015352 (Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence) position: , mismatch: 4, identity: 0.846

caaaatatcacacataaatcatcctc	CRISPR spacer
caaaataacacacataattcatcacc	Protospacer
******* ********* ***** .*

11. spacer 1.13|12822|26|NZ_ALQY01000066|PILER-CR matches to MH491968 (Escherichia phage LL5, complete genome) position: , mismatch: 4, identity: 0.846

caaaatatcacacataaatcatcctc	CRISPR spacer
caaaatctcacacatcaatcatcacc	Protospacer
****** ******** ******* .*

12. spacer 1.5|12999|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MK448822 (Streptococcus phage Javan629, complete genome) position: , mismatch: 5, identity: 0.833

agaaaaagcaaggtcagcagtgcaacaaga	CRISPR spacer
gttagaggcaaggtcagcagtgcaacaaga	Protospacer
.  *.*.***********************

13. spacer 1.2|12801|30|NZ_ALQY01000066|CRT,CRISPRCasFinder matches to NZ_CP015352 (Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence) position: , mismatch: 6, identity: 0.8

tcaaaatatcacacataaatcatcctcctt	CRISPR spacer
acaaaataacacacataattcatcaccatt	Protospacer
 ******* ********* ***** .* **

14. spacer 1.6|13065|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MK448738 (Streptococcus phage Javan355, complete genome) position: , mismatch: 6, identity: 0.8

cttaaaatgaattggaataccgtcatcgga	CRISPR spacer
cttcgcatgaactggaataccatcatcggt	Protospacer
*** . *****.*********.******* 

15. spacer 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MT188223 (Acinetobacter phage vB_AbaM_D22, complete genome) position: , mismatch: 6, identity: 0.8

gagctttctcaactaaatcatcaaatgagt	CRISPR spacer
gagctttctcaagtaaatcagcagttgcat	Protospacer
************ ******* **. ** .*

16. spacer 1.2|12801|30|NZ_ALQY01000066|CRT,CRISPRCasFinder matches to MH491968 (Escherichia phage LL5, complete genome) position: , mismatch: 7, identity: 0.767

tcaaaatatcacacataaatcatcctcctt	CRISPR spacer
acaaaatctcacacatcaatcatcacccga	Protospacer
 ****** ******** ******* .**  

17. spacer 1.3|12867|30|NZ_ALQY01000066|CRT,CRISPRCasFinder matches to NZ_CP032532 (Bacillus megaterium NCT-2 plasmid pNCT2_4, complete sequence) position: , mismatch: 7, identity: 0.767

gctcttaaattaacagatgactctgaatca	CRISPR spacer
agaattaaataaacagatgactgtgaatcg	Protospacer
.   ****** *********** ******.

18. spacer 1.4|12933|30|NZ_ALQY01000066|CRT,CRISPRCasFinder matches to NZ_CP015165 (Acetobacter ascendens strain LMG 1590 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

atatggtg-gctttttcattgctcaaaaccg	CRISPR spacer
-tgggacgagctttttcattgctcaagaccc	Protospacer
 *. *..* *****************.*** 

19. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LS450957 (Chlamydia abortus strain 15-49d3 plasmid II) position: , mismatch: 7, identity: 0.767

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
ttctcggtttgcaaaagataaaagaattct	Protospacer
****** ************ ***. * ..*

20. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LS450959 (Chlamydia abortus strain 15-70d24 plasmid II) position: , mismatch: 7, identity: 0.767

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
ttctcggtttgcaaaagataaaagaattct	Protospacer
****** ************ ***. * ..*

21. spacer 1.8|13197|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to KY653116 (Staphylococcus phage IME1318_01, complete genome) position: , mismatch: 7, identity: 0.767

tcaaatgtgaacatgcctgatgatacacct	CRISPR spacer
tcaaatgggaacattcctgatgatgtgatt	Protospacer
******* ****** *********... .*

22. spacer 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP014820 (Geminocystis sp. NIES-3708 plasmid pGM05, complete sequence) position: , mismatch: 7, identity: 0.767

gagctttctcaactaaatcatcaaatgagt	CRISPR spacer
catttttcttaactaaatcatcaaatattt	Protospacer
 * .*****.****************.  *

23. spacer 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 7, identity: 0.767

gagctttctcaactaaatcatcaaatgagt	CRISPR spacer
gataggtctcaactaaaacatcaaatgacc	Protospacer
**    *********** ********** .

24. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP051210 (Acinetobacter sp. NEB149 plasmid pMsp65, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
agctcgctttgaaaaagatcaaaagtagag	Protospacer
  ********* ************  *   

25. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP041047 (Citrobacter sp. CF971 plasmid pBM527-1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
ccatccctttgaaaaagatcaaaatatcgc	Protospacer
.. ** ***** ************** * .

26. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024317 (Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-lp72, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
tgccaagtttgcaaaagatcaaaatgacaa	Protospacer
* *. . ******************.**  

27. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024391 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp72, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
tgccaagtttgcaaaagatcaaaatgacaa	Protospacer
* *. . ******************.**  

28. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP035634 (Enterobacter cloacae strain EN3600 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
ccatccctttgaaaaagatcaaaatatcgc	Protospacer
.. ** ***** ************** * .

29. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024206 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-lp72, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
tgccaagtttgcaaaagatcaaaatgacaa	Protospacer
* *. . ******************.**  

30. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024334 (Borrelia miyamotoi strain Yekat-1 plasmid pYkt1-lp72, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
tgccaagtttgcaaaagatcaaaatgacaa	Protospacer
* *. . ******************.**  

31. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022359 (Shewanella bicestrii strain JAB-1 plasmid pSHE-CTX-M, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
ccatccctttgaaaaagatcaaaatatcgc	Protospacer
.. ** ***** ************** * .

32. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP033130 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA23_010062, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
caatccctttgaaaaagatcaaaatatcgc	Protospacer
.  ** ***** ************** * .

33. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP040888 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
ccatccctttgaaaaagatcaaaatatcgc	Protospacer
.. ** ***** ************** * .

34. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NC_008573 (Shewanella sp. ANA-3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
ccatccctttgaaaaagatcaaaatatcgc	Protospacer
.. ** ***** ************** * .

35. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP010351 (Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
caatccctttgaaaaagatcaaaatatcgc	Protospacer
.  ** ***** ************** * .

36. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024352 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp72, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
tgccaagtttgcaaaagatcaaaatgacaa	Protospacer
* *. . ******************.**  

37. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
ccatccctttgaaaaagatcaaaatatcgc	Protospacer
.. ** ***** ************** * .

38. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021873 (Borrelia miyamotoi strain CA17-2241 plasmid lp72, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
tgccaagtttgcaaaagatcaaaatgacaa	Protospacer
* *. . ******************.**  

39. spacer 1.7|13131|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024372 (Borrelia miyamotoi strain Izh-14 plasmid pIzh14-lp72, complete sequence) position: , mismatch: 8, identity: 0.733

ttctcgctttgcaaaagatcaaaataactt	CRISPR spacer
tgccaagtttgcaaaagatcaaaatgacaa	Protospacer
* *. . ******************.**  

40. spacer 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP050419 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_4, complete sequence) position: , mismatch: 8, identity: 0.733

gagctttctcaactaaatcatcaaatgagt	CRISPR spacer
agcctttcgcaactaaatcatccaatgttc	Protospacer
.. ***** ************* ****  .

41. spacer 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP050429 (Acinetobacter baumannii strain PM194188 plasmid pPM194122_4, complete sequence) position: , mismatch: 8, identity: 0.733

gagctttctcaactaaatcatcaaatgagt	CRISPR spacer
agcctttcgcaactaaatcatccaatgttc	Protospacer
.. ***** ************* ****  .

42. spacer 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP050387 (Acinetobacter baumannii strain VB82 plasmid pVB82_2, complete sequence) position: , mismatch: 8, identity: 0.733

gagctttctcaactaaatcatcaaatgagt	CRISPR spacer
agcctttcgcaactaaatcatccaatgttc	Protospacer
.. ***** ************* ****  .

43. spacer 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP012955 (Acinetobacter baumannii strain D36 plasmid pD36-3 clone GC1, complete sequence) position: , mismatch: 8, identity: 0.733

gagctttctcaactaaatcatcaaatgagt	CRISPR spacer
agcctttcgcaactaaatcatccaatgttc	Protospacer
.. ***** ************* ****  .

44. spacer 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP040260 (Acinetobacter baumannii strain P7774 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

gagctttctcaactaaatcatcaaatgagt	CRISPR spacer
agcctttcgcaactaaatcatccaatgttc	Protospacer
.. ***** ************* ****  .

45. spacer 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP014857 (Lysinibacillus sphaericus III(3)7 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733

gagctttctcaactaaatcatcaaatgagt	CRISPR spacer
tctttttctcatctaaatcaacaaatgctt	Protospacer
   .******* ******** ******  *

46. spacer 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NC_010381 (Lysinibacillus sphaericus C3-41 plasmid pBsph, complete sequence) position: , mismatch: 8, identity: 0.733

gagctttctcaactaaatcatcaaatgagt	CRISPR spacer
tctttttctcatctaaatcaacaaatgctt	Protospacer
   .******* ******** ******  *

47. spacer 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MT075580 (Lysinibacillus sphaericus strain SSII-1 plasmid pSSII-1, complete sequence) position: , mismatch: 8, identity: 0.733

gagctttctcaactaaatcatcaaatgagt	CRISPR spacer
tctttttctcatctaaatcaacaaatgctt	Protospacer
   .******* ******** ******  *

48. spacer 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP014644 (Lysinibacillus sphaericus strain OT4b.25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

gagctttctcaactaaatcatcaaatgagt	CRISPR spacer
tctttttctcatctaaatcaacaaatgctt	Protospacer
   .******* ******** ******  *

49. spacer 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MT254578 (Bacillus phage Izhevsk, complete genome) position: , mismatch: 8, identity: 0.733

gagctttctcaactaaatcatcaaatgagt	CRISPR spacer
agcaatcctaaactaaatcaacaaatgagt	Protospacer
..   *.** ********** *********

50. spacer 1.11|13395|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.733

atttcgttcacttgttctggtgtgagatga	CRISPR spacer
attccgttcacttgttttggtgtttagcca	Protospacer
***.************.******  ... *

51. spacer 1.4|12933|30|NZ_ALQY01000066|CRT,CRISPRCasFinder matches to MG945605 (UNVERIFIED: Microviridae sp. isolate 4475-1711, complete genome) position: , mismatch: 9, identity: 0.7

atatggtggctttttcattgctcaaaaccg	CRISPR spacer
tgttggtggctttttcattgttcaattgta	Protospacer
   *****************.****   ..

52. spacer 1.4|12933|30|NZ_ALQY01000066|CRT,CRISPRCasFinder matches to NC_012854 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence) position: , mismatch: 9, identity: 0.7

atatggtggctttttcattgctcaaaaccg	CRISPR spacer
tttctcgggctttttcattgcgcaaaacgc	Protospacer
 * .   ************** ******  

53. spacer 1.9|13263|30|NZ_ALQY01000066|CRT,CRISPRCasFinder,PILER-CR matches to MG945191 (UNVERIFIED: Microviridae sp. isolate 696-1711, complete genome) position: , mismatch: 9, identity: 0.7

gagctttctcaactaaatcatcaaatgagt	CRISPR spacer
tagctttatcaactaaatcattaatctgtg	Protospacer
 ****** *************.** . .  

54. spacer 1.3|12867|30|NZ_ALQY01000066|CRT,CRISPRCasFinder matches to LC425518 (Uncultured phage DNA, contig: NODE577) position: , mismatch: 10, identity: 0.667

gctcttaaattaacagatgactctgaatca	CRISPR spacer
ataggaaaagtaacagatgactctgaaagt	Protospacer
..    *** *****************   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ALQY01000074
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1445 : 14871 22 Streptococcus_phage(94.74%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALQY01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 20187 : 27361 8 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_2 46444 : 51488 8 Streptococcus_phage(85.71%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALQY01000049
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10139 : 34761 25 Streptococcus_phage(91.3%) head,portal,capsid,holin,protease,tail,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALQY01000043
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALQY01000043_1 43909-44000 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALQY01000043_1 1.1|43941|28|NZ_ALQY01000043|CRISPRCasFinder 43941-43968 28 CP016197 Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-3, complete sequence 59657-59684 7 0.75

1. spacer 1.1|43941|28|NZ_ALQY01000043|CRISPRCasFinder matches to CP016197 (Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-3, complete sequence) position: , mismatch: 7, identity: 0.75

gcgtgaaggatagcttgattcagaaggc	CRISPR spacer
caaagaaggatagcttgattcatatgga	Protospacer
  . ****************** * ** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ALQY01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6748 : 17482 16 Streptococcus_phage(84.62%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ALQY01000079
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALQY01000079.1|WP_000384271.1|6903_7230_-|hypothetical-protein 6903_7230_- 108 aa aa AcrIIA21 NA NA No NA
10. NZ_ALQY01000078
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 770 : 12015 17 Streptococcus_phage(81.25%) tail,portal,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage