Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALSM01000018 Streptococcus agalactiae GB00003 ctg7180000003141, whole genome shotgun sequence 0 crisprs csa3,cas3 0 0 2 0
NZ_ALSM01000011 Streptococcus agalactiae GB00003 ctg7180000003134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSM01000025 Streptococcus agalactiae GB00003 ctg7180000003148, whole genome shotgun sequence 1 crisprs DinG,cas2,cas1,cas4,cas7,cas8c,cas5,cas3 0 13 1 0
NZ_ALSM01000019 Streptococcus agalactiae GB00003 ctg7180000003142, whole genome shotgun sequence 1 crisprs cas9,cas1,cas2,csn2 0 4 0 0
NZ_ALSM01000008 Streptococcus agalactiae GB00003 ctg7180000003131, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSM01000005 Streptococcus agalactiae GB00003 ctg7180000003128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSM01000007 Streptococcus agalactiae GB00003 ctg7180000003130, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALSM01000015 Streptococcus agalactiae GB00003 ctg7180000003138, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSM01000014 Streptococcus agalactiae GB00003 ctg7180000003137, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALSM01000021 Streptococcus agalactiae GB00003 ctg7180000003144, whole genome shotgun sequence 0 crisprs WYL,DEDDh 0 0 1 0
NZ_ALSM01000009 Streptococcus agalactiae GB00003 ctg7180000003132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSM01000006 Streptococcus agalactiae GB00003 ctg7180000003129, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSM01000017 Streptococcus agalactiae GB00003 ctg7180000003140, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSM01000013 Streptococcus agalactiae GB00003 ctg7180000003136, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSM01000002 Streptococcus agalactiae GB00003 ctg7180000003125, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSM01000024 Streptococcus agalactiae GB00003 ctg7180000003147, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSM01000020 Streptococcus agalactiae GB00003 ctg7180000003143, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALSM01000010 Streptococcus agalactiae GB00003 ctg7180000003133, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALSM01000022 Streptococcus agalactiae GB00003 ctg7180000003145, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALSM01000001 Streptococcus agalactiae GB00003 ctg7180000003124, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSM01000003 Streptococcus agalactiae GB00003 ctg7180000003126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSM01000004 Streptococcus agalactiae GB00003 ctg7180000003127, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSM01000012 Streptococcus agalactiae GB00003 ctg7180000003135, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSM01000016 Streptococcus agalactiae GB00003 ctg7180000003139, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALSM01000023 Streptococcus agalactiae GB00003 ctg7180000003146, whole genome shotgun sequence 0 crisprs csm6 0 0 1 0

Results visualization

1. NZ_ALSM01000018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 66240 : 81916 25 Streptococcus_phage(64.29%) integrase attL 65387:65406|attR 79319:79338
DBSCAN-SWA_2 90236 : 97440 8 uncultured_Caudovirales_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALSM01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 42284 : 54349 8 Gordonia_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALSM01000022
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 212431 : 260043 65 Streptococcus_phage(83.02%) holin,terminase,head,integrase,protease,tail,portal,capsid attL 224288:224301|attR 260576:260589
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ALSM01000016
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 84889 : 95161 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALSM01000025
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALSM01000025_1 106937-107364 TypeI I-C
6 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALSM01000025_1 1.3|107099|35|NZ_ALSM01000025|CRT 107099-107133 35 MK448768 Streptococcus phage Javan47, complete genome 34297-34331 0 1.0
NZ_ALSM01000025_1 1.6|107298|35|NZ_ALSM01000025|CRT 107298-107332 35 MK448796 Streptococcus phage Javan53, complete genome 31059-31093 0 1.0
NZ_ALSM01000025_1 1.8|107099|33|NZ_ALSM01000025|CRISPRCasFinder 107099-107131 33 MK448768 Streptococcus phage Javan47, complete genome 34297-34329 0 1.0
NZ_ALSM01000025_1 1.11|107298|33|NZ_ALSM01000025|CRISPRCasFinder 107298-107330 33 MK448796 Streptococcus phage Javan53, complete genome 31059-31091 0 1.0
NZ_ALSM01000025_1 1.13|107099|34|NZ_ALSM01000025|PILER-CR 107099-107132 34 MK448768 Streptococcus phage Javan47, complete genome 34297-34330 0 1.0
NZ_ALSM01000025_1 1.16|107298|34|NZ_ALSM01000025|PILER-CR 107298-107331 34 MK448796 Streptococcus phage Javan53, complete genome 31059-31092 0 1.0
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_MG205643 Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence 72996-73027 5 0.844
NZ_ALSM01000025_1 1.9|107166|32|NZ_ALSM01000025|CRISPRCasFinder 107166-107197 32 MH622943 Myoviridae sp. isolate ctbc_4, complete genome 180180-180211 5 0.844
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 548430-548461 6 0.812
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP038623 Arsenophonus nasoniae strain FIN plasmid pArsFIN11, complete sequence 39364-39395 6 0.812
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NC_017421 Borreliella burgdorferi N40 plasmid N40_lp38, complete sequence 28345-28376 6 0.812
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NC_001856 Borreliella burgdorferi B31 plasmid lp38, complete sequence 28055-28086 6 0.812
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP019853 Borreliella burgdorferi plasmid lp38, complete sequence 28068-28099 6 0.812
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP019764 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp38, complete sequence 28061-28092 6 0.812
NZ_ALSM01000025_1 1.4|107166|34|NZ_ALSM01000025|CRT 107166-107199 34 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 606095-606128 6 0.824
NZ_ALSM01000025_1 1.9|107166|32|NZ_ALSM01000025|CRISPRCasFinder 107166-107197 32 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 617393-617424 6 0.812
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 484591-484622 7 0.781
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 AP014284 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C63, *** SEQUENCING IN PROGRESS *** 9262-9293 7 0.781
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP014152 Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence 46517-46548 7 0.781
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP006909 Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence 131643-131674 7 0.781
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP013684 Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence 15273-15304 7 0.781
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP013710 Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence 232837-232868 7 0.781
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NC_010379 Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence 25057-25088 7 0.781
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 158727-158758 7 0.781
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP013700 Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence 158558-158589 7 0.781
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NC_025146 Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111 1638-1669 7 0.781
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NC_020380 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-16, complete sequence 13185-13216 7 0.781
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 MH517022 Acinetobacter phage SH-Ab 15599, complete genome 51037-51068 7 0.781
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 MK496784 Capybara microvirus Cap3_SP_414, complete genome 2372-2403 7 0.781
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 U72945 Virus-like particle CAK1 of Clostridium beijerinckii origin of replication region 829-860 7 0.781
NZ_ALSM01000025_1 1.14|107166|33|NZ_ALSM01000025|PILER-CR 107166-107198 33 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 617393-617425 7 0.788
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP029456 Bacillus cereus strain FORC087 plasmid pFORC087.2, complete sequence 61423-61454 8 0.75
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 70696-70727 8 0.75
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 CP016196 Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-2, complete sequence 62259-62290 8 0.75
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP045061 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence 70700-70731 8 0.75
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP045054 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence 70707-70738 8 0.75
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP045058 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence 70706-70737 8 0.75
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 MH830339 Proteus phage Stubb, complete genome 26806-26837 8 0.75
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 MG030347 Proteus phage PM135, complete genome 76557-76588 8 0.75
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 MN935203 UNVERIFIED: Proteus phage VTCCBPA139, partial genome 26007-26038 8 0.75
NZ_ALSM01000025_1 1.2|107033|34|NZ_ALSM01000025|CRT 107033-107066 34 NZ_MH569712 Serratia marcescens strain S120 plasmid pPM120-2, complete sequence 42532-42565 8 0.765
NZ_ALSM01000025_1 1.4|107166|34|NZ_ALSM01000025|CRT 107166-107199 34 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 617393-617426 8 0.765
NZ_ALSM01000025_1 1.4|107166|34|NZ_ALSM01000025|CRT 107166-107199 34 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 378878-378911 8 0.765
NZ_ALSM01000025_1 1.4|107166|34|NZ_ALSM01000025|CRT 107166-107199 34 NC_015901 Lactococcus lactis subsp. lactis bv. diacetylactis plasmid pVF22, complete sequence 18325-18358 8 0.765
NZ_ALSM01000025_1 1.14|107166|33|NZ_ALSM01000025|PILER-CR 107166-107198 33 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 378879-378911 8 0.758
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 93170-93201 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 228972-229003 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_MG205643 Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence 9883-9914 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_AP017932 Lactobacillus sakei strain LK-145 plasmid pLs145-a, complete sequence 5632-5663 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP025208 Lactobacillus sakei strain WiKim0074 plasmid pLSW74_2, complete sequence 12385-12416 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP021933 Lactobacillus plantarum strain TMW 1.1478 plasmid pL11478-1, complete sequence 57054-57085 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP017376 Lactobacillus plantarum strain TMW 1.708 plasmid pL1708-2, complete sequence 17183-17214 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP021472 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-2, complete sequence 18052-18083 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP052067 Lactobacillus paracasei strain 347-16 plasmid unnamed2, complete sequence 1046-1077 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP031209 Lactobacillus brevis strain UCCLB521 plasmid pUCCLB521_A, complete sequence 42073-42104 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP035015 Lactobacillus plantarum strain 12_3 plasmid pldC, complete sequence 24116-24147 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NC_003383 Listeria innocua Clip11262 plasmid pLI100, complete sequence 34563-34594 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP048005 Lactobacillus paracasei strain CACC 566 plasmid p2CACC566, complete sequence 41814-41845 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP046038 Lactobacillus sakei strain CBA3614 plasmid unnamed1, complete sequence 31384-31415 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP017410 Lactobacillus plantarum strain RI-113 plasmid pRI113_4, complete sequence 12201-12232 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NC_016608 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-5, complete sequence 15266-15297 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP029967 Lactobacillus curvatus strain ZJUNIT8 plasmid pnunamed1, complete sequence 42716-42747 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP028336 Lactobacillus plantarum strain SRCM101167 plasmid unnamed2, complete sequence 38185-38216 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP028231 Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence 3683-3714 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP018183 Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-3, complete sequence 17219-17250 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 MH937473 Streptococcus phage CHPC929, complete genome 34811-34842 9 0.719
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NC_010353 Streptococcus phage 858, complete genome 33013-33044 9 0.719
NZ_ALSM01000025_1 1.4|107166|34|NZ_ALSM01000025|CRT 107166-107199 34 NZ_CP013615 Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence 243737-243770 9 0.735
NZ_ALSM01000025_1 1.7|107033|32|NZ_ALSM01000025|CRISPRCasFinder 107033-107064 32 CP029330 Clostridium beijerinckii isolate WB53 plasmid unnamed1 3102-3133 9 0.719
NZ_ALSM01000025_1 1.7|107033|32|NZ_ALSM01000025|CRISPRCasFinder 107033-107064 32 CP029330 Clostridium beijerinckii isolate WB53 plasmid unnamed1 17601-17632 9 0.719
NZ_ALSM01000025_1 1.7|107033|32|NZ_ALSM01000025|CRISPRCasFinder 107033-107064 32 NZ_MH569712 Serratia marcescens strain S120 plasmid pPM120-2, complete sequence 42532-42563 9 0.719
NZ_ALSM01000025_1 1.7|107033|32|NZ_ALSM01000025|CRISPRCasFinder 107033-107064 32 NC_015916 Borreliella bissettii DN127 plasmid lp28-3, complete sequence 15065-15096 9 0.719
NZ_ALSM01000025_1 1.7|107033|32|NZ_ALSM01000025|CRISPRCasFinder 107033-107064 32 NZ_CP015806 Borrelia mayonii strain MN14-1539 plasmid lp28-3 19067-19098 9 0.719
NZ_ALSM01000025_1 1.7|107033|32|NZ_ALSM01000025|CRISPRCasFinder 107033-107064 32 NZ_CP015791 Borrelia mayonii strain MN14-1420 plasmid lp28-3, complete sequence 19067-19098 9 0.719
NZ_ALSM01000025_1 1.7|107033|32|NZ_ALSM01000025|CRISPRCasFinder 107033-107064 32 NZ_CP038639 Cupriavidus oxalaticus strain X32 plasmid unnamed4, complete sequence 357536-357567 9 0.719
NZ_ALSM01000025_1 1.9|107166|32|NZ_ALSM01000025|CRISPRCasFinder 107166-107197 32 NZ_CP013615 Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence 243737-243768 9 0.719
NZ_ALSM01000025_1 1.9|107166|32|NZ_ALSM01000025|CRISPRCasFinder 107166-107197 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 378880-378911 9 0.719
NZ_ALSM01000025_1 1.9|107166|32|NZ_ALSM01000025|CRISPRCasFinder 107166-107197 32 MG945889 UNVERIFIED: Microviridae sp. isolate 1554-1801, partial genome 4926-4957 9 0.719
NZ_ALSM01000025_1 1.11|107298|33|NZ_ALSM01000025|CRISPRCasFinder 107298-107330 33 NZ_CP051683 Mucilaginibacter sp. F39-2 plasmid unnamed1, complete sequence 8254-8286 9 0.727
NZ_ALSM01000025_1 1.12|107033|33|NZ_ALSM01000025|PILER-CR 107033-107065 33 CP029330 Clostridium beijerinckii isolate WB53 plasmid unnamed1 3102-3134 9 0.727
NZ_ALSM01000025_1 1.12|107033|33|NZ_ALSM01000025|PILER-CR 107033-107065 33 CP029330 Clostridium beijerinckii isolate WB53 plasmid unnamed1 17601-17633 9 0.727
NZ_ALSM01000025_1 1.12|107033|33|NZ_ALSM01000025|PILER-CR 107033-107065 33 NZ_MH569712 Serratia marcescens strain S120 plasmid pPM120-2, complete sequence 42532-42564 9 0.727
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP015507 Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence 161310-161341 10 0.688
NZ_ALSM01000025_1 1.2|107033|34|NZ_ALSM01000025|CRT 107033-107066 34 CP029330 Clostridium beijerinckii isolate WB53 plasmid unnamed1 3102-3135 10 0.706
NZ_ALSM01000025_1 1.2|107033|34|NZ_ALSM01000025|CRT 107033-107066 34 CP029330 Clostridium beijerinckii isolate WB53 plasmid unnamed1 17601-17634 10 0.706
NZ_ALSM01000025_1 1.14|107166|33|NZ_ALSM01000025|PILER-CR 107166-107198 33 NZ_CP013615 Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence 243737-243769 10 0.697
NZ_ALSM01000025_1 1.16|107298|34|NZ_ALSM01000025|PILER-CR 107298-107331 34 NZ_CP051683 Mucilaginibacter sp. F39-2 plasmid unnamed1, complete sequence 8253-8286 10 0.706
NZ_ALSM01000025_1 1.1|106969|32|NZ_ALSM01000025|CRT 106969-107000 32 NZ_CP031220 Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence 90370-90401 11 0.656
NZ_ALSM01000025_1 1.4|107166|34|NZ_ALSM01000025|CRT 107166-107199 34 NC_013792 Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence 238853-238886 11 0.676

1. spacer 1.3|107099|35|NZ_ALSM01000025|CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

aaaacggatggttgtatattgcaggctatcagcta	CRISPR spacer
aaaacggatggttgtatattgcaggctatcagcta	Protospacer
***********************************

2. spacer 1.6|107298|35|NZ_ALSM01000025|CRT matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 0, identity: 1.0

gtcttttcagacagaacataaatggaaatatagta	CRISPR spacer
gtcttttcagacagaacataaatggaaatatagta	Protospacer
***********************************

3. spacer 1.8|107099|33|NZ_ALSM01000025|CRISPRCasFinder matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

aaaacggatggttgtatattgcaggctatcagc	CRISPR spacer
aaaacggatggttgtatattgcaggctatcagc	Protospacer
*********************************

4. spacer 1.11|107298|33|NZ_ALSM01000025|CRISPRCasFinder matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 0, identity: 1.0

gtcttttcagacagaacataaatggaaatatag	CRISPR spacer
gtcttttcagacagaacataaatggaaatatag	Protospacer
*********************************

5. spacer 1.13|107099|34|NZ_ALSM01000025|PILER-CR matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

aaaacggatggttgtatattgcaggctatcagct	CRISPR spacer
aaaacggatggttgtatattgcaggctatcagct	Protospacer
**********************************

6. spacer 1.16|107298|34|NZ_ALSM01000025|PILER-CR matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 0, identity: 1.0

gtcttttcagacagaacataaatggaaatatagt	CRISPR spacer
gtcttttcagacagaacataaatggaaatatagt	Protospacer
**********************************

7. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 5, identity: 0.844

ataatgaattaataaaaaaataat-cattatta	CRISPR spacer
ataatgaatttatataaaaataatacagtttt-	Protospacer
********** *** ********* ** * ** 

8. spacer 1.9|107166|32|NZ_ALSM01000025|CRISPRCasFinder matches to MH622943 (Myoviridae sp. isolate ctbc_4, complete genome) position: , mismatch: 5, identity: 0.844

ataattatggtagtctta-tttttaatataaaa	CRISPR spacer
ataattatggttgtattattttttcatataat-	Protospacer
*********** ** *** ***** ******  

9. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aaaatttgctaataaaaaaataatcattaata	Protospacer
* ***  ..******************** **

10. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP038623 (Arsenophonus nasoniae strain FIN plasmid pArsFIN11, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
attatatgttaataactaaataatcattatta	Protospacer
** **. .*******  ***************

11. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NC_017421 (Borreliella burgdorferi N40 plasmid N40_lp38, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatca-ttatta	CRISPR spacer
ataatgaataactaaaaaaataaggaggtatt-	Protospacer
********* * ***********  *  **** 

12. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NC_001856 (Borreliella burgdorferi B31 plasmid lp38, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatca-ttatta	CRISPR spacer
ataatgaataactaaaaaaataaggaggtatt-	Protospacer
********* * ***********  *  **** 

13. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP019853 (Borreliella burgdorferi plasmid lp38, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatca-ttatta	CRISPR spacer
ataatgaataactaaaaaaataaggaggtatt-	Protospacer
********* * ***********  *  **** 

14. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP019764 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp38, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatca-ttatta	CRISPR spacer
ataatgaataactaaaaaaataaggaggtatt-	Protospacer
********* * ***********  *  **** 

15. spacer 1.4|107166|34|NZ_ALSM01000025|CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.824

-ataattatggtagtcttatttttaatataaaata	CRISPR spacer
cattcttat-ttattcttattttcaatataaaata	Protospacer
 **  ****  ** *********.***********

16. spacer 1.9|107166|32|NZ_ALSM01000025|CRISPRCasFinder matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 6, identity: 0.812

ataattatggtagtcttatttttaatataaaa	CRISPR spacer
acaaaaatgttagtcttatgtttaatataaac	Protospacer
*.**  *** ********* *********** 

17. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 7, identity: 0.781

-ataatgaattaataaaaaaataatcattatta	CRISPR spacer
tataa-atattaataaaaaacaaatcattatct	Protospacer
 **** . ************  *********. 

18. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to AP014284 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C63, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
atccagaattaataaaaaaaaaattattagaa	Protospacer
**   *************** ***.****  *

19. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP014152 (Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

20. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP006909 (Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

21. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP013684 (Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaagaaattttatact-	Protospacer
 ******************. ***. * **.* 

22. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP013710 (Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

23. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

24. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

25. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP013700 (Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaagaaattttatact-	Protospacer
 ******************. ***. * **.* 

26. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

27. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NC_020380 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-16, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcattatta--	CRISPR spacer
ataaataattaataaaaaaataa--aacactacg	Protospacer
****  *****************  * .*.**  

28. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to MH517022 (Acinetobacter phage SH-Ab 15599, complete genome) position: , mismatch: 7, identity: 0.781

ataatgaat--taataaaaaaataatcattatta	CRISPR spacer
--gacgtattataatagaaaaataatcactatta	Protospacer
  .*.* **  *****.***********.*****

29. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to MK496784 (Capybara microvirus Cap3_SP_414, complete genome) position: , mismatch: 7, identity: 0.781

ataatg-aattaataaaaaaataatcattatta	CRISPR spacer
-tatcgtaattaataaaaaaatcattattacga	Protospacer
 ** .* *************** **.****. *

30. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to U72945 (Virus-like particle CAK1 of Clostridium beijerinckii origin of replication region) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcattatta-	CRISPR spacer
ttaaacaattaataaaaaaataatt-ttatgga	Protospacer
 ***  ******************. **** . 

31. spacer 1.14|107166|33|NZ_ALSM01000025|PILER-CR matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 7, identity: 0.788

ataattatggtagtcttatttttaatataaaat	CRISPR spacer
acaaaaatgttagtcttatgtttaatataaaca	Protospacer
*.**  *** ********* ***********  

32. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP029456 (Bacillus cereus strain FORC087 plasmid pFORC087.2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataat-cattatta	CRISPR spacer
gaaattaattaatagaaaaataatccaatgct-	Protospacer
. *** ********.********* ** *..* 

33. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaattaatgaaaaaataatattaacaa	Protospacer
 ****.*******.**********  * *. *

34. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to CP016196 (Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaactaataaaaaaataataaaatata	Protospacer
 ****.**.*************** *    **

35. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP045061 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaattaatgaaaaaataatattaacaa	Protospacer
 ****.*******.**********  * *. *

36. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP045054 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaattaatgaaaaaataatattaacaa	Protospacer
 ****.*******.**********  * *. *

37. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP045058 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaattaatgaaaaaataatattaacaa	Protospacer
 ****.*******.**********  * *. *

38. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to MH830339 (Proteus phage Stubb, complete genome) position: , mismatch: 8, identity: 0.75

ataatga-----attaataaaaaaataatcattatta	CRISPR spacer
-----gagcattattaataaataaataatcataataa	Protospacer
     **     ********* ********** ** *

39. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to MG030347 (Proteus phage PM135, complete genome) position: , mismatch: 8, identity: 0.75

ataatga-----attaataaaaaaataatcattatta	CRISPR spacer
-----gagcattattaataaataaataatcataataa	Protospacer
     **     ********* ********** ** *

40. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to MN935203 (UNVERIFIED: Proteus phage VTCCBPA139, partial genome) position: , mismatch: 8, identity: 0.75

ataatga-----attaataaaaaaataatcattatta	CRISPR spacer
-----gagcattattaataaataaataatcataataa	Protospacer
     **     ********* ********** ** *

41. spacer 1.2|107033|34|NZ_ALSM01000025|CRT matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 8, identity: 0.765

gcgttgatatgaaaggaaattatag-agatatgat	CRISPR spacer
tcgttgatctaaaaggaaattatagcactcataa-	Protospacer
 ******* *.************** *  .**.* 

42. spacer 1.4|107166|34|NZ_ALSM01000025|CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.765

ataattatggtagtcttatttttaatataaaata	CRISPR spacer
acaaaaatgttagtcttatgtttaatataaacac	Protospacer
*.**  *** ********* ***********   

43. spacer 1.4|107166|34|NZ_ALSM01000025|CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 8, identity: 0.765

ataattatggtagtcttatttttaatataaaata-	CRISPR spacer
aaaattaaagtagtcttatttttaat-cattttac	Protospacer
* ***** .***************** .*   ** 

44. spacer 1.4|107166|34|NZ_ALSM01000025|CRT matches to NC_015901 (Lactococcus lactis subsp. lactis bv. diacetylactis plasmid pVF22, complete sequence) position: , mismatch: 8, identity: 0.765

ataattatggtagtcttatttttaatataaaata	CRISPR spacer
taatttctattattctaatttttaatataaaata	Protospacer
  * ** *. ** *** *****************

45. spacer 1.14|107166|33|NZ_ALSM01000025|PILER-CR matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 8, identity: 0.758

ataattatggtagtcttatttttaatataaaat----	CRISPR spacer
aaaattaaagtagtcttatttttaat----catttta	Protospacer
* ***** .*****************     **    

46. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ataatgaatttataaaaaaataaatttaggag	Protospacer
********** ************ . * .  .

47. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ataatgaatttataaaaaaataaatttaggag	Protospacer
********** ************ . * .  .

48. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
caaaactattaatataaaagtaatcattatct	Protospacer
  **   ******* ****.**********. 

49. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_AP017932 (Lactobacillus sakei strain LK-145 plasmid pLs145-a, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

50. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP025208 (Lactobacillus sakei strain WiKim0074 plasmid pLSW74_2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

51. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP021933 (Lactobacillus plantarum strain TMW 1.1478 plasmid pL11478-1, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

52. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP017376 (Lactobacillus plantarum strain TMW 1.708 plasmid pL1708-2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

53. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP021472 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

54. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP052067 (Lactobacillus paracasei strain 347-16 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

55. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP031209 (Lactobacillus brevis strain UCCLB521 plasmid pUCCLB521_A, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

56. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP035015 (Lactobacillus plantarum strain 12_3 plasmid pldC, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

57. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NC_003383 (Listeria innocua Clip11262 plasmid pLI100, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaat-taataaaaaaataatcattatta	CRISPR spacer
-tggcaggtgtaacaaaaaaattatcattatta	Protospacer
 *......* ***.******** **********

58. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP048005 (Lactobacillus paracasei strain CACC 566 plasmid p2CACC566, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

59. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP046038 (Lactobacillus sakei strain CBA3614 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

60. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP017410 (Lactobacillus plantarum strain RI-113 plasmid pRI113_4, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

61. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NC_016608 (Pediococcus claussenii ATCC BAA-344 plasmid pPECL-5, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

62. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP029967 (Lactobacillus curvatus strain ZJUNIT8 plasmid pnunamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

63. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP028336 (Lactobacillus plantarum strain SRCM101167 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

64. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP028231 (Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

65. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP018183 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-3, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

66. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to MH937473 (Streptococcus phage CHPC929, complete genome) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
atattgaattaataaaaaagtaagtaagtaaa	Protospacer
*** ***************.*** .*     *

67. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NC_010353 (Streptococcus phage 858, complete genome) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
atattgaattaataaaaaagtaagtaagtaaa	Protospacer
*** ***************.*** .*     *

68. spacer 1.4|107166|34|NZ_ALSM01000025|CRT matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 9, identity: 0.735

ataattatggtagtcttatttttaa------tataaaata	CRISPR spacer
ttaattattgtagtattatttttaaagtgtttat------	Protospacer
 ******* ***** **********      ***      

69. spacer 1.7|107033|32|NZ_ALSM01000025|CRISPRCasFinder matches to CP029330 (Clostridium beijerinckii isolate WB53 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

gcgttgatatgaaaggaaattatagagatatg	CRISPR spacer
caaactatatgaaagaaaattataaagatata	Protospacer
  . . *********.********.******.

70. spacer 1.7|107033|32|NZ_ALSM01000025|CRISPRCasFinder matches to CP029330 (Clostridium beijerinckii isolate WB53 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

gcgttgatatgaaaggaaattatagagatatg	CRISPR spacer
caaactatatgaaagaaaattataaagatata	Protospacer
  . . *********.********.******.

71. spacer 1.7|107033|32|NZ_ALSM01000025|CRISPRCasFinder matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 9, identity: 0.719

gcgttgatatgaaaggaaattatagagatatg	CRISPR spacer
tcgttgatctaaaaggaaattatagcactcat	Protospacer
 ******* *.************** . *   

72. spacer 1.7|107033|32|NZ_ALSM01000025|CRISPRCasFinder matches to NC_015916 (Borreliella bissettii DN127 plasmid lp28-3, complete sequence) position: , mismatch: 9, identity: 0.719

gcgttgatatgaaaggaaattatagagatatg	CRISPR spacer
aaaatgggatgagagggaattatagagatata	Protospacer
. . **. ****.***.**************.

73. spacer 1.7|107033|32|NZ_ALSM01000025|CRISPRCasFinder matches to NZ_CP015806 (Borrelia mayonii strain MN14-1539 plasmid lp28-3) position: , mismatch: 9, identity: 0.719

gcgttgatatgaaaggaaattatagagatatg	CRISPR spacer
aaaatgggatgagagggaattatagagatata	Protospacer
. . **. ****.***.**************.

74. spacer 1.7|107033|32|NZ_ALSM01000025|CRISPRCasFinder matches to NZ_CP015791 (Borrelia mayonii strain MN14-1420 plasmid lp28-3, complete sequence) position: , mismatch: 9, identity: 0.719

gcgttgatatgaaaggaaattatagagatatg	CRISPR spacer
aaaatgggatgagagggaattatagagatata	Protospacer
. . **. ****.***.**************.

75. spacer 1.7|107033|32|NZ_ALSM01000025|CRISPRCasFinder matches to NZ_CP038639 (Cupriavidus oxalaticus strain X32 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

gcgttgatatgaaaggaaattatagagatatg	CRISPR spacer
acggcctgctgaaaggaaatcatagagaaatg	Protospacer
.** .    ***********.******* ***

76. spacer 1.9|107166|32|NZ_ALSM01000025|CRISPRCasFinder matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 9, identity: 0.719

ataattatggtagtcttatttttaatataaaa	CRISPR spacer
ttaattattgtagtattatttttaaagtgttt	Protospacer
 ******* ***** ********** .*.   

77. spacer 1.9|107166|32|NZ_ALSM01000025|CRISPRCasFinder matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 9, identity: 0.719

ataattatggtagtcttatttttaatataaaa	CRISPR spacer
aaaattaaagtagtcttatttttaatcatttt	Protospacer
* ***** .*****************      

78. spacer 1.9|107166|32|NZ_ALSM01000025|CRISPRCasFinder matches to MG945889 (UNVERIFIED: Microviridae sp. isolate 1554-1801, partial genome) position: , mismatch: 9, identity: 0.719

ataattatggtagtcttatttttaatataaaa	CRISPR spacer
atgggccgggtacacttatttttaatataaat	Protospacer
**.. .  ****  ***************** 

79. spacer 1.11|107298|33|NZ_ALSM01000025|CRISPRCasFinder matches to NZ_CP051683 (Mucilaginibacter sp. F39-2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

gtcttttcagacagaacataaatggaaatatag	CRISPR spacer
aacaatttaaacagaacataaatggaaatgaac	Protospacer
. *  **.*.*******************. * 

80. spacer 1.12|107033|33|NZ_ALSM01000025|PILER-CR matches to CP029330 (Clostridium beijerinckii isolate WB53 plasmid unnamed1) position: , mismatch: 9, identity: 0.727

gcgttgatatgaaaggaaattatagagatatga	CRISPR spacer
caaactatatgaaagaaaattataaagatataa	Protospacer
  . . *********.********.******.*

81. spacer 1.12|107033|33|NZ_ALSM01000025|PILER-CR matches to CP029330 (Clostridium beijerinckii isolate WB53 plasmid unnamed1) position: , mismatch: 9, identity: 0.727

gcgttgatatgaaaggaaattatagagatatga	CRISPR spacer
caaactatatgaaagaaaattataaagatataa	Protospacer
  . . *********.********.******.*

82. spacer 1.12|107033|33|NZ_ALSM01000025|PILER-CR matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 9, identity: 0.727

gcgttgatatgaaaggaaattatagagatatga	CRISPR spacer
tcgttgatctaaaaggaaattatagcactcata	Protospacer
 ******* *.************** . *   *

83. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 10, identity: 0.688

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
gaaatgaataaatgaaaaaataatctaccctt	Protospacer
. ******* ***.***********  . .* 

84. spacer 1.2|107033|34|NZ_ALSM01000025|CRT matches to CP029330 (Clostridium beijerinckii isolate WB53 plasmid unnamed1) position: , mismatch: 10, identity: 0.706

gcgttgatatgaaaggaaattatagagatatgat	CRISPR spacer
caaactatatgaaagaaaattataaagatataag	Protospacer
  . . *********.********.******.* 

85. spacer 1.2|107033|34|NZ_ALSM01000025|CRT matches to CP029330 (Clostridium beijerinckii isolate WB53 plasmid unnamed1) position: , mismatch: 10, identity: 0.706

gcgttgatatgaaaggaaattatagagatatgat	CRISPR spacer
caaactatatgaaagaaaattataaagatataag	Protospacer
  . . *********.********.******.* 

86. spacer 1.14|107166|33|NZ_ALSM01000025|PILER-CR matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 10, identity: 0.697

ataattatggtagtcttatttttaatataaaat	CRISPR spacer
ttaattattgtagtattatttttaaagtgttta	Protospacer
 ******* ***** ********** .*.    

87. spacer 1.16|107298|34|NZ_ALSM01000025|PILER-CR matches to NZ_CP051683 (Mucilaginibacter sp. F39-2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

gtcttttcagacagaacataaatggaaatatagt	CRISPR spacer
aacaatttaaacagaacataaatggaaatgaaca	Protospacer
. *  **.*.*******************. *  

88. spacer 1.1|106969|32|NZ_ALSM01000025|CRT matches to NZ_CP031220 (Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence) position: , mismatch: 11, identity: 0.656

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
tagatgaattaataaataaatattcaaatggg	Protospacer
  .************* ***** ***     .

89. spacer 1.4|107166|34|NZ_ALSM01000025|CRT matches to NC_013792 (Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence) position: , mismatch: 11, identity: 0.676

ataattatggtagtcttatttttaatataaaata	CRISPR spacer
ttttcaccactaattttatttttaatataaaata	Protospacer
 *  .  .. **.*.*******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6275 : 13829 11 Streptococcus_phage(50.0%) integrase,transposase attL 9205:9218|attR 14697:14710
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALSM01000023
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 102041 : 111029 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALSM01000007
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALSM01000007.1|WP_000384271.1|15629_15956_-|replication-initiator-protein-A 15629_15956_- 108 aa aa AcrIIA21 NA NA No NA
8. NZ_ALSM01000021
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 80318 : 144553 73 Streptococcus_phage(82.14%) capsid,integrase,protease,portal,tail,tRNA,terminase,head,holin attL 101916:101939|attR 133771:133794
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ALSM01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1621 : 10111 10 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_ALSM01000019
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALSM01000019_1 135782-136146 TypeII II-A
5 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALSM01000019_1 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135884-135912 29 MK448736 Streptococcus phage Javan35, complete genome 13157-13185 0 1.0
NZ_ALSM01000019_1 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135884-135912 29 MK448781 Streptococcus phage Javan5, complete genome 15179-15207 0 1.0
NZ_ALSM01000019_1 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135884-135912 29 MK448938 Streptococcus phage Javan44, complete genome 13158-13186 0 1.0
NZ_ALSM01000019_1 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135884-135912 29 MK448911 Streptococcus phage Javan34, complete genome 13157-13185 0 1.0
NZ_ALSM01000019_1 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135884-135912 29 MK448916 Streptococcus phage Javan36, complete genome 13157-13185 0 1.0
NZ_ALSM01000019_1 1.3|135949|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135949-135978 30 MK448924 Streptococcus phage Javan384, complete genome 23479-23508 0 1.0
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448871 Streptococcus phage Javan196, complete genome 2242-2271 0 1.0
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448697 Streptococcus phage Javan185, complete genome 2242-2271 0 1.0
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448693 Streptococcus phage Javan177, complete genome 2242-2271 0 1.0
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448729 Streptococcus phage Javan31, complete genome 2521-2550 0 1.0
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448696 Streptococcus phage Javan183, complete genome 2242-2271 0 1.0
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448837 Streptococcus phage Javan10, complete genome 2521-2550 0 1.0
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448868 Streptococcus phage Javan188, complete genome 2242-2271 0 1.0
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448691 Streptococcus phage Javan17, complete genome 2521-2550 0 1.0
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448866 Streptococcus phage Javan184, complete genome 2242-2271 0 1.0
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448699 Streptococcus phage Javan189, complete genome 2242-2271 0 1.0
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448867 Streptococcus phage Javan186, complete genome 2242-2271 0 1.0
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448948 Streptococcus phage Javan46, complete genome 2521-2550 0 1.0
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448768 Streptococcus phage Javan47, complete genome 2521-2550 0 1.0
NZ_ALSM01000019_1 1.1|135818|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135818-135847 30 MK448852 Streptococcus phage Javan140, complete genome 17195-17224 1 0.967
NZ_ALSM01000019_1 1.1|135818|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135818-135847 30 MK448678 Streptococcus phage Javan135, complete genome 17183-17212 1 0.967
NZ_ALSM01000019_1 1.3|135949|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135949-135978 30 MK448723 Streptococcus phage Javan271, complete genome 22317-22346 1 0.967
NZ_ALSM01000019_1 1.3|135949|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135949-135978 30 MK448753 Streptococcus phage Javan407, complete genome 23326-23355 1 0.967
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448976 Streptococcus phage Javan528, complete genome 2242-2271 1 0.967
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448961 Streptococcus phage Javan494, complete genome 2242-2271 1 0.967
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 MK448855 Streptococcus phage Javan150, complete genome 2206-2235 1 0.967
NZ_ALSM01000019_1 1.1|135818|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135818-135847 30 MK448784 Streptococcus phage Javan505, complete genome 18268-18297 2 0.933
NZ_ALSM01000019_1 1.1|135818|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135818-135847 30 MK448947 Streptococcus phage Javan458, complete genome 18268-18297 2 0.933
NZ_ALSM01000019_1 1.1|135818|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135818-135847 30 MK448689 Streptococcus phage Javan163, complete genome 18268-18297 2 0.933
NZ_ALSM01000019_1 1.1|135818|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135818-135847 30 MK448974 Streptococcus phage Javan524, complete genome 18268-18297 2 0.933
NZ_ALSM01000019_1 1.1|135818|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135818-135847 30 MK448789 Streptococcus phage Javan513, complete genome 18267-18296 2 0.933
NZ_ALSM01000019_1 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135884-135912 29 MK448754 Streptococcus phage Javan411, complete genome 15409-15437 6 0.793
NZ_ALSM01000019_1 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135884-135912 29 MK448929 Streptococcus phage Javan400, complete genome 15409-15437 6 0.793
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 KR131710 Fusobacterium phage Funu1, complete genome 31220-31249 7 0.767
NZ_ALSM01000019_1 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135884-135912 29 NZ_CP018188 Streptococcus salivarius strain ICDC2 plasmid, complete sequence 28137-28165 8 0.724
NZ_ALSM01000019_1 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135884-135912 29 MT310854 Streptomyces phage CricKo, complete genome 32420-32448 8 0.724
NZ_ALSM01000019_1 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135884-135912 29 MH155877 Streptomyces phage Rainydai, complete genome 32420-32448 8 0.724
NZ_ALSM01000019_1 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135884-135912 29 MT657340 Streptomyces phage Thiqqums, complete genome 32420-32448 8 0.724
NZ_ALSM01000019_1 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 135884-135912 29 MH155880 Streptomyces phage SendItCS, complete genome 31733-31761 8 0.724
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 NC_031062 Erwinia phage vB_EamP_Frozen, complete genome 404-433 8 0.733
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 KX098391 Erwinia phage vB_EamP_Gutmeister, complete genome 401-430 8 0.733
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 KX098390 Erwinia phage vB_EamP_Rexella, complete genome 400-429 8 0.733
NZ_ALSM01000019_1 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT 136015-136044 30 KF806588 Erwinia phage Ea9-2, complete genome 380-409 8 0.733

1. spacer 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 0, identity: 1.0

aagtcgaaaaagatgacttctattactgg	CRISPR spacer
aagtcgaaaaagatgacttctattactgg	Protospacer
*****************************

2. spacer 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 0, identity: 1.0

aagtcgaaaaagatgacttctattactgg	CRISPR spacer
aagtcgaaaaagatgacttctattactgg	Protospacer
*****************************

3. spacer 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 0, identity: 1.0

aagtcgaaaaagatgacttctattactgg	CRISPR spacer
aagtcgaaaaagatgacttctattactgg	Protospacer
*****************************

4. spacer 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 0, identity: 1.0

aagtcgaaaaagatgacttctattactgg	CRISPR spacer
aagtcgaaaaagatgacttctattactgg	Protospacer
*****************************

5. spacer 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 0, identity: 1.0

aagtcgaaaaagatgacttctattactgg	CRISPR spacer
aagtcgaaaaagatgacttctattactgg	Protospacer
*****************************

6. spacer 1.3|135949|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448924 (Streptococcus phage Javan384, complete genome) position: , mismatch: 0, identity: 1.0

aatgaagatattctagctcgtgtaaaaata	CRISPR spacer
aatgaagatattctagctcgtgtaaaaata	Protospacer
******************************

7. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448871 (Streptococcus phage Javan196, complete genome) position: , mismatch: 0, identity: 1.0

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaaacagcg	Protospacer
******************************

8. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448697 (Streptococcus phage Javan185, complete genome) position: , mismatch: 0, identity: 1.0

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaaacagcg	Protospacer
******************************

9. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448693 (Streptococcus phage Javan177, complete genome) position: , mismatch: 0, identity: 1.0

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaaacagcg	Protospacer
******************************

10. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaaacagcg	Protospacer
******************************

11. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448696 (Streptococcus phage Javan183, complete genome) position: , mismatch: 0, identity: 1.0

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaaacagcg	Protospacer
******************************

12. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 0, identity: 1.0

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaaacagcg	Protospacer
******************************

13. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448868 (Streptococcus phage Javan188, complete genome) position: , mismatch: 0, identity: 1.0

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaaacagcg	Protospacer
******************************

14. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaaacagcg	Protospacer
******************************

15. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448866 (Streptococcus phage Javan184, complete genome) position: , mismatch: 0, identity: 1.0

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaaacagcg	Protospacer
******************************

16. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448699 (Streptococcus phage Javan189, complete genome) position: , mismatch: 0, identity: 1.0

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaaacagcg	Protospacer
******************************

17. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448867 (Streptococcus phage Javan186, complete genome) position: , mismatch: 0, identity: 1.0

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaaacagcg	Protospacer
******************************

18. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaaacagcg	Protospacer
******************************

19. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaaacagcg	Protospacer
******************************

20. spacer 1.1|135818|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448852 (Streptococcus phage Javan140, complete genome) position: , mismatch: 1, identity: 0.967

tacctacgaagactataatttcgaaacaaa	CRISPR spacer
tacctacgaagactataatctcgaaacaaa	Protospacer
*******************.**********

21. spacer 1.1|135818|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448678 (Streptococcus phage Javan135, complete genome) position: , mismatch: 1, identity: 0.967

tacctacgaagactataatttcgaaacaaa	CRISPR spacer
tacctacgaagactataatctcgaaacaaa	Protospacer
*******************.**********

22. spacer 1.3|135949|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448723 (Streptococcus phage Javan271, complete genome) position: , mismatch: 1, identity: 0.967

aatgaagatattctagctcgtgtaaaaata	CRISPR spacer
aatgaagacattctagctcgtgtaaaaata	Protospacer
********.*********************

23. spacer 1.3|135949|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448753 (Streptococcus phage Javan407, complete genome) position: , mismatch: 1, identity: 0.967

aatgaagatattctagctcgtgtaaaaata	CRISPR spacer
aatgaagacattctagctcgtgtaaaaata	Protospacer
********.*********************

24. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448976 (Streptococcus phage Javan528, complete genome) position: , mismatch: 1, identity: 0.967

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaagcagcg	Protospacer
************************.*****

25. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448961 (Streptococcus phage Javan494, complete genome) position: , mismatch: 1, identity: 0.967

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaagcagcg	Protospacer
************************.*****

26. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448855 (Streptococcus phage Javan150, complete genome) position: , mismatch: 1, identity: 0.967

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaaaaaatcaaagaattgtgcaagcagcg	Protospacer
************************.*****

27. spacer 1.1|135818|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448784 (Streptococcus phage Javan505, complete genome) position: , mismatch: 2, identity: 0.933

tacctacgaagactataatttcgaaacaaa	CRISPR spacer
cacctacgaagactataatctcgaaacaaa	Protospacer
.******************.**********

28. spacer 1.1|135818|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448947 (Streptococcus phage Javan458, complete genome) position: , mismatch: 2, identity: 0.933

tacctacgaagactataatttcgaaacaaa	CRISPR spacer
cacctacgaagactataatctcgaaacaaa	Protospacer
.******************.**********

29. spacer 1.1|135818|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448689 (Streptococcus phage Javan163, complete genome) position: , mismatch: 2, identity: 0.933

tacctacgaagactataatttcgaaacaaa	CRISPR spacer
cacctacgaagactataatctcgaaacaaa	Protospacer
.******************.**********

30. spacer 1.1|135818|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448974 (Streptococcus phage Javan524, complete genome) position: , mismatch: 2, identity: 0.933

tacctacgaagactataatttcgaaacaaa	CRISPR spacer
cacctacgaagactataatctcgaaacaaa	Protospacer
.******************.**********

31. spacer 1.1|135818|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448789 (Streptococcus phage Javan513, complete genome) position: , mismatch: 2, identity: 0.933

tacctacgaagactataatttcgaaacaaa	CRISPR spacer
cacctacgaagactataatctcgaaacaaa	Protospacer
.******************.**********

32. spacer 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448754 (Streptococcus phage Javan411, complete genome) position: , mismatch: 6, identity: 0.793

aagtcgaaaaagatgacttctattactgg	CRISPR spacer
aaccaaaaaaagatgacttttattattgg	Protospacer
** . .*************.*****.***

33. spacer 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MK448929 (Streptococcus phage Javan400, complete genome) position: , mismatch: 6, identity: 0.793

aagtcgaaaaagatgacttctattactgg	CRISPR spacer
aaccaaaaaaagatgacttttattattgg	Protospacer
** . .*************.*****.***

34. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to KR131710 (Fusobacterium phage Funu1, complete genome) position: , mismatch: 7, identity: 0.767

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
agaaaatatcaaagaattgagcaaaaatta	Protospacer
 ***** ************ ***** * ..

35. spacer 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018188 (Streptococcus salivarius strain ICDC2 plasmid, complete sequence) position: , mismatch: 8, identity: 0.724

aagtcgaaaaagatgacttctattactgg	CRISPR spacer
ctgtagaaaaagacgacttctattatatt	Protospacer
  ** ********.***********.   

36. spacer 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MT310854 (Streptomyces phage CricKo, complete genome) position: , mismatch: 8, identity: 0.724

aagtcgaaaaagatgacttctattactgg	CRISPR spacer
tgatcaaagaagatgacttctattacacc	Protospacer
 ..**.**.*****************   

37. spacer 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MH155877 (Streptomyces phage Rainydai, complete genome) position: , mismatch: 8, identity: 0.724

aagtcgaaaaagatgacttctattactgg	CRISPR spacer
tgatcaaagaagatgacttctattacacc	Protospacer
 ..**.**.*****************   

38. spacer 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MT657340 (Streptomyces phage Thiqqums, complete genome) position: , mismatch: 8, identity: 0.724

aagtcgaaaaagatgacttctattactgg	CRISPR spacer
tgatcaaagaagatgacttctattacacc	Protospacer
 ..**.**.*****************   

39. spacer 1.2|135884|29|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to MH155880 (Streptomyces phage SendItCS, complete genome) position: , mismatch: 8, identity: 0.724

aagtcgaaaaagatgacttctattactgg	CRISPR spacer
tgatcaaagaagatgacttctattacacc	Protospacer
 ..**.**.*****************   

40. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to NC_031062 (Erwinia phage vB_EamP_Frozen, complete genome) position: , mismatch: 8, identity: 0.733

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaacaaatcaaagaattgttcaatgccaa	Protospacer
**** *************** ***     .

41. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to KX098391 (Erwinia phage vB_EamP_Gutmeister, complete genome) position: , mismatch: 8, identity: 0.733

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaacaaatcaaagaattgttcaatgccaa	Protospacer
**** *************** ***     .

42. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to KX098390 (Erwinia phage vB_EamP_Rexella, complete genome) position: , mismatch: 8, identity: 0.733

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaacaaatcaaagaattgttcaatgccaa	Protospacer
**** *************** ***     .

43. spacer 1.4|136015|30|NZ_ALSM01000019|PILER-CR,CRISPRCasFinder,CRT matches to KF806588 (Erwinia phage Ea9-2, complete genome) position: , mismatch: 8, identity: 0.733

tgaaaaaatcaaagaattgtgcaaacagcg	CRISPR spacer
tgaacaaatcaaagaattgttcaatgccaa	Protospacer
**** *************** ***     .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage