Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALUP01000013 Streptococcus agalactiae GB00922 ctg7180000004843, whole genome shotgun sequence 0 crisprs RT,DEDDh 0 0 2 0
NZ_ALUP01000004 Streptococcus agalactiae GB00922 ctg7180000004834, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALUP01000011 Streptococcus agalactiae GB00922 ctg7180000004841, whole genome shotgun sequence 2 crisprs cas9,cas1,cas2,csn2,csm6 0 7 2 0
NZ_ALUP01000017 Streptococcus agalactiae GB00922 ctg7180000004859, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUP01000015 Streptococcus agalactiae GB00922 ctg7180000004845, whole genome shotgun sequence 0 crisprs WYL,DEDDh,RT 0 0 0 0
NZ_ALUP01000002 Streptococcus agalactiae GB00922 ctg7180000004832, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUP01000012 Streptococcus agalactiae GB00922 ctg7180000004842, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUP01000007 Streptococcus agalactiae GB00922 ctg7180000004837, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALUP01000009 Streptococcus agalactiae GB00922 ctg7180000004839, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALUP01000008 Streptococcus agalactiae GB00922 ctg7180000004838, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALUP01000003 Streptococcus agalactiae GB00922 ctg7180000004833, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUP01000006 Streptococcus agalactiae GB00922 ctg7180000004836, whole genome shotgun sequence 0 crisprs cas3 0 0 1 0
NZ_ALUP01000005 Streptococcus agalactiae GB00922 ctg7180000004835, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUP01000001 Streptococcus agalactiae GB00922 ctg7180000004830, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUP01000016 Streptococcus agalactiae GB00922 ctg7180000004847, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUP01000014 Streptococcus agalactiae GB00922 ctg7180000004844, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALUP01000010 Streptococcus agalactiae GB00922 ctg7180000004840, whole genome shotgun sequence 0 crisprs DinG 0 0 1 0

Results visualization

1. NZ_ALUP01000013
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 128505 : 139238 14 Streptococcus_phage(84.62%) NA NA
DBSCAN-SWA_2 315367 : 325639 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALUP01000007
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALUP01000007.1|WP_000384271.1|15440_15767_-|replication-initiator-protein-A 15440_15767_- 108 aa aa AcrIIA21 NA NA No NA
3. NZ_ALUP01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 521 : 47763 75 Streptococcus_phage(67.19%) head,integrase,tail,portal,capsid,terminase,holin attL 25944:25957|attR 45466:45479
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ALUP01000009
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12999 : 20986 7 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALUP01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 87010 : 94214 8 uncultured_Caudovirales_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALUP01000011
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALUP01000011_1 263447-264013 TypeII II-A
8 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALUP01000011_2 477075-477150 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALUP01000011_1 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263483-263512 30 NZ_CP020429 Streptococcus sp. FDAARGOS_192 plasmid unnamed1, complete sequence 95485-95514 0 1.0
NZ_ALUP01000011_1 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263483-263512 30 NC_015876 Streptococcus pseudopneumoniae IS7493 plasmid pDRPIS7493, complete sequence 1739-1768 0 1.0
NZ_ALUP01000011_1 1.7|263882|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263882-263911 30 MK448742 Streptococcus phage Javan37, complete genome 28973-29002 0 1.0
NZ_ALUP01000011_1 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263483-263512 30 NZ_LR135350 Enterococcus faecium isolate E8202 plasmid 7 3783-3812 1 0.967
NZ_ALUP01000011_1 1.7|263882|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263882-263911 30 MK448956 Streptococcus phage Javan48, complete genome 32279-32308 1 0.967
NZ_ALUP01000011_1 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263483-263512 30 NC_010096 Streptococcus agalactiae plasmid pMV158, complete sequence 221-250 2 0.933
NZ_ALUP01000011_1 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263483-263512 30 HG796789 Uncultured bacterium plasmid pRGF00031 2270-2299 2 0.933
NZ_ALUP01000011_1 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263483-263512 30 HG796317 Uncultured bacterium plasmid pRGI00402 1971-2000 2 0.933
NZ_ALUP01000011_1 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263483-263512 30 NC_001380 Streptococcus agalactiae plasmid pLS1, complete sequence 221-250 2 0.933
NZ_ALUP01000011_1 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263750-263779 30 MK448796 Streptococcus phage Javan53, complete genome 36041-36070 2 0.933
NZ_ALUP01000011_1 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263750-263779 30 MK448971 Streptococcus phage Javan52, complete genome 32226-32255 2 0.933
NZ_ALUP01000011_1 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263750-263779 30 MK448829 Streptococcus phage Javan7, complete genome 26921-26950 2 0.933
NZ_ALUP01000011_1 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263750-263779 30 MK448956 Streptococcus phage Javan48, complete genome 30545-30574 2 0.933
NZ_ALUP01000011_1 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263750-263779 30 MH853355 Streptococcus phage LF1, complete genome 17778-17807 2 0.933
NZ_ALUP01000011_1 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263750-263779 30 MH853358 Streptococcus phage LF4, complete genome 17778-17807 2 0.933
NZ_ALUP01000011_1 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263816-263845 30 MK448924 Streptococcus phage Javan384, complete genome 7947-7976 2 0.933
NZ_ALUP01000011_1 1.7|263882|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263882-263911 30 MK448796 Streptococcus phage Javan53, complete genome 37775-37804 2 0.933
NZ_ALUP01000011_1 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263750-263779 30 MK448837 Streptococcus phage Javan10, complete genome 25450-25479 3 0.9
NZ_ALUP01000011_1 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263750-263779 30 MK448742 Streptococcus phage Javan37, complete genome 27241-27270 3 0.9
NZ_ALUP01000011_1 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263750-263779 30 MK448851 Streptococcus phage Javan14, complete genome 31180-31209 3 0.9
NZ_ALUP01000011_1 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263816-263845 30 AJ609634 Bacteriophage EJ-1 proviral DNA, complete genome 10413-10442 3 0.9
NZ_ALUP01000011_1 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263816-263845 30 NC_005294 Streptococcus prophage EJ-1, complete genome 10413-10442 3 0.9
NZ_ALUP01000011_1 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263750-263779 30 MK448749 Streptococcus phage Javan39, complete genome 31818-31847 4 0.867
NZ_ALUP01000011_1 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263750-263779 30 MH853356 Streptococcus phage LF2, partial genome 31159-31188 4 0.867
NZ_ALUP01000011_1 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263483-263512 30 NZ_CP053793 Streptococcus canis strain HL_77_1 plasmid pSC77-1, complete sequence 3458-3487 6 0.8
NZ_ALUP01000011_1 1.2|263549|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263549-263578 30 MF161328 Streptococcus phage D4276, complete genome 7824-7853 6 0.8
NZ_ALUP01000011_1 1.2|263549|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263549-263578 30 NZ_CP014203 Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence 102320-102349 7 0.767
NZ_ALUP01000011_1 1.2|263549|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263549-263578 30 NZ_MK275619 Clostridium perfringens strain JXJA17 plasmid p1, complete sequence 29705-29734 7 0.767
NZ_ALUP01000011_1 1.2|263549|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263549-263578 30 MH892353 Streptococcus phage SW2, complete genome 9889-9918 7 0.767
NZ_ALUP01000011_1 1.2|263549|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263549-263578 30 MH973661 Streptococcus phage SW5, complete genome 9747-9776 7 0.767
NZ_ALUP01000011_1 1.3|263615|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263615-263644 30 NZ_CP046163 Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence 1820533-1820562 7 0.767
NZ_ALUP01000011_1 1.3|263615|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263615-263644 30 NZ_CP046066 Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence 156125-156154 7 0.767
NZ_ALUP01000011_1 1.3|263615|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263615-263644 30 NZ_CP045356 Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence 1604685-1604714 7 0.767
NZ_ALUP01000011_1 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263816-263845 30 NZ_CP044019 Acinetobacter indicus strain HY20 plasmid pAI01, complete sequence 64701-64730 7 0.767
NZ_ALUP01000011_1 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263816-263845 30 MN855940 Myoviridae sp. isolate 64, complete genome 2455-2484 7 0.767
NZ_ALUP01000011_1 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263816-263845 30 CAJCJZ010000002 Enterococcus phage vB_EfaS_140 genome assembly, contig: phage140-genome, whole genome shotgun sequence 37602-37631 7 0.767
NZ_ALUP01000011_1 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263816-263845 30 MT119360 Enterococcus phage nattely, complete genome 46883-46912 7 0.767
NZ_ALUP01000011_1 1.8|263948|30|NZ_ALUP01000011|CRISPRCasFinder,CRT 263948-263977 30 MT778840 Rhizobium phage P11VFA, complete genome 28085-28114 7 0.767
NZ_ALUP01000011_1 1.8|263948|30|NZ_ALUP01000011|CRISPRCasFinder,CRT 263948-263977 30 KF614509 Rhizobium phage vB_RleS_L338C, complete genome 63260-63289 7 0.767
NZ_ALUP01000011_1 1.8|263948|30|NZ_ALUP01000011|CRISPRCasFinder,CRT 263948-263977 30 MF417890 Uncultured Caudovirales phage clone 7F_15, partial genome 31755-31784 7 0.767
NZ_ALUP01000011_1 1.8|263948|30|NZ_ALUP01000011|CRISPRCasFinder,CRT 263948-263977 30 MF417953 Uncultured Caudovirales phage clone 7S_15, partial genome 5050-5079 7 0.767
NZ_ALUP01000011_1 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263816-263845 30 MK448665 Streptococcus phage Javan1, complete genome 31865-31894 8 0.733
NZ_ALUP01000011_1 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263816-263845 30 NZ_CP053834 Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence 102759-102788 8 0.733
NZ_ALUP01000011_1 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT 263483-263512 30 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 2414834-2414863 9 0.7

1. spacer 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020429 (Streptococcus sp. FDAARGOS_192 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aagagattcacgccaccgaccgtatcgctg	CRISPR spacer
aagagattcacgccaccgaccgtatcgctg	Protospacer
******************************

2. spacer 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NC_015876 (Streptococcus pseudopneumoniae IS7493 plasmid pDRPIS7493, complete sequence) position: , mismatch: 0, identity: 1.0

aagagattcacgccaccgaccgtatcgctg	CRISPR spacer
aagagattcacgccaccgaccgtatcgctg	Protospacer
******************************

3. spacer 1.7|263882|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 0, identity: 1.0

aaacatccgcaacgggataaataaagctag	CRISPR spacer
aaacatccgcaacgggataaataaagctag	Protospacer
******************************

4. spacer 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR135350 (Enterococcus faecium isolate E8202 plasmid 7) position: , mismatch: 1, identity: 0.967

aagagattcacgccaccgaccgtatcgctg	CRISPR spacer
aagagattcacaccaccgaccgtatcgctg	Protospacer
***********.******************

5. spacer 1.7|263882|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 1, identity: 0.967

aaacatccgcaacgggataaataaagctag	CRISPR spacer
aaacatccgcaacgggataaataaagttag	Protospacer
**************************.***

6. spacer 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NC_010096 (Streptococcus agalactiae plasmid pMV158, complete sequence) position: , mismatch: 2, identity: 0.933

aagagattcacgccaccgaccgtatcgctg	CRISPR spacer
atgagattcacaccaccgaccgtatcgctg	Protospacer
* *********.******************

7. spacer 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to HG796789 (Uncultured bacterium plasmid pRGF00031) position: , mismatch: 2, identity: 0.933

aagagattcacgccaccgaccgtatcgctg	CRISPR spacer
atgagattcacaccaccgaccgtatcgctg	Protospacer
* *********.******************

8. spacer 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to HG796317 (Uncultured bacterium plasmid pRGI00402) position: , mismatch: 2, identity: 0.933

aagagattcacgccaccgaccgtatcgctg	CRISPR spacer
atgagattcacaccaccgaccgtatcgctg	Protospacer
* *********.******************

9. spacer 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NC_001380 (Streptococcus agalactiae plasmid pLS1, complete sequence) position: , mismatch: 2, identity: 0.933

aagagattcacgccaccgaccgtatcgctg	CRISPR spacer
atgagattcacaccaccgaccgtatcgctg	Protospacer
* *********.******************

10. spacer 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 2, identity: 0.933

gctggagattttacaagcagtttgaatttc	CRISPR spacer
gctggagattttacaagcagtttaaattcc	Protospacer
***********************.****.*

11. spacer 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 2, identity: 0.933

gctggagattttacaagcagtttgaatttc	CRISPR spacer
gttggagattttataagcagtttgaatttc	Protospacer
*.***********.****************

12. spacer 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MK448829 (Streptococcus phage Javan7, complete genome) position: , mismatch: 2, identity: 0.933

gctggagattttacaagcagtttgaatttc	CRISPR spacer
gctggagattttacaagcagtttaaattcc	Protospacer
***********************.****.*

13. spacer 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 2, identity: 0.933

gctggagattttacaagcagtttgaatttc	CRISPR spacer
gttggagattttataagcagtttgaatttc	Protospacer
*.***********.****************

14. spacer 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MH853355 (Streptococcus phage LF1, complete genome) position: , mismatch: 2, identity: 0.933

gctggagattttacaagcagtttgaatttc	CRISPR spacer
gctggagattttacaagcagtttaaattcc	Protospacer
***********************.****.*

15. spacer 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MH853358 (Streptococcus phage LF4, complete genome) position: , mismatch: 2, identity: 0.933

gctggagattttacaagcagtttgaatttc	CRISPR spacer
gctggagattttacaagcagtttaaattcc	Protospacer
***********************.****.*

16. spacer 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MK448924 (Streptococcus phage Javan384, complete genome) position: , mismatch: 2, identity: 0.933

aatcacttctgcataaatatcttttacttc	CRISPR spacer
gataacttctgcataaatatcttttacttc	Protospacer
.** **************************

17. spacer 1.7|263882|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 2, identity: 0.933

aaacatccgcaacgggataaataaagctag	CRISPR spacer
gaacatccgcaacggaataaataaagctag	Protospacer
.**************.**************

18. spacer 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 3, identity: 0.9

gctggagattttacaagcagtttgaatttc	CRISPR spacer
gctggagattttataagcagtttaaattcc	Protospacer
*************.*********.****.*

19. spacer 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 3, identity: 0.9

gctggagattttacaagcagtttgaatttc	CRISPR spacer
gctggagattttataagcagtttaaattcc	Protospacer
*************.*********.****.*

20. spacer 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 3, identity: 0.9

gctggagattttacaagcagtttgaatttc	CRISPR spacer
gttggagattttataagcaatttgaatttc	Protospacer
*.***********.*****.**********

21. spacer 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to AJ609634 (Bacteriophage EJ-1 proviral DNA, complete genome) position: , mismatch: 3, identity: 0.9

aatcacttctgcataaatatcttttacttc	CRISPR spacer
gataacttctgcataaatatctttcacttc	Protospacer
.** ********************.*****

22. spacer 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NC_005294 (Streptococcus prophage EJ-1, complete genome) position: , mismatch: 3, identity: 0.9

aatcacttctgcataaatatcttttacttc	CRISPR spacer
gataacttctgcataaatatctttcacttc	Protospacer
.** ********************.*****

23. spacer 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 4, identity: 0.867

gctggagattttacaagcagtttgaatttc	CRISPR spacer
gttggagattttataagcagtttaaattcc	Protospacer
*.***********.*********.****.*

24. spacer 1.5|263750|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 4, identity: 0.867

gctggagattttacaagcagtttgaatttc	CRISPR spacer
gttggagattttataagcagtttaaattcc	Protospacer
*.***********.*********.****.*

25. spacer 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053793 (Streptococcus canis strain HL_77_1 plasmid pSC77-1, complete sequence) position: , mismatch: 6, identity: 0.8

aagagattcacgccaccgaccgtatcgctg	CRISPR spacer
tgaggcttcacaccaccgaccgtatcgctg	Protospacer
 ...* *****.******************

26. spacer 1.2|263549|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MF161328 (Streptococcus phage D4276, complete genome) position: , mismatch: 6, identity: 0.8

ctttatccg-ttttactcattctttttttaa	CRISPR spacer
-tccatttgtttttactccttctttttttaa	Protospacer
 *..**..* ******** ************

27. spacer 1.2|263549|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014203 (Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence) position: , mismatch: 7, identity: 0.767

ctttatccgttttactcattctttttttaa	CRISPR spacer
acttatccattttactcattcttttcattc	Protospacer
 .******.****************. *  

28. spacer 1.2|263549|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK275619 (Clostridium perfringens strain JXJA17 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

ctttatccgttttactcattctttttttaa	CRISPR spacer
ttttatccgatttactcattttttgtattt	Protospacer
.******** **********.*** * *  

29. spacer 1.2|263549|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MH892353 (Streptococcus phage SW2, complete genome) position: , mismatch: 7, identity: 0.767

ctttatccgttttactcattctttttttaa	CRISPR spacer
ccatttgttttttactccttctttttttaa	Protospacer
*. * * . ******** ************

30. spacer 1.2|263549|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MH973661 (Streptococcus phage SW5, complete genome) position: , mismatch: 7, identity: 0.767

ctttatccgttttactcattctttttttaa	CRISPR spacer
ccatttgttttttactccttctttttttaa	Protospacer
*. * * . ******** ************

31. spacer 1.3|263615|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 7, identity: 0.767

gatagaattgttactttggaaggggaactt	CRISPR spacer
tatagaattgtgactttggaagggaacacg	Protospacer
 ********** ************.*  . 

32. spacer 1.3|263615|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 7, identity: 0.767

gatagaattgttactttggaaggggaactt	CRISPR spacer
tatagaattgtgactttggaagggaacacg	Protospacer
 ********** ************.*  . 

33. spacer 1.3|263615|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 7, identity: 0.767

gatagaattgttactttggaaggggaactt	CRISPR spacer
tatagaattgtgactttggaagggaacacg	Protospacer
 ********** ************.*  . 

34. spacer 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044019 (Acinetobacter indicus strain HY20 plasmid pAI01, complete sequence) position: , mismatch: 7, identity: 0.767

aatcacttctgcataaatatcttttacttc	CRISPR spacer
agctacttgtgcataaatatcatttacctg	Protospacer
*...**** ************ *****.* 

35. spacer 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MN855940 (Myoviridae sp. isolate 64, complete genome) position: , mismatch: 7, identity: 0.767

aatcacttctgcataaatatcttttacttc	CRISPR spacer
agcccactctccataaatctcttttacttc	Protospacer
*..*  .*** ******* ***********

36. spacer 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to CAJCJZ010000002 (Enterococcus phage vB_EfaS_140 genome assembly, contig: phage140-genome, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.767

aatcacttctgcataaatatcttttacttc	CRISPR spacer
gactaattgtgcataaatatcttttagttt	Protospacer
.*..* ** ***************** **.

37. spacer 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MT119360 (Enterococcus phage nattely, complete genome) position: , mismatch: 7, identity: 0.767

aatcacttctgcataaatatcttttacttc	CRISPR spacer
tactaattgtgcataaatatcttttagttt	Protospacer
 *..* ** ***************** **.

38. spacer 1.8|263948|30|NZ_ALUP01000011|CRISPRCasFinder,CRT matches to MT778840 (Rhizobium phage P11VFA, complete genome) position: , mismatch: 7, identity: 0.767

agtttcttgtgggttagcttgtccaccata	CRISPR spacer
tcgttcttgtgggtgagcttgtccacgttg	Protospacer
   *********** ***********  *.

39. spacer 1.8|263948|30|NZ_ALUP01000011|CRISPRCasFinder,CRT matches to KF614509 (Rhizobium phage vB_RleS_L338C, complete genome) position: , mismatch: 7, identity: 0.767

agtttcttgtgggttagcttgtccaccata	CRISPR spacer
tcgttcttgtgggtgagcttgtccacgttg	Protospacer
   *********** ***********  *.

40. spacer 1.8|263948|30|NZ_ALUP01000011|CRISPRCasFinder,CRT matches to MF417890 (Uncultured Caudovirales phage clone 7F_15, partial genome) position: , mismatch: 7, identity: 0.767

agtttcttgtgggttagcttgtccaccata	CRISPR spacer
tgcttgttgtggcttagcttgtccactttg	Protospacer
 *.** ****** *************. *.

41. spacer 1.8|263948|30|NZ_ALUP01000011|CRISPRCasFinder,CRT matches to MF417953 (Uncultured Caudovirales phage clone 7S_15, partial genome) position: , mismatch: 7, identity: 0.767

agtttcttgtgggttagcttgtccaccata	CRISPR spacer
tgcttgttgtggcttagcttgtccactttg	Protospacer
 *.** ****** *************. *.

42. spacer 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to MK448665 (Streptococcus phage Javan1, complete genome) position: , mismatch: 8, identity: 0.733

aatcacttctgcataaatatcttttacttc	CRISPR spacer
tgcaggttctgcaaaaataacttttacttc	Protospacer
 .. . ******* ***** **********

43. spacer 1.6|263816|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053834 (Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence) position: , mismatch: 8, identity: 0.733

aatcacttctgcataaatatcttttacttc	CRISPR spacer
tttaacttctgcatcaatatcttttgtata	Protospacer
  * ********** **********.. * 

44. spacer 1.1|263483|30|NZ_ALUP01000011|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.7

aagagattcacgccaccgaccgtatcgctg	CRISPR spacer
cgaactttcacgccaccgatcgtatcgacc	Protospacer
 ..*  *************.******* . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 328990 : 336945 10 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 431589 : 440580 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALUP01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3611 : 9767 11 Streptococcus_phage(57.14%) transposase,integrase attL 504:516|attR 9801:9813
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage