Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ALSA01000030 Streptococcus agalactiae MRI Z1-039 ctg120005197713, whole genome shotgun sequence 1 crisprs cas9,cas1,cas2,csn2 0 13 0 0
NZ_ALSA01000176 Streptococcus agalactiae MRI Z1-039 ctg120005197859, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALSA01000116 Streptococcus agalactiae MRI Z1-039 ctg120005197799, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000146 Streptococcus agalactiae MRI Z1-039 ctg120005197829, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000124 Streptococcus agalactiae MRI Z1-039 ctg120005197807, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000112 Streptococcus agalactiae MRI Z1-039 ctg120005197795, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000041 Streptococcus agalactiae MRI Z1-039 ctg120005197724, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000132 Streptococcus agalactiae MRI Z1-039 ctg120005197815, whole genome shotgun sequence 1 crisprs csm6 0 0 1 0
NZ_ALSA01000111 Streptococcus agalactiae MRI Z1-039 ctg120005197794, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALSA01000084 Streptococcus agalactiae MRI Z1-039 ctg120005197767, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000143 Streptococcus agalactiae MRI Z1-039 ctg120005197826, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000067 Streptococcus agalactiae MRI Z1-039 ctg120005197750, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000001 Streptococcus agalactiae MRI Z1-039 ctg120005196082, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000123 Streptococcus agalactiae MRI Z1-039 ctg120005197806, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000036 Streptococcus agalactiae MRI Z1-039 ctg120005197719, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000107 Streptococcus agalactiae MRI Z1-039 ctg120005197790, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000008 Streptococcus agalactiae MRI Z1-039 ctg120005197691, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000028 Streptococcus agalactiae MRI Z1-039 ctg120005197711, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000094 Streptococcus agalactiae MRI Z1-039 ctg120005197777, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000072 Streptococcus agalactiae MRI Z1-039 ctg120005197755, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000163 Streptococcus agalactiae MRI Z1-039 ctg120005197846, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000119 Streptococcus agalactiae MRI Z1-039 ctg120005197802, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000092 Streptococcus agalactiae MRI Z1-039 ctg120005197775, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000062 Streptococcus agalactiae MRI Z1-039 ctg120005197745, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000005 Streptococcus agalactiae MRI Z1-039 ctg120005197688, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000159 Streptococcus agalactiae MRI Z1-039 ctg120005197842, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000080 Streptococcus agalactiae MRI Z1-039 ctg120005197763, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000100 Streptococcus agalactiae MRI Z1-039 ctg120005197783, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000086 Streptococcus agalactiae MRI Z1-039 ctg120005197769, whole genome shotgun sequence 1 crisprs NA 0 6 0 0
NZ_ALSA01000010 Streptococcus agalactiae MRI Z1-039 ctg120005197693, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000071 Streptococcus agalactiae MRI Z1-039 ctg120005197754, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000057 Streptococcus agalactiae MRI Z1-039 ctg120005197740, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000034 Streptococcus agalactiae MRI Z1-039 ctg120005197717, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000033 Streptococcus agalactiae MRI Z1-039 ctg120005197716, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000125 Streptococcus agalactiae MRI Z1-039 ctg120005197808, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000160 Streptococcus agalactiae MRI Z1-039 ctg120005197843, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALSA01000166 Streptococcus agalactiae MRI Z1-039 ctg120005197849, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000118 Streptococcus agalactiae MRI Z1-039 ctg120005197801, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALSA01000032 Streptococcus agalactiae MRI Z1-039 ctg120005197715, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000048 Streptococcus agalactiae MRI Z1-039 ctg120005197731, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000152 Streptococcus agalactiae MRI Z1-039 ctg120005197835, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000168 Streptococcus agalactiae MRI Z1-039 ctg120005197851, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000141 Streptococcus agalactiae MRI Z1-039 ctg120005197824, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000059 Streptococcus agalactiae MRI Z1-039 ctg120005197742, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000053 Streptococcus agalactiae MRI Z1-039 ctg120005197736, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000167 Streptococcus agalactiae MRI Z1-039 ctg120005197850, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000079 Streptococcus agalactiae MRI Z1-039 ctg120005197762, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000085 Streptococcus agalactiae MRI Z1-039 ctg120005197768, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000003 Streptococcus agalactiae MRI Z1-039 ctg120005197686, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000004 Streptococcus agalactiae MRI Z1-039 ctg120005197687, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000161 Streptococcus agalactiae MRI Z1-039 ctg120005197844, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000165 Streptococcus agalactiae MRI Z1-039 ctg120005197848, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000139 Streptococcus agalactiae MRI Z1-039 ctg120005197822, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000065 Streptococcus agalactiae MRI Z1-039 ctg120005197748, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000029 Streptococcus agalactiae MRI Z1-039 ctg120005197712, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000017 Streptococcus agalactiae MRI Z1-039 ctg120005197700, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000076 Streptococcus agalactiae MRI Z1-039 ctg120005197759, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000081 Streptococcus agalactiae MRI Z1-039 ctg120005197764, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000056 Streptococcus agalactiae MRI Z1-039 ctg120005197739, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000015 Streptococcus agalactiae MRI Z1-039 ctg120005197698, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000043 Streptococcus agalactiae MRI Z1-039 ctg120005197726, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000137 Streptococcus agalactiae MRI Z1-039 ctg120005197820, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000150 Streptococcus agalactiae MRI Z1-039 ctg120005197833, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000064 Streptococcus agalactiae MRI Z1-039 ctg120005197747, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000054 Streptococcus agalactiae MRI Z1-039 ctg120005197737, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000135 Streptococcus agalactiae MRI Z1-039 ctg120005197818, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000020 Streptococcus agalactiae MRI Z1-039 ctg120005197703, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000108 Streptococcus agalactiae MRI Z1-039 ctg120005197791, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000117 Streptococcus agalactiae MRI Z1-039 ctg120005197800, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000082 Streptococcus agalactiae MRI Z1-039 ctg120005197765, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000040 Streptococcus agalactiae MRI Z1-039 ctg120005197723, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000110 Streptococcus agalactiae MRI Z1-039 ctg120005197793, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000042 Streptococcus agalactiae MRI Z1-039 ctg120005197725, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ALSA01000045 Streptococcus agalactiae MRI Z1-039 ctg120005197728, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000024 Streptococcus agalactiae MRI Z1-039 ctg120005197707, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000014 Streptococcus agalactiae MRI Z1-039 ctg120005197697, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000115 Streptococcus agalactiae MRI Z1-039 ctg120005197798, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000099 Streptococcus agalactiae MRI Z1-039 ctg120005197782, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000155 Streptococcus agalactiae MRI Z1-039 ctg120005197838, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000129 Streptococcus agalactiae MRI Z1-039 ctg120005197812, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000126 Streptococcus agalactiae MRI Z1-039 ctg120005197809, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000047 Streptococcus agalactiae MRI Z1-039 ctg120005197730, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000144 Streptococcus agalactiae MRI Z1-039 ctg120005197827, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000170 Streptococcus agalactiae MRI Z1-039 ctg120005197853, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000077 Streptococcus agalactiae MRI Z1-039 ctg120005197760, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000171 Streptococcus agalactiae MRI Z1-039 ctg120005197854, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000093 Streptococcus agalactiae MRI Z1-039 ctg120005197776, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000052 Streptococcus agalactiae MRI Z1-039 ctg120005197735, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000131 Streptococcus agalactiae MRI Z1-039 ctg120005197814, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ALSA01000173 Streptococcus agalactiae MRI Z1-039 ctg120005197856, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000153 Streptococcus agalactiae MRI Z1-039 ctg120005197836, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000087 Streptococcus agalactiae MRI Z1-039 ctg120005197770, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000035 Streptococcus agalactiae MRI Z1-039 ctg120005197718, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000019 Streptococcus agalactiae MRI Z1-039 ctg120005197702, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000089 Streptococcus agalactiae MRI Z1-039 ctg120005197772, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000021 Streptococcus agalactiae MRI Z1-039 ctg120005197704, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000073 Streptococcus agalactiae MRI Z1-039 ctg120005197756, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000104 Streptococcus agalactiae MRI Z1-039 ctg120005197787, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000007 Streptococcus agalactiae MRI Z1-039 ctg120005197690, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000022 Streptococcus agalactiae MRI Z1-039 ctg120005197705, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000070 Streptococcus agalactiae MRI Z1-039 ctg120005197753, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000083 Streptococcus agalactiae MRI Z1-039 ctg120005197766, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000018 Streptococcus agalactiae MRI Z1-039 ctg120005197701, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000074 Streptococcus agalactiae MRI Z1-039 ctg120005197757, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000058 Streptococcus agalactiae MRI Z1-039 ctg120005197741, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000063 Streptococcus agalactiae MRI Z1-039 ctg120005197746, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000049 Streptococcus agalactiae MRI Z1-039 ctg120005197732, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000044 Streptococcus agalactiae MRI Z1-039 ctg120005197727, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000106 Streptococcus agalactiae MRI Z1-039 ctg120005197789, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000011 Streptococcus agalactiae MRI Z1-039 ctg120005197694, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000122 Streptococcus agalactiae MRI Z1-039 ctg120005197805, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000151 Streptococcus agalactiae MRI Z1-039 ctg120005197834, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000009 Streptococcus agalactiae MRI Z1-039 ctg120005197692, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000114 Streptococcus agalactiae MRI Z1-039 ctg120005197797, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000006 Streptococcus agalactiae MRI Z1-039 ctg120005197689, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000013 Streptococcus agalactiae MRI Z1-039 ctg120005197696, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000157 Streptococcus agalactiae MRI Z1-039 ctg120005197840, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALSA01000174 Streptococcus agalactiae MRI Z1-039 ctg120005197857, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000051 Streptococcus agalactiae MRI Z1-039 ctg120005197734, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000091 Streptococcus agalactiae MRI Z1-039 ctg120005197774, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000096 Streptococcus agalactiae MRI Z1-039 ctg120005197779, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000055 Streptococcus agalactiae MRI Z1-039 ctg120005197738, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000026 Streptococcus agalactiae MRI Z1-039 ctg120005197709, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000136 Streptococcus agalactiae MRI Z1-039 ctg120005197819, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000138 Streptococcus agalactiae MRI Z1-039 ctg120005197821, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000109 Streptococcus agalactiae MRI Z1-039 ctg120005197792, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000169 Streptococcus agalactiae MRI Z1-039 ctg120005197852, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_ALSA01000130 Streptococcus agalactiae MRI Z1-039 ctg120005197813, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ALSA01000140 Streptococcus agalactiae MRI Z1-039 ctg120005197823, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000127 Streptococcus agalactiae MRI Z1-039 ctg120005197810, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000066 Streptococcus agalactiae MRI Z1-039 ctg120005197749, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000149 Streptococcus agalactiae MRI Z1-039 ctg120005197832, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALSA01000016 Streptococcus agalactiae MRI Z1-039 ctg120005197699, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000078 Streptococcus agalactiae MRI Z1-039 ctg120005197761, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000068 Streptococcus agalactiae MRI Z1-039 ctg120005197751, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000023 Streptococcus agalactiae MRI Z1-039 ctg120005197706, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000133 Streptococcus agalactiae MRI Z1-039 ctg120005197816, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000102 Streptococcus agalactiae MRI Z1-039 ctg120005197785, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000075 Streptococcus agalactiae MRI Z1-039 ctg120005197758, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000142 Streptococcus agalactiae MRI Z1-039 ctg120005197825, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALSA01000103 Streptococcus agalactiae MRI Z1-039 ctg120005197786, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000164 Streptococcus agalactiae MRI Z1-039 ctg120005197847, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALSA01000147 Streptococcus agalactiae MRI Z1-039 ctg120005197830, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000172 Streptococcus agalactiae MRI Z1-039 ctg120005197855, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000061 Streptococcus agalactiae MRI Z1-039 ctg120005197744, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000145 Streptococcus agalactiae MRI Z1-039 ctg120005197828, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000148 Streptococcus agalactiae MRI Z1-039 ctg120005197831, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000031 Streptococcus agalactiae MRI Z1-039 ctg120005197714, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000097 Streptococcus agalactiae MRI Z1-039 ctg120005197780, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000158 Streptococcus agalactiae MRI Z1-039 ctg120005197841, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000025 Streptococcus agalactiae MRI Z1-039 ctg120005197708, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000095 Streptococcus agalactiae MRI Z1-039 ctg120005197778, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000050 Streptococcus agalactiae MRI Z1-039 ctg120005197733, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_ALSA01000175 Streptococcus agalactiae MRI Z1-039 ctg120005197858, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000156 Streptococcus agalactiae MRI Z1-039 ctg120005197839, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000121 Streptococcus agalactiae MRI Z1-039 ctg120005197804, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000090 Streptococcus agalactiae MRI Z1-039 ctg120005197773, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000012 Streptococcus agalactiae MRI Z1-039 ctg120005197695, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000113 Streptococcus agalactiae MRI Z1-039 ctg120005197796, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000120 Streptococcus agalactiae MRI Z1-039 ctg120005197803, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000101 Streptococcus agalactiae MRI Z1-039 ctg120005197784, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000134 Streptococcus agalactiae MRI Z1-039 ctg120005197817, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000027 Streptococcus agalactiae MRI Z1-039 ctg120005197710, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000162 Streptococcus agalactiae MRI Z1-039 ctg120005197845, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000105 Streptococcus agalactiae MRI Z1-039 ctg120005197788, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000069 Streptococcus agalactiae MRI Z1-039 ctg120005197752, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000098 Streptococcus agalactiae MRI Z1-039 ctg120005197781, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000088 Streptococcus agalactiae MRI Z1-039 ctg120005197771, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000002 Streptococcus agalactiae MRI Z1-039 ctg120005197685, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000037 Streptococcus agalactiae MRI Z1-039 ctg120005197720, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000154 Streptococcus agalactiae MRI Z1-039 ctg120005197837, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ALSA01000038 Streptococcus agalactiae MRI Z1-039 ctg120005197721, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_ALSA01000039 Streptococcus agalactiae MRI Z1-039 ctg120005197722, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000128 Streptococcus agalactiae MRI Z1-039 ctg120005197811, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000060 Streptococcus agalactiae MRI Z1-039 ctg120005197743, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ALSA01000046 Streptococcus agalactiae MRI Z1-039 ctg120005197729, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ALSA01000160
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 8733 14 Streptococcus_phage(60.0%) transposase,integrase attL 2074:2088|attR 10039:10053
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ALSA01000118
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12020 : 27892 30 Streptococcus_phage(80.0%) integrase attL 5094:5108|attR 26097:26111
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ALSA01000131
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ALSA01000131.1|WP_000384271.1|2341_2668_+|replication-initiator-protein-A 2341_2668_+ 108 aa aa AcrIIA21 NA NA No NA
4. NZ_ALSA01000176
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 10126 13 Streptococcus_phage(100.0%) integrase attL 1706:1719|attR 10782:10795
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ALSA01000164
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 4644 11 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ALSA01000086
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALSA01000086_1 10-627 Orphan NA
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP020439 Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence 39390-39419 3 0.9
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP020439 Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence 39879-39908 3 0.9
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP020439 Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence 224840-224869 3 0.9
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP020439 Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence 225329-225358 3 0.9
NZ_ALSA01000086_1 1.7|316|30|NZ_ALSA01000086|CRT 316-345 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5579-5608 4 0.867
NZ_ALSA01000086_1 1.7|316|30|NZ_ALSA01000086|CRT 316-345 30 NC_018503 Bacillus thuringiensis HD-771 plasmid p07, complete sequence 5507-5536 5 0.833
NZ_ALSA01000086_1 1.5|196|30|NZ_ALSA01000086|CRT 196-225 30 LC553736 Salmonella phage SAP012 DNA, complete sequence 29488-29517 6 0.8
NZ_ALSA01000086_1 1.7|316|30|NZ_ALSA01000086|CRT 316-345 30 CP017837 Proteobacteria phage MWH-Nonnen-W8red 2 genome 25052-25081 6 0.8
NZ_ALSA01000086_1 1.9|412|30|NZ_ALSA01000086|CRT 412-441 30 LC553736 Salmonella phage SAP012 DNA, complete sequence 29488-29517 6 0.8
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP020748 Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence 15343-15372 6 0.8
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP020748 Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence 15403-15432 6 0.8
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP020748 Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence 15547-15576 6 0.8
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP020748 Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence 15655-15684 6 0.8
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NC_017726 Bacillus anthracis str. H9401 plasmid BAP1, complete sequence 68415-68444 6 0.8
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 MG603697 Vibrio phage Vp_R1, complete genome 46472-46501 6 0.8
NZ_ALSA01000086_1 1.7|316|30|NZ_ALSA01000086|CRT 316-345 30 NZ_CP040783 Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence 171876-171905 7 0.767
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NC_047926 Lactobacillus phage Semele, complete genome 8765-8794 7 0.767
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NC_011973 Bacillus cereus Q1 plasmid pBc239, complete sequence 212070-212099 7 0.767
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NC_011973 Bacillus cereus Q1 plasmid pBc239, complete sequence 212106-212135 7 0.767
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NC_011973 Bacillus cereus Q1 plasmid pBc239, complete sequence 212142-212171 7 0.767
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NC_014331 Bacillus cereus biovar anthracis str. CI plasmid pCI-XO1, complete sequence 68381-68410 7 0.767
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP016317 Bacillus cereus strain M3 plasmid pBCM301, complete sequence 143793-143822 7 0.767
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 68913-68942 7 0.767
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP053930 Bacillus cereus strain FDAARGOS_797 plasmid unnamed1, complete sequence 10773-10802 7 0.767
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP020748 Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence 15523-15552 7 0.767
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP020748 Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence 15619-15648 7 0.767
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP020748 Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence 15775-15804 7 0.767
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP009299 Bacillus cereus D17 plasmid unnamed, complete sequence 166622-166651 7 0.767
NZ_ALSA01000086_1 1.5|196|30|NZ_ALSA01000086|CRT 196-225 30 NC_019401 Cronobacter phage vB_CsaM_GAP32, complete genome 16599-16628 8 0.733
NZ_ALSA01000086_1 1.8|364|30|NZ_ALSA01000086|CRT 364-393 30 NC_047926 Lactobacillus phage Semele, complete genome 8765-8794 8 0.733
NZ_ALSA01000086_1 1.8|364|30|NZ_ALSA01000086|CRT 364-393 30 NZ_CP053930 Bacillus cereus strain FDAARGOS_797 plasmid unnamed1, complete sequence 10773-10802 8 0.733
NZ_ALSA01000086_1 1.8|364|30|NZ_ALSA01000086|CRT 364-393 30 NZ_CP013715 Staphylococcus equorum strain C2014 plasmid pC2014-1, complete sequence 54374-54403 8 0.733
NZ_ALSA01000086_1 1.8|364|30|NZ_ALSA01000086|CRT 364-393 30 NZ_CP009299 Bacillus cereus D17 plasmid unnamed, complete sequence 166622-166651 8 0.733
NZ_ALSA01000086_1 1.9|412|30|NZ_ALSA01000086|CRT 412-441 30 NC_019401 Cronobacter phage vB_CsaM_GAP32, complete genome 16599-16628 8 0.733
NZ_ALSA01000086_1 1.11|532|30|NZ_ALSA01000086|CRT 532-561 30 NC_047926 Lactobacillus phage Semele, complete genome 8765-8794 8 0.733
NZ_ALSA01000086_1 1.11|532|30|NZ_ALSA01000086|CRT 532-561 30 NZ_CP053930 Bacillus cereus strain FDAARGOS_797 plasmid unnamed1, complete sequence 10773-10802 8 0.733
NZ_ALSA01000086_1 1.11|532|30|NZ_ALSA01000086|CRT 532-561 30 NZ_CP013715 Staphylococcus equorum strain C2014 plasmid pC2014-1, complete sequence 54374-54403 8 0.733
NZ_ALSA01000086_1 1.11|532|30|NZ_ALSA01000086|CRT 532-561 30 NZ_CP009299 Bacillus cereus D17 plasmid unnamed, complete sequence 166622-166651 8 0.733
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP013715 Staphylococcus equorum strain C2014 plasmid pC2014-1, complete sequence 54374-54403 8 0.733
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP020748 Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence 15259-15288 8 0.733
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NZ_CP009317 Bacillus cereus 03BB102 plasmid unnamed, complete sequence 83883-83912 8 0.733
NZ_ALSA01000086_1 1.12|580|30|NZ_ALSA01000086|CRT 580-609 30 NC_012473 Bacillus cereus 03BB102 plasmid p03BB102_179, complete sequence 53011-53040 8 0.733
NZ_ALSA01000086_1 1.7|316|30|NZ_ALSA01000086|CRT 316-345 30 MH707430 Bacillus phage BSP7, complete genome 30318-30347 9 0.7
NZ_ALSA01000086_1 1.8|364|30|NZ_ALSA01000086|CRT 364-393 30 NZ_CP038858 Escherichia coli strain PigCaeca_2 plasmid unnamed, complete sequence 110912-110941 9 0.7
NZ_ALSA01000086_1 1.11|532|30|NZ_ALSA01000086|CRT 532-561 30 NZ_CP038858 Escherichia coli strain PigCaeca_2 plasmid unnamed, complete sequence 110912-110941 9 0.7

1. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP020439 (Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence) position: , mismatch: 3, identity: 0.9

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
agccaaggcagaggctaagccagaagttaa	Protospacer
.*****. **********************

2. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP020439 (Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence) position: , mismatch: 3, identity: 0.9

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
agccaaggcagaggctaagccagaagttaa	Protospacer
.*****. **********************

3. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP020439 (Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence) position: , mismatch: 3, identity: 0.9

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
agccaaggcagaggctaagccagaagttaa	Protospacer
.*****. **********************

4. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP020439 (Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence) position: , mismatch: 3, identity: 0.9

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
agccaaggcagaggctaagccagaagttaa	Protospacer
.*****. **********************

5. spacer 1.7|316|30|NZ_ALSA01000086|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 4, identity: 0.867

agccaaaccagaggctaaaccagaaattaa	CRISPR spacer
aactaaaccagagactaaaccagaaactaa	Protospacer
*.*.*********.************.***

6. spacer 1.7|316|30|NZ_ALSA01000086|CRT matches to NC_018503 (Bacillus thuringiensis HD-771 plasmid p07, complete sequence) position: , mismatch: 5, identity: 0.833

agccaaaccagaggctaaaccagaaattaa	CRISPR spacer
gactaaaccagagactaaaccagaaactaa	Protospacer
..*.*********.************.***

7. spacer 1.5|196|30|NZ_ALSA01000086|CRT matches to LC553736 (Salmonella phage SAP012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8

ggccaaaccagacgttaagccagaagctaa	CRISPR spacer
agtccaaccagacgatcagccagaagctga	Protospacer
.*.* ********* * ***********.*

8. spacer 1.7|316|30|NZ_ALSA01000086|CRT matches to CP017837 (Proteobacteria phage MWH-Nonnen-W8red 2 genome) position: , mismatch: 6, identity: 0.8

agccaaaccagaggctaaaccagaaattaa	CRISPR spacer
agttaaaccagagcctaaaccagaaacaga	Protospacer
**..********* ************. .*

9. spacer 1.9|412|30|NZ_ALSA01000086|CRT matches to LC553736 (Salmonella phage SAP012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8

ggccaaaccagacgttaagccagaagctaa	CRISPR spacer
agtccaaccagacgatcagccagaagctga	Protospacer
.*.* ********* * ***********.*

10. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP020748 (Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.8

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
gccaaaaccagagcctaagccagaaccaaa	Protospacer
* * ********* *********** . **

11. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP020748 (Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.8

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
gccaaaaccagagcctaagccagaaccaaa	Protospacer
* * ********* *********** . **

12. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP020748 (Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.8

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
gccaaaaccagagcctaagccagaaccaaa	Protospacer
* * ********* *********** . **

13. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP020748 (Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.8

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
gccaaaaccagagcctaagccagaaccaaa	Protospacer
* * ********* *********** . **

14. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NC_017726 (Bacillus anthracis str. H9401 plasmid BAP1, complete sequence) position: , mismatch: 6, identity: 0.8

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
gacaaaaccagagactaagccagaaacaaa	Protospacer
*.* *********.***********.. **

15. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to MG603697 (Vibrio phage Vp_R1, complete genome) position: , mismatch: 6, identity: 0.8

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
ggtgaaaccagagcctaagccagaacctat	Protospacer
**. ********* *********** .** 

16. spacer 1.7|316|30|NZ_ALSA01000086|CRT matches to NZ_CP040783 (Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

agccaaaccagaggctaaaccagaaattaa	CRISPR spacer
cgaacaaccagtggctgaaccagaaattag	Protospacer
 *   ****** ****.************.

17. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NC_047926 (Lactobacillus phage Semele, complete genome) position: , mismatch: 7, identity: 0.767

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
aactgaaccagaagctaagccagaagttcc	Protospacer
..*..*******.***************  

18. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NC_011973 (Bacillus cereus Q1 plasmid pBc239, complete sequence) position: , mismatch: 7, identity: 0.767

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
aacaaaaccagagactaagccagaaacaaa	Protospacer
..* *********.***********.. **

19. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NC_011973 (Bacillus cereus Q1 plasmid pBc239, complete sequence) position: , mismatch: 7, identity: 0.767

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
aacaaaaccagagactaagccagaaacaaa	Protospacer
..* *********.***********.. **

20. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NC_011973 (Bacillus cereus Q1 plasmid pBc239, complete sequence) position: , mismatch: 7, identity: 0.767

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
aacaaaaccagagactaagccagaaacaaa	Protospacer
..* *********.***********.. **

21. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NC_014331 (Bacillus cereus biovar anthracis str. CI plasmid pCI-XO1, complete sequence) position: , mismatch: 7, identity: 0.767

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
aacaaaaccagagactaagccagaaacaaa	Protospacer
..* *********.***********.. **

22. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 7, identity: 0.767

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
ggaaaaaccagagacaaagccagaagtacc	Protospacer
**  *********.* ***********   

23. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 7, identity: 0.767

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
ggaaaaaccagagacaaagccagaagtacc	Protospacer
**  *********.* ***********   

24. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP053930 (Bacillus cereus strain FDAARGOS_797 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
agtagaaaaagaggctaagccagaagtgaa	Protospacer
.*. .**  ****************** **

25. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP020748 (Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.767

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
accaaaaccagagcctaagccagaaccaaa	Protospacer
. * ********* *********** . **

26. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP020748 (Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.767

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
accaaaaccagagcctaagccagaaccaaa	Protospacer
. * ********* *********** . **

27. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP020748 (Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.767

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
tgaaaaaccagagcctaagccagaaccaaa	Protospacer
 *  ********* *********** . **

28. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP009299 (Bacillus cereus D17 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
agtagaaaaagaggctaagccagaagtgaa	Protospacer
.*. .**  ****************** **

29. spacer 1.5|196|30|NZ_ALSA01000086|CRT matches to NC_019401 (Cronobacter phage vB_CsaM_GAP32, complete genome) position: , mismatch: 8, identity: 0.733

ggccaaaccagacgttaagccagaagctaa	CRISPR spacer
accagaaccagaagttaagccagaacctgc	Protospacer
. * .******* ************ **. 

30. spacer 1.8|364|30|NZ_ALSA01000086|CRT matches to NC_047926 (Lactobacillus phage Semele, complete genome) position: , mismatch: 8, identity: 0.733

ggccagaccagaggctaagccagaagttaa	CRISPR spacer
aactgaaccagaagctaagccagaagttcc	Protospacer
..*...******.***************  

31. spacer 1.8|364|30|NZ_ALSA01000086|CRT matches to NZ_CP053930 (Bacillus cereus strain FDAARGOS_797 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ggccagaccagaggctaagccagaagttaa	CRISPR spacer
agtagaaaaagaggctaagccagaagtgaa	Protospacer
.*. ..*  ****************** **

32. spacer 1.8|364|30|NZ_ALSA01000086|CRT matches to NZ_CP013715 (Staphylococcus equorum strain C2014 plasmid pC2014-1, complete sequence) position: , mismatch: 8, identity: 0.733

ggccagaccagaggctaagccagaagttaa	CRISPR spacer
tgttttacctgaggctaagccagaagatac	Protospacer
 *..  *** **************** ** 

33. spacer 1.8|364|30|NZ_ALSA01000086|CRT matches to NZ_CP009299 (Bacillus cereus D17 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

ggccagaccagaggctaagccagaagttaa	CRISPR spacer
agtagaaaaagaggctaagccagaagtgaa	Protospacer
.*. ..*  ****************** **

34. spacer 1.9|412|30|NZ_ALSA01000086|CRT matches to NC_019401 (Cronobacter phage vB_CsaM_GAP32, complete genome) position: , mismatch: 8, identity: 0.733

ggccaaaccagacgttaagccagaagctaa	CRISPR spacer
accagaaccagaagttaagccagaacctgc	Protospacer
. * .******* ************ **. 

35. spacer 1.11|532|30|NZ_ALSA01000086|CRT matches to NC_047926 (Lactobacillus phage Semele, complete genome) position: , mismatch: 8, identity: 0.733

ggccagaccagaggctaagccagaagttaa	CRISPR spacer
aactgaaccagaagctaagccagaagttcc	Protospacer
..*...******.***************  

36. spacer 1.11|532|30|NZ_ALSA01000086|CRT matches to NZ_CP053930 (Bacillus cereus strain FDAARGOS_797 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ggccagaccagaggctaagccagaagttaa	CRISPR spacer
agtagaaaaagaggctaagccagaagtgaa	Protospacer
.*. ..*  ****************** **

37. spacer 1.11|532|30|NZ_ALSA01000086|CRT matches to NZ_CP013715 (Staphylococcus equorum strain C2014 plasmid pC2014-1, complete sequence) position: , mismatch: 8, identity: 0.733

ggccagaccagaggctaagccagaagttaa	CRISPR spacer
tgttttacctgaggctaagccagaagatac	Protospacer
 *..  *** **************** ** 

38. spacer 1.11|532|30|NZ_ALSA01000086|CRT matches to NZ_CP009299 (Bacillus cereus D17 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

ggccagaccagaggctaagccagaagttaa	CRISPR spacer
agtagaaaaagaggctaagccagaagtgaa	Protospacer
.*. ..*  ****************** **

39. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP013715 (Staphylococcus equorum strain C2014 plasmid pC2014-1, complete sequence) position: , mismatch: 8, identity: 0.733

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
tgttttacctgaggctaagccagaagatac	Protospacer
 *..  *** **************** ** 

40. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP020748 (Bacillus mycoides strain Gnyt1 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.733

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
accaaaaccagagcctaagccagaaccaag	Protospacer
. * ********* *********** . *.

41. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NZ_CP009317 (Bacillus cereus 03BB102 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
tccaaaaccagagactaagccagcagtacc	Protospacer
  * *********.********* ***   

42. spacer 1.12|580|30|NZ_ALSA01000086|CRT matches to NC_012473 (Bacillus cereus 03BB102 plasmid p03BB102_179, complete sequence) position: , mismatch: 8, identity: 0.733

ggccaaaccagaggctaagccagaagttaa	CRISPR spacer
tccaaaaccagagactaagccagcagtacc	Protospacer
  * *********.********* ***   

43. spacer 1.7|316|30|NZ_ALSA01000086|CRT matches to MH707430 (Bacillus phage BSP7, complete genome) position: , mismatch: 9, identity: 0.7

agccaaaccagaggctaaaccagaaattaa	CRISPR spacer
ccctaaaccagaggctaaacaagaagaagc	Protospacer
  *.**************** ****.  . 

44. spacer 1.8|364|30|NZ_ALSA01000086|CRT matches to NZ_CP038858 (Escherichia coli strain PigCaeca_2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

ggccagaccagaggctaagccagaagttaa	CRISPR spacer
ccacagaccagaggataagccagactgcta	Protospacer
   *********** *********   . *

45. spacer 1.11|532|30|NZ_ALSA01000086|CRT matches to NZ_CP038858 (Escherichia coli strain PigCaeca_2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

ggccagaccagaggctaagccagaagttaa	CRISPR spacer
ccacagaccagaggataagccagactgcta	Protospacer
   *********** *********   . *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ALSA01000149
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 18303 : 28502 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ALSA01000154
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 51849 : 60386 9 Streptococcus_phage(33.33%) integrase attL 39913:39926|attR 56836:56849
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ALSA01000142
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 703 : 11437 14 Streptococcus_phage(84.62%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_ALSA01000111
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 4575 10 Streptococcus_phage(100.0%) protease,capsid,head,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_ALSA01000132
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALSA01000132_1 124197-124267 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 102731 : 111721 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_ALSA01000030
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ALSA01000030_1 36448-37473 TypeII II-A
15 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448507 Streptococcus satellite phage Javan463, complete genome 1631-1660 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448491 Streptococcus satellite phage Javan43, complete genome 1648-1677 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448392 Streptococcus satellite phage Javan27, complete genome 1647-1676 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448346 Streptococcus satellite phage Javan168, complete genome 1631-1660 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448336 Streptococcus satellite phage Javan15, complete genome 1647-1676 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448327 Streptococcus satellite phage Javan13, complete genome 1648-1677 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448344 Streptococcus satellite phage Javan165, complete genome 1631-1660 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448380 Streptococcus satellite phage Javan24, complete genome 1648-1677 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448343 Streptococcus satellite phage Javan162, complete genome 1631-1660 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448329 Streptococcus satellite phage Javan134, complete genome 1631-1660 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448322 Streptococcus satellite phage Javan12, complete genome 1648-1677 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448660 Streptococcus satellite phage Javan9, complete genome 1648-1677 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448325 Streptococcus satellite phage Javan125, complete genome 1631-1660 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448370 Streptococcus satellite phage Javan22, complete genome 1647-1676 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448518 Streptococcus satellite phage Javan50, complete genome 1648-1677 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448326 Streptococcus satellite phage Javan127, complete genome 1373-1402 0 1.0
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MK448335 Streptococcus satellite phage Javan148, complete genome 1631-1660 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448507 Streptococcus satellite phage Javan463, complete genome 5788-5817 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448491 Streptococcus satellite phage Javan43, complete genome 5022-5051 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448514 Streptococcus satellite phage Javan480, complete genome 3125-3154 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448510 Streptococcus satellite phage Javan469, complete genome 4397-4426 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448347 Streptococcus satellite phage Javan171, complete genome 3125-3154 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448392 Streptococcus satellite phage Javan27, complete genome 4995-5024 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448346 Streptococcus satellite phage Javan168, complete genome 4865-4894 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448336 Streptococcus satellite phage Javan15, complete genome 4454-4483 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448501 Streptococcus satellite phage Javan449, complete genome 4459-4488 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448324 Streptococcus satellite phage Javan121, complete genome 6765-6794 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448661 Streptococcus satellite phage Javan96, complete genome 4486-4515 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448327 Streptococcus satellite phage Javan13, complete genome 5022-5051 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448344 Streptococcus satellite phage Javan165, complete genome 4865-4894 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448380 Streptococcus satellite phage Javan24, complete genome 4869-4898 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448343 Streptococcus satellite phage Javan162, complete genome 5788-5817 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448350 Streptococcus satellite phage Javan19, complete genome 5876-5905 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448519 Streptococcus satellite phage Javan500, complete genome 3647-3676 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448339 Streptococcus satellite phage Javan154, complete genome 4118-4147 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448329 Streptococcus satellite phage Javan134, complete genome 5788-5817 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448329 Streptococcus satellite phage Javan134, complete genome 11144-11173 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448322 Streptococcus satellite phage Javan12, complete genome 5022-5051 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448325 Streptococcus satellite phage Javan125, complete genome 5788-5817 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448325 Streptococcus satellite phage Javan125, complete genome 11144-11173 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448370 Streptococcus satellite phage Javan22, complete genome 4995-5024 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448326 Streptococcus satellite phage Javan127, complete genome 4607-4636 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448323 Streptococcus satellite phage Javan120, complete genome 4001-4030 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448335 Streptococcus satellite phage Javan148, complete genome 5788-5817 0 1.0
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448335 Streptococcus satellite phage Javan148, complete genome 11144-11173 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448522 Streptococcus satellite phage Javan519, complete genome 2983-3012 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448330 Streptococcus satellite phage Javan136, complete genome 3886-3915 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448514 Streptococcus satellite phage Javan480, complete genome 3869-3898 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448512 Streptococcus satellite phage Javan475, complete genome 4255-4284 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448662 Streptococcus satellite phage Javan97, complete genome 7906-7935 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448510 Streptococcus satellite phage Javan469, complete genome 5141-5170 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448328 Streptococcus satellite phage Javan130, complete genome 3886-3915 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448347 Streptococcus satellite phage Javan171, complete genome 3869-3898 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448392 Streptococcus satellite phage Javan27, complete genome 5739-5768 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448508 Streptococcus satellite phage Javan466, complete genome 4330-4359 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448346 Streptococcus satellite phage Javan168, complete genome 5609-5638 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448336 Streptococcus satellite phage Javan15, complete genome 5198-5227 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448333 Streptococcus satellite phage Javan145, complete genome 3886-3915 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448501 Streptococcus satellite phage Javan449, complete genome 5203-5232 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448324 Streptococcus satellite phage Javan121, complete genome 7912-7941 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448661 Streptococcus satellite phage Javan96, complete genome 5633-5662 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448344 Streptococcus satellite phage Javan165, complete genome 5609-5638 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448380 Streptococcus satellite phage Javan24, complete genome 5613-5642 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448343 Streptococcus satellite phage Javan162, complete genome 6532-6561 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448350 Streptococcus satellite phage Javan19, complete genome 6620-6649 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448339 Streptococcus satellite phage Javan154, complete genome 4862-4891 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448329 Streptococcus satellite phage Javan134, complete genome 11888-11917 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448340 Streptococcus satellite phage Javan156, complete genome 3885-3914 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448325 Streptococcus satellite phage Javan125, complete genome 11888-11917 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448513 Streptococcus satellite phage Javan479, complete genome 2983-3012 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448332 Streptococcus satellite phage Javan142, complete genome 3893-3922 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448370 Streptococcus satellite phage Javan22, complete genome 5739-5768 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448520 Streptococcus satellite phage Javan504, complete genome 4255-4284 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448331 Streptococcus satellite phage Javan138, complete genome 3893-3922 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448518 Streptococcus satellite phage Javan50, complete genome 6078-6107 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448516 Streptococcus satellite phage Javan490, complete genome 5193-5222 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448326 Streptococcus satellite phage Javan127, complete genome 5351-5380 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448659 Streptococcus satellite phage Javan89, complete genome 3978-4007 0 1.0
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448335 Streptococcus satellite phage Javan148, complete genome 11888-11917 0 1.0
NZ_ALSA01000030_1 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36880-36909 30 MK448736 Streptococcus phage Javan35, complete genome 36272-36301 0 1.0
NZ_ALSA01000030_1 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36880-36909 30 MK448781 Streptococcus phage Javan5, complete genome 38294-38323 0 1.0
NZ_ALSA01000030_1 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36880-36909 30 MK448938 Streptococcus phage Javan44, complete genome 36273-36302 0 1.0
NZ_ALSA01000030_1 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36880-36909 30 MK448859 Streptococcus phage Javan170, complete genome 40117-40146 0 1.0
NZ_ALSA01000030_1 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36880-36909 30 MK448777 Streptococcus phage Javan491, complete genome 33084-33113 0 1.0
NZ_ALSA01000030_1 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36880-36909 30 MK448916 Streptococcus phage Javan36, complete genome 36272-36301 0 1.0
NZ_ALSA01000030_1 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36880-36909 30 MK448676 Streptococcus phage Javan131, complete genome 43198-43227 0 1.0
NZ_ALSA01000030_1 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36880-36909 30 MK448688 Streptococcus phage Javan161, complete genome 40075-40104 0 1.0
NZ_ALSA01000030_1 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36880-36909 30 MK448673 Streptococcus phage Javan119, complete genome 44103-44132 0 1.0
NZ_ALSA01000030_1 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36946-36975 30 MK448392 Streptococcus satellite phage Javan27, complete genome 4738-4767 0 1.0
NZ_ALSA01000030_1 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36946-36975 30 MK448336 Streptococcus satellite phage Javan15, complete genome 4197-4226 0 1.0
NZ_ALSA01000030_1 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36946-36975 30 MK448660 Streptococcus satellite phage Javan9, complete genome 4198-4227 0 1.0
NZ_ALSA01000030_1 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36946-36975 30 MK448370 Streptococcus satellite phage Javan22, complete genome 4738-4767 0 1.0
NZ_ALSA01000030_1 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37012-37041 30 MK448829 Streptococcus phage Javan7, complete genome 13770-13799 0 1.0
NZ_ALSA01000030_1 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37012-37041 30 MH853355 Streptococcus phage LF1, complete genome 4627-4656 0 1.0
NZ_ALSA01000030_1 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37012-37041 30 MH853358 Streptococcus phage LF4, complete genome 4627-4656 0 1.0
NZ_ALSA01000030_1 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37144-37173 30 MK448971 Streptococcus phage Javan52, complete genome 7364-7393 0 1.0
NZ_ALSA01000030_1 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37210-37239 30 MK448742 Streptococcus phage Javan37, complete genome 12406-12435 0 1.0
NZ_ALSA01000030_1 1.2|36550|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36550-36579 30 MK448971 Streptococcus phage Javan52, complete genome 18786-18815 1 0.967
NZ_ALSA01000030_1 1.2|36550|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36550-36579 30 MK448851 Streptococcus phage Javan14, complete genome 18108-18137 1 0.967
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MK448516 Streptococcus satellite phage Javan490, complete genome 4449-4478 1 0.967
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448491 Streptococcus satellite phage Javan43, complete genome 5766-5795 1 0.967
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448327 Streptococcus satellite phage Javan13, complete genome 5766-5795 1 0.967
NZ_ALSA01000030_1 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36748-36777 30 MK448322 Streptococcus satellite phage Javan12, complete genome 5766-5795 1 0.967
NZ_ALSA01000030_1 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36880-36909 30 MK448678 Streptococcus phage Javan135, complete genome 37821-37850 1 0.967
NZ_ALSA01000030_1 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36946-36975 30 MK448572 Streptococcus satellite phage Javan61, complete genome 2147-2176 1 0.967
NZ_ALSA01000030_1 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37012-37041 30 MK448736 Streptococcus phage Javan35, complete genome 14238-14267 1 0.967
NZ_ALSA01000030_1 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37012-37041 30 MK448956 Streptococcus phage Javan48, complete genome 15833-15862 1 0.967
NZ_ALSA01000030_1 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37012-37041 30 MK448781 Streptococcus phage Javan5, complete genome 16260-16289 1 0.967
NZ_ALSA01000030_1 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37012-37041 30 MK448938 Streptococcus phage Javan44, complete genome 14239-14268 1 0.967
NZ_ALSA01000030_1 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37012-37041 30 MK448911 Streptococcus phage Javan34, complete genome 14238-14267 1 0.967
NZ_ALSA01000030_1 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37012-37041 30 MK448837 Streptococcus phage Javan10, complete genome 12296-12325 1 0.967
NZ_ALSA01000030_1 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37012-37041 30 MK448742 Streptococcus phage Javan37, complete genome 14010-14039 1 0.967
NZ_ALSA01000030_1 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37012-37041 30 MK448916 Streptococcus phage Javan36, complete genome 14238-14267 1 0.967
NZ_ALSA01000030_1 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36946-36975 30 MK448542 Streptococcus satellite phage Javan560, complete genome 3614-3643 2 0.933
NZ_ALSA01000030_1 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36946-36975 30 MK448557 Streptococcus satellite phage Javan594, complete genome 4325-4354 2 0.933
NZ_ALSA01000030_1 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36946-36975 30 MK448560 Streptococcus satellite phage Javan598, complete genome 3329-3358 2 0.933
NZ_ALSA01000030_1 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36946-36975 30 MK448589 Streptococcus satellite phage Javan632, complete genome 2337-2366 2 0.933
NZ_ALSA01000030_1 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37144-37173 30 MK448686 Streptococcus phage Javan157, complete genome 3217-3246 2 0.933
NZ_ALSA01000030_1 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37144-37173 30 MK448951 Streptococcus phage Javan470, complete genome 3217-3246 2 0.933
NZ_ALSA01000030_1 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36946-36975 30 NZ_CP012912 Streptococcus suis strain NSUI060 plasmid pNSUI060a, complete sequence 2440-2469 3 0.9
NZ_ALSA01000030_1 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37144-37173 30 MK448736 Streptococcus phage Javan35, complete genome 6439-6468 4 0.867
NZ_ALSA01000030_1 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37144-37173 30 MK448956 Streptococcus phage Javan48, complete genome 8327-8356 4 0.867
NZ_ALSA01000030_1 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37144-37173 30 MK448781 Streptococcus phage Javan5, complete genome 6439-6468 4 0.867
NZ_ALSA01000030_1 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37144-37173 30 MK448749 Streptococcus phage Javan39, complete genome 8327-8356 4 0.867
NZ_ALSA01000030_1 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37144-37173 30 MK448938 Streptococcus phage Javan44, complete genome 6439-6468 4 0.867
NZ_ALSA01000030_1 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37144-37173 30 MK448911 Streptococcus phage Javan34, complete genome 6439-6468 4 0.867
NZ_ALSA01000030_1 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37144-37173 30 MK448916 Streptococcus phage Javan36, complete genome 6439-6468 4 0.867
NZ_ALSA01000030_1 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36616-36645 30 MG592459 Vibrio phage 1.084.O._10N.261.49.F5, partial genome 121920-121949 6 0.8
NZ_ALSA01000030_1 1.6|36814|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36814-36843 30 AP014119 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C36-MedDCM-OCT-S41-C69, *** SEQUENCING IN PROGRESS *** 7500-7529 6 0.8
NZ_ALSA01000030_1 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37144-37173 30 MK448768 Streptococcus phage Javan47, complete genome 4537-4566 6 0.8
NZ_ALSA01000030_1 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37144-37173 30 NC_048682 Raoultella phage Ro1, complete genome 61462-61491 6 0.8
NZ_ALSA01000030_1 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37144-37173 30 NC_048647 UNVERIFIED: Klebsiella phage KNP2 genomic sequence 74426-74455 6 0.8
NZ_ALSA01000030_1 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37144-37173 30 KX452695 UNVERIFIED: Klebsiella phage KPN2 genomic sequence 74426-74455 6 0.8
NZ_ALSA01000030_1 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37210-37239 30 NZ_CP024320 Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-lp41, complete sequence 25478-25507 6 0.8
NZ_ALSA01000030_1 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37210-37239 30 NZ_CP024393 Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp41, complete sequence 6693-6722 6 0.8
NZ_ALSA01000030_1 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37210-37239 30 NZ_CP024208 Borrelia miyamotoi strain Izh-5 plasmid pIzh5-lp41, complete sequence 6731-6760 6 0.8
NZ_ALSA01000030_1 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37210-37239 30 NZ_CP024336 Borrelia miyamotoi strain Yekat-1 plasmid pYkt1-lp41, complete sequence 6878-6907 6 0.8
NZ_ALSA01000030_1 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37210-37239 30 NZ_CP024354 Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp41-1, complete sequence 37126-37155 6 0.8
NZ_ALSA01000030_1 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37210-37239 30 NZ_CP024355 Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp41-2, complete sequence 6731-6760 6 0.8
NZ_ALSA01000030_1 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37210-37239 30 NZ_CP024374 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-lp41, complete sequence 41309-41338 6 0.8
NZ_ALSA01000030_1 1.14|37342|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37342-37371 30 NC_047897 Lactobacillus phage Lenus, complete genome 65427-65456 6 0.8
NZ_ALSA01000030_1 1.14|37342|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37342-37371 30 AP013698 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C55A-MedDCM-OCT-S36-C68, *** SEQUENCING IN PROGRESS *** 17874-17903 6 0.8
NZ_ALSA01000030_1 1.6|36814|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36814-36843 30 MN871440 UNVERIFIED: Aeromonas phage AsFcp_1, complete genome 72690-72719 7 0.767
NZ_ALSA01000030_1 1.6|36814|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36814-36843 30 NC_023688 Aeromonas phage PX29, complete genome 187441-187470 7 0.767
NZ_ALSA01000030_1 1.6|36814|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36814-36843 30 MH791407 UNVERIFIED: Aeromonas phage AsFcp_4, partial genome 91033-91062 7 0.767
NZ_ALSA01000030_1 1.6|36814|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36814-36843 30 MH791401 UNVERIFIED: Aeromonas phage AsFcp_2, complete genome 136815-136844 7 0.767
NZ_ALSA01000030_1 1.6|36814|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36814-36843 30 MG592435 Vibrio phage 1.055.O._10N.286.55.E9, partial genome 40991-41020 7 0.767
NZ_ALSA01000030_1 1.10|37078|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37078-37107 30 CP027641 Escherichia coli strain 2014C-4705 plasmid unnamed, complete sequence 7655-7684 7 0.767
NZ_ALSA01000030_1 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37210-37239 30 NZ_CP042565 Acinetobacter baumannii strain E47 plasmid pE47_009, complete sequence 560-589 7 0.767
NZ_ALSA01000030_1 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37276-37305 30 MK250021 Prevotella phage Lak-B2, complete genome 201423-201452 7 0.767
NZ_ALSA01000030_1 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37276-37305 30 MK250024 Prevotella phage Lak-B5, complete genome 195433-195462 7 0.767
NZ_ALSA01000030_1 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37276-37305 30 MK250028 Prevotella phage Lak-B9, complete genome 200316-200345 7 0.767
NZ_ALSA01000030_1 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37276-37305 30 MK250023 Prevotella phage Lak-B4, complete genome 201325-201354 7 0.767
NZ_ALSA01000030_1 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37276-37305 30 MK250025 Prevotella phage Lak-B6, complete genome 198626-198655 7 0.767
NZ_ALSA01000030_1 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37276-37305 30 MK250022 Prevotella phage Lak-B3, complete genome 198641-198670 7 0.767
NZ_ALSA01000030_1 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37276-37305 30 MK250027 Prevotella phage Lak-B8, complete genome 201536-201565 7 0.767
NZ_ALSA01000030_1 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37276-37305 30 MK250026 Prevotella phage Lak-B7, complete genome 200607-200636 7 0.767
NZ_ALSA01000030_1 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37276-37305 30 MK250020 Prevotella phage Lak-B1, complete genome 200296-200325 7 0.767
NZ_ALSA01000030_1 1.14|37342|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37342-37371 30 NC_047925 Lactobacillus phage Nyseid, complete genome 67879-67908 7 0.767
NZ_ALSA01000030_1 1.14|37342|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37342-37371 30 KU052488 Lactobacillus phage SA-C12, complete genome 24549-24578 7 0.767
NZ_ALSA01000030_1 1.14|37342|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37342-37371 30 MN693473 Marine virus AFVG_25M504, complete genome 22237-22266 7 0.767
NZ_ALSA01000030_1 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36682-36711 30 MH617280 Inoviridae sp. isolate ctba8, complete genome 216-245 8 0.733
NZ_ALSA01000030_1 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36946-36975 30 MN582070 Myoviridae sp. ctThM1, complete genome 18036-18065 8 0.733
NZ_ALSA01000030_1 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37276-37305 30 MH622943 Myoviridae sp. isolate ctbc_4, complete genome 271041-271070 8 0.733
NZ_ALSA01000030_1 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37276-37305 30 NZ_CP047143 Lactobacillus sp. C25 plasmid unnamed, complete sequence 59944-59973 8 0.733
NZ_ALSA01000030_1 1.14|37342|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 37342-37371 30 AP018932 Escherichia phage KIT03 DNA, complete sequence 154828-154857 8 0.733
NZ_ALSA01000030_1 1.2|36550|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36550-36579 30 NC_049510 Erwinia phage phiEaP-8, complete genome 32344-32373 9 0.7
NZ_ALSA01000030_1 1.6|36814|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT 36814-36843 30 NC_012782 [Eubacterium] eligens ATCC 27750 plasmid unnamed, complete sequence 9031-9060 9 0.7

1. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448507 (Streptococcus satellite phage Javan463, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

2. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448491 (Streptococcus satellite phage Javan43, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

3. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448392 (Streptococcus satellite phage Javan27, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

4. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448346 (Streptococcus satellite phage Javan168, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

5. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448336 (Streptococcus satellite phage Javan15, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

6. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448327 (Streptococcus satellite phage Javan13, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

7. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448344 (Streptococcus satellite phage Javan165, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

8. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448380 (Streptococcus satellite phage Javan24, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

9. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448343 (Streptococcus satellite phage Javan162, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

10. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448329 (Streptococcus satellite phage Javan134, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

11. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448322 (Streptococcus satellite phage Javan12, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

12. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448660 (Streptococcus satellite phage Javan9, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

13. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448325 (Streptococcus satellite phage Javan125, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

14. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448370 (Streptococcus satellite phage Javan22, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

15. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448518 (Streptococcus satellite phage Javan50, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

16. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448326 (Streptococcus satellite phage Javan127, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

17. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448335 (Streptococcus satellite phage Javan148, complete genome) position: , mismatch: 0, identity: 1.0

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tttattgaatagaaatcaatcactaatgtt	Protospacer
******************************

18. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448507 (Streptococcus satellite phage Javan463, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

19. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448491 (Streptococcus satellite phage Javan43, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

20. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448514 (Streptococcus satellite phage Javan480, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

21. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448510 (Streptococcus satellite phage Javan469, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

22. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448347 (Streptococcus satellite phage Javan171, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

23. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448392 (Streptococcus satellite phage Javan27, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

24. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448346 (Streptococcus satellite phage Javan168, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

25. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448336 (Streptococcus satellite phage Javan15, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

26. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448501 (Streptococcus satellite phage Javan449, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

27. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448324 (Streptococcus satellite phage Javan121, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

28. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448661 (Streptococcus satellite phage Javan96, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

29. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448327 (Streptococcus satellite phage Javan13, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

30. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448344 (Streptococcus satellite phage Javan165, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

31. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448380 (Streptococcus satellite phage Javan24, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

32. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448343 (Streptococcus satellite phage Javan162, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

33. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448350 (Streptococcus satellite phage Javan19, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

34. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448519 (Streptococcus satellite phage Javan500, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

35. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448339 (Streptococcus satellite phage Javan154, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

36. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448329 (Streptococcus satellite phage Javan134, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

37. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448329 (Streptococcus satellite phage Javan134, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

38. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448322 (Streptococcus satellite phage Javan12, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

39. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448325 (Streptococcus satellite phage Javan125, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

40. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448325 (Streptococcus satellite phage Javan125, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

41. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448370 (Streptococcus satellite phage Javan22, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

42. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448326 (Streptococcus satellite phage Javan127, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

43. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448323 (Streptococcus satellite phage Javan120, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

44. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448335 (Streptococcus satellite phage Javan148, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

45. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448335 (Streptococcus satellite phage Javan148, complete genome) position: , mismatch: 0, identity: 1.0

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggagatg	Protospacer
******************************

46. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448522 (Streptococcus satellite phage Javan519, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

47. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448330 (Streptococcus satellite phage Javan136, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

48. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448514 (Streptococcus satellite phage Javan480, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

49. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448512 (Streptococcus satellite phage Javan475, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

50. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448662 (Streptococcus satellite phage Javan97, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

51. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448510 (Streptococcus satellite phage Javan469, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

52. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448328 (Streptococcus satellite phage Javan130, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

53. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448347 (Streptococcus satellite phage Javan171, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

54. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448392 (Streptococcus satellite phage Javan27, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

55. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448508 (Streptococcus satellite phage Javan466, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

56. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448346 (Streptococcus satellite phage Javan168, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

57. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448336 (Streptococcus satellite phage Javan15, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

58. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448333 (Streptococcus satellite phage Javan145, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

59. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448501 (Streptococcus satellite phage Javan449, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

60. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448324 (Streptococcus satellite phage Javan121, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

61. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448661 (Streptococcus satellite phage Javan96, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

62. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448344 (Streptococcus satellite phage Javan165, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

63. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448380 (Streptococcus satellite phage Javan24, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

64. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448343 (Streptococcus satellite phage Javan162, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

65. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448350 (Streptococcus satellite phage Javan19, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

66. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448339 (Streptococcus satellite phage Javan154, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

67. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448329 (Streptococcus satellite phage Javan134, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

68. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448340 (Streptococcus satellite phage Javan156, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

69. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448325 (Streptococcus satellite phage Javan125, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

70. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448513 (Streptococcus satellite phage Javan479, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

71. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448332 (Streptococcus satellite phage Javan142, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

72. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448370 (Streptococcus satellite phage Javan22, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

73. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448520 (Streptococcus satellite phage Javan504, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

74. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448331 (Streptococcus satellite phage Javan138, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

75. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448518 (Streptococcus satellite phage Javan50, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

76. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448516 (Streptococcus satellite phage Javan490, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

77. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448326 (Streptococcus satellite phage Javan127, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

78. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448659 (Streptococcus satellite phage Javan89, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

79. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448335 (Streptococcus satellite phage Javan148, complete genome) position: , mismatch: 0, identity: 1.0

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagcaaaagcgtttgaatgacattgaaca	Protospacer
******************************

80. spacer 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 0, identity: 1.0

agagttatgaaacaacctttagctttgaca	CRISPR spacer
agagttatgaaacaacctttagctttgaca	Protospacer
******************************

81. spacer 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 0, identity: 1.0

agagttatgaaacaacctttagctttgaca	CRISPR spacer
agagttatgaaacaacctttagctttgaca	Protospacer
******************************

82. spacer 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 0, identity: 1.0

agagttatgaaacaacctttagctttgaca	CRISPR spacer
agagttatgaaacaacctttagctttgaca	Protospacer
******************************

83. spacer 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448859 (Streptococcus phage Javan170, complete genome) position: , mismatch: 0, identity: 1.0

agagttatgaaacaacctttagctttgaca	CRISPR spacer
agagttatgaaacaacctttagctttgaca	Protospacer
******************************

84. spacer 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448777 (Streptococcus phage Javan491, complete genome) position: , mismatch: 0, identity: 1.0

agagttatgaaacaacctttagctttgaca	CRISPR spacer
agagttatgaaacaacctttagctttgaca	Protospacer
******************************

85. spacer 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 0, identity: 1.0

agagttatgaaacaacctttagctttgaca	CRISPR spacer
agagttatgaaacaacctttagctttgaca	Protospacer
******************************

86. spacer 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448676 (Streptococcus phage Javan131, complete genome) position: , mismatch: 0, identity: 1.0

agagttatgaaacaacctttagctttgaca	CRISPR spacer
agagttatgaaacaacctttagctttgaca	Protospacer
******************************

87. spacer 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448688 (Streptococcus phage Javan161, complete genome) position: , mismatch: 0, identity: 1.0

agagttatgaaacaacctttagctttgaca	CRISPR spacer
agagttatgaaacaacctttagctttgaca	Protospacer
******************************

88. spacer 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 0, identity: 1.0

agagttatgaaacaacctttagctttgaca	CRISPR spacer
agagttatgaaacaacctttagctttgaca	Protospacer
******************************

89. spacer 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448392 (Streptococcus satellite phage Javan27, complete genome) position: , mismatch: 0, identity: 1.0

tttctttacagtcttacaacaataaagaga	CRISPR spacer
tttctttacagtcttacaacaataaagaga	Protospacer
******************************

90. spacer 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448336 (Streptococcus satellite phage Javan15, complete genome) position: , mismatch: 0, identity: 1.0

tttctttacagtcttacaacaataaagaga	CRISPR spacer
tttctttacagtcttacaacaataaagaga	Protospacer
******************************

91. spacer 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448660 (Streptococcus satellite phage Javan9, complete genome) position: , mismatch: 0, identity: 1.0

tttctttacagtcttacaacaataaagaga	CRISPR spacer
tttctttacagtcttacaacaataaagaga	Protospacer
******************************

92. spacer 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448370 (Streptococcus satellite phage Javan22, complete genome) position: , mismatch: 0, identity: 1.0

tttctttacagtcttacaacaataaagaga	CRISPR spacer
tttctttacagtcttacaacaataaagaga	Protospacer
******************************

93. spacer 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448829 (Streptococcus phage Javan7, complete genome) position: , mismatch: 0, identity: 1.0

ccctccgttcgttcgcatgtctgaccactg	CRISPR spacer
ccctccgttcgttcgcatgtctgaccactg	Protospacer
******************************

94. spacer 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MH853355 (Streptococcus phage LF1, complete genome) position: , mismatch: 0, identity: 1.0

ccctccgttcgttcgcatgtctgaccactg	CRISPR spacer
ccctccgttcgttcgcatgtctgaccactg	Protospacer
******************************

95. spacer 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MH853358 (Streptococcus phage LF4, complete genome) position: , mismatch: 0, identity: 1.0

ccctccgttcgttcgcatgtctgaccactg	CRISPR spacer
ccctccgttcgttcgcatgtctgaccactg	Protospacer
******************************

96. spacer 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 0, identity: 1.0

aaaccaaaaaggacaattgaaacacacggc	CRISPR spacer
aaaccaaaaaggacaattgaaacacacggc	Protospacer
******************************

97. spacer 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 0, identity: 1.0

tgattttgaagacaaaataaaaggtgttta	CRISPR spacer
tgattttgaagacaaaataaaaggtgttta	Protospacer
******************************

98. spacer 1.2|36550|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 1, identity: 0.967

caacaatgagtgccaatggtgtagacagaa	CRISPR spacer
caacaatgagtgccaatggtgtagacaaaa	Protospacer
***************************.**

99. spacer 1.2|36550|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 1, identity: 0.967

caacaatgagtgccaatggtgtagacagaa	CRISPR spacer
caacaatgagtgccaatggtgtagacaaaa	Protospacer
***************************.**

100. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448516 (Streptococcus satellite phage Javan490, complete genome) position: , mismatch: 1, identity: 0.967

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
caaaatttattaaacaacgtttgggggatg	Protospacer
*************************.****

101. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448491 (Streptococcus satellite phage Javan43, complete genome) position: , mismatch: 1, identity: 0.967

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagaaaaagcgtttgaatgacattgaaca	Protospacer
**** *************************

102. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448327 (Streptococcus satellite phage Javan13, complete genome) position: , mismatch: 1, identity: 0.967

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagaaaaagcgtttgaatgacattgaaca	Protospacer
**** *************************

103. spacer 1.5|36748|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448322 (Streptococcus satellite phage Javan12, complete genome) position: , mismatch: 1, identity: 0.967

agagcaaaagcgtttgaatgacattgaaca	CRISPR spacer
agagaaaaagcgtttgaatgacattgaaca	Protospacer
**** *************************

104. spacer 1.7|36880|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448678 (Streptococcus phage Javan135, complete genome) position: , mismatch: 1, identity: 0.967

agagttatgaaacaacctttagctttgaca	CRISPR spacer
agagttatgaagcaacctttagctttgaca	Protospacer
***********.******************

105. spacer 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448572 (Streptococcus satellite phage Javan61, complete genome) position: , mismatch: 1, identity: 0.967

tttctttacagtcttacaacaataaagaga	CRISPR spacer
tttctttacagtcttacaacaacaaagaga	Protospacer
**********************.*******

106. spacer 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 1, identity: 0.967

ccctccgttcgttcgcatgtctgaccactg	CRISPR spacer
ccctccgctcgttcgcatgtctgaccactg	Protospacer
*******.**********************

107. spacer 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 1, identity: 0.967

ccctccgttcgttcgcatgtctgaccactg	CRISPR spacer
ccctccgctcgttcgcatgtctgaccactg	Protospacer
*******.**********************

108. spacer 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 1, identity: 0.967

ccctccgttcgttcgcatgtctgaccactg	CRISPR spacer
ccctccgctcgttcgcatgtctgaccactg	Protospacer
*******.**********************

109. spacer 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 1, identity: 0.967

ccctccgttcgttcgcatgtctgaccactg	CRISPR spacer
ccctccgctcgttcgcatgtctgaccactg	Protospacer
*******.**********************

110. spacer 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 1, identity: 0.967

ccctccgttcgttcgcatgtctgaccactg	CRISPR spacer
ccctccgctcgttcgcatgtctgaccactg	Protospacer
*******.**********************

111. spacer 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 1, identity: 0.967

ccctccgttcgttcgcatgtctgaccactg	CRISPR spacer
ccctccgctcgttcgcatgtctgaccactg	Protospacer
*******.**********************

112. spacer 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 1, identity: 0.967

ccctccgttcgttcgcatgtctgaccactg	CRISPR spacer
ccctccgctcgttcgcatgtctgaccactg	Protospacer
*******.**********************

113. spacer 1.9|37012|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 1, identity: 0.967

ccctccgttcgttcgcatgtctgaccactg	CRISPR spacer
ccctccgctcgttcgcatgtctgaccactg	Protospacer
*******.**********************

114. spacer 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448542 (Streptococcus satellite phage Javan560, complete genome) position: , mismatch: 2, identity: 0.933

tttctttacagtcttacaacaataaagaga	CRISPR spacer
tttctttacagtcatacaacaataaagaaa	Protospacer
************* **************.*

115. spacer 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448557 (Streptococcus satellite phage Javan594, complete genome) position: , mismatch: 2, identity: 0.933

tttctttacagtcttacaacaataaagaga	CRISPR spacer
tttctttacagtcatacaacaataaagaaa	Protospacer
************* **************.*

116. spacer 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448560 (Streptococcus satellite phage Javan598, complete genome) position: , mismatch: 2, identity: 0.933

tttctttacagtcttacaacaataaagaga	CRISPR spacer
tttctttacagtcatacaacaataaagaaa	Protospacer
************* **************.*

117. spacer 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448589 (Streptococcus satellite phage Javan632, complete genome) position: , mismatch: 2, identity: 0.933

tttctttacagtcttacaacaataaagaga	CRISPR spacer
tttctttacagtcttacaataacaaagaga	Protospacer
*******************.**.*******

118. spacer 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448686 (Streptococcus phage Javan157, complete genome) position: , mismatch: 2, identity: 0.933

aaaccaaaaaggacaattgaaacacacggc	CRISPR spacer
aaaccaaaatggacaattgagacacacggc	Protospacer
********* **********.*********

119. spacer 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448951 (Streptococcus phage Javan470, complete genome) position: , mismatch: 2, identity: 0.933

aaaccaaaaaggacaattgaaacacacggc	CRISPR spacer
aaaccaaaatggacaattgagacacacggc	Protospacer
********* **********.*********

120. spacer 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012912 (Streptococcus suis strain NSUI060 plasmid pNSUI060a, complete sequence) position: , mismatch: 3, identity: 0.9

tttctttacagtcttacaacaataaagaga	CRISPR spacer
tttctttacagtcatacaacaacaaagaaa	Protospacer
************* ********.*****.*

121. spacer 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 4, identity: 0.867

aaaccaaaaaggacaattgaaacacacggc	CRISPR spacer
agaccaaaatggacaattgaaacacatgtc	Protospacer
*.******* ****************.* *

122. spacer 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 4, identity: 0.867

aaaccaaaaaggacaattgaaacacacggc	CRISPR spacer
agaccaaaatggacaattgaaacacatgtc	Protospacer
*.******* ****************.* *

123. spacer 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 4, identity: 0.867

aaaccaaaaaggacaattgaaacacacggc	CRISPR spacer
agaccaaaatggacaattgaaacacatgtc	Protospacer
*.******* ****************.* *

124. spacer 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 4, identity: 0.867

aaaccaaaaaggacaattgaaacacacggc	CRISPR spacer
agaccaaaatggacaattgaaacacatgtc	Protospacer
*.******* ****************.* *

125. spacer 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 4, identity: 0.867

aaaccaaaaaggacaattgaaacacacggc	CRISPR spacer
agaccaaaatggacaattgaaacacatgtc	Protospacer
*.******* ****************.* *

126. spacer 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 4, identity: 0.867

aaaccaaaaaggacaattgaaacacacggc	CRISPR spacer
agaccaaaatggacaattgaaacacatgtc	Protospacer
*.******* ****************.* *

127. spacer 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 4, identity: 0.867

aaaccaaaaaggacaattgaaacacacggc	CRISPR spacer
agaccaaaatggacaattgaaacacatgtc	Protospacer
*.******* ****************.* *

128. spacer 1.3|36616|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MG592459 (Vibrio phage 1.084.O._10N.261.49.F5, partial genome) position: , mismatch: 6, identity: 0.8

tttattgaatagaaatcaatcactaatgtt	CRISPR spacer
tatattgaatagaaatcggtcactaattcc	Protospacer
* ***************..******** ..

129. spacer 1.6|36814|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to AP014119 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C36-MedDCM-OCT-S41-C69, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

tgaggagattgttaatgattaacttaacat--	CRISPR spacer
tgaagaggttgttaatgattaac--aatcttg	Protospacer
***.***.***************  **. *  

130. spacer 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 6, identity: 0.8

aaaccaaaaaggacaattgaaacacacggc	CRISPR spacer
cgtcaaaaatggacgattgaaacacacggc	Protospacer
 . * **** ****.***************

131. spacer 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NC_048682 (Raoultella phage Ro1, complete genome) position: , mismatch: 6, identity: 0.8

aaaccaaaaaggacaattg---aaacacacggc	CRISPR spacer
taaccaaaaaggacaattgtaaaaacaaat---	Protospacer
 ******************   ***** *.   

132. spacer 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NC_048647 (UNVERIFIED: Klebsiella phage KNP2 genomic sequence) position: , mismatch: 6, identity: 0.8

aaaccaaaaaggacaattg---aaacacacggc	CRISPR spacer
taaccaaaaaggacaattgtaaaaacaaat---	Protospacer
 ******************   ***** *.   

133. spacer 1.11|37144|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to KX452695 (UNVERIFIED: Klebsiella phage KPN2 genomic sequence) position: , mismatch: 6, identity: 0.8

aaaccaaaaaggacaattg---aaacacacggc	CRISPR spacer
taaccaaaaaggacaattgtaaaaacaaat---	Protospacer
 ******************   ***** *.   

134. spacer 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024320 (Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-lp41, complete sequence) position: , mismatch: 6, identity: 0.8

tgattttgaagacaaaataaaaggtgttta---	CRISPR spacer
tgattttgtagacaaaataaaa---cttcaagt	Protospacer
******** *************    **.*   

135. spacer 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024393 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp41, complete sequence) position: , mismatch: 6, identity: 0.8

tgattttgaagacaaaataaaaggtgttta---	CRISPR spacer
tgattttgtagacaaaataaaa---cttcaagt	Protospacer
******** *************    **.*   

136. spacer 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024208 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-lp41, complete sequence) position: , mismatch: 6, identity: 0.8

tgattttgaagacaaaataaaaggtgttta---	CRISPR spacer
tgattttgtagacaaaataaaa---cttcaagt	Protospacer
******** *************    **.*   

137. spacer 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024336 (Borrelia miyamotoi strain Yekat-1 plasmid pYkt1-lp41, complete sequence) position: , mismatch: 6, identity: 0.8

tgattttgaagacaaaataaaaggtgttta---	CRISPR spacer
tgattttgtagacaaaataaaa---cttcaagt	Protospacer
******** *************    **.*   

138. spacer 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024354 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp41-1, complete sequence) position: , mismatch: 6, identity: 0.8

tgattttgaagacaaaataaaaggtgttta---	CRISPR spacer
tgattttgtagacaaaataaaa---cttcaagt	Protospacer
******** *************    **.*   

139. spacer 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024355 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp41-2, complete sequence) position: , mismatch: 6, identity: 0.8

tgattttgaagacaaaataaaaggtgttta---	CRISPR spacer
tgattttgtagacaaaataaaa---cttcaagt	Protospacer
******** *************    **.*   

140. spacer 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024374 (Borrelia miyamotoi strain Izh-14 plasmid pIzh14-lp41, complete sequence) position: , mismatch: 6, identity: 0.8

tgattttgaagacaaaataaaaggtgttta---	CRISPR spacer
tgattttgtagacaaaataaaa---cttcaagt	Protospacer
******** *************    **.*   

141. spacer 1.14|37342|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NC_047897 (Lactobacillus phage Lenus, complete genome) position: , mismatch: 6, identity: 0.8

tggttatacatttactaatccatcagcatt	CRISPR spacer
ggatggtactgttactaatccatcagcatt	Protospacer
 *.* .***  *******************

142. spacer 1.14|37342|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to AP013698 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C55A-MedDCM-OCT-S36-C68, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

-tggttatacatttactaatccatcagcatt	CRISPR spacer
ctcagta-acagttactaatacatcagcatt	Protospacer
 * . ** *** ******** **********

143. spacer 1.6|36814|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MN871440 (UNVERIFIED: Aeromonas phage AsFcp_1, complete genome) position: , mismatch: 7, identity: 0.767

tgaggagattgttaatgattaacttaacat	CRISPR spacer
agtaaggattggtaatgattaactttacat	Protospacer
 * ...***** ************* ****

144. spacer 1.6|36814|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NC_023688 (Aeromonas phage PX29, complete genome) position: , mismatch: 7, identity: 0.767

tgaggagattgttaatgattaacttaacat	CRISPR spacer
agtaaggattggtaatgattaactttacat	Protospacer
 * ...***** ************* ****

145. spacer 1.6|36814|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MH791407 (UNVERIFIED: Aeromonas phage AsFcp_4, partial genome) position: , mismatch: 7, identity: 0.767

tgaggagattgttaatgattaacttaacat	CRISPR spacer
agtaaggattggtaatgattaactttacat	Protospacer
 * ...***** ************* ****

146. spacer 1.6|36814|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MH791401 (UNVERIFIED: Aeromonas phage AsFcp_2, complete genome) position: , mismatch: 7, identity: 0.767

tgaggagattgttaatgattaacttaacat	CRISPR spacer
agtaaggattggtaatgattaactttacat	Protospacer
 * ...***** ************* ****

147. spacer 1.6|36814|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MG592435 (Vibrio phage 1.055.O._10N.286.55.E9, partial genome) position: , mismatch: 7, identity: 0.767

tgaggagattgttaatgattaacttaacat	CRISPR spacer
tttggagattgataatgattaaattaggac	Protospacer
*  ******** ********** ***. *.

148. spacer 1.10|37078|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to CP027641 (Escherichia coli strain 2014C-4705 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

tatatgttctcagaacgcttaaaatctctt	CRISPR spacer
agaattgtctcagaacgcttaaaaactgtt	Protospacer
 . **  ***************** ** **

149. spacer 1.12|37210|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042565 (Acinetobacter baumannii strain E47 plasmid pE47_009, complete sequence) position: , mismatch: 7, identity: 0.767

tgattttgaagacaaaataaaaggtgttta	CRISPR spacer
ggcttttaaagacaaaataaaatgtgtcgt	Protospacer
 * ****.************** ****.  

150. spacer 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK250021 (Prevotella phage Lak-B2, complete genome) position: , mismatch: 7, identity: 0.767

gattatattatctcaaaaagttatcaatca	CRISPR spacer
atttatattatgtcaagaagttatcatcaa	Protospacer
. ********* ****.********* . *

151. spacer 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK250024 (Prevotella phage Lak-B5, complete genome) position: , mismatch: 7, identity: 0.767

gattatattatctcaaaaagttatcaatca	CRISPR spacer
atttatattatgtcaagaagttatcatcaa	Protospacer
. ********* ****.********* . *

152. spacer 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK250028 (Prevotella phage Lak-B9, complete genome) position: , mismatch: 7, identity: 0.767

gattatattatctcaaaaagttatcaatca	CRISPR spacer
atttatattatgtcaagaagttatcatcaa	Protospacer
. ********* ****.********* . *

153. spacer 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 7, identity: 0.767

gattatattatctcaaaaagttatcaatca	CRISPR spacer
atttatattatgtcaagaagttatcatcaa	Protospacer
. ********* ****.********* . *

154. spacer 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK250025 (Prevotella phage Lak-B6, complete genome) position: , mismatch: 7, identity: 0.767

gattatattatctcaaaaagttatcaatca	CRISPR spacer
atttatattatgtcaagaagttatcatcaa	Protospacer
. ********* ****.********* . *

155. spacer 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK250022 (Prevotella phage Lak-B3, complete genome) position: , mismatch: 7, identity: 0.767

gattatattatctcaaaaagttatcaatca	CRISPR spacer
atttatattatgtcaagaagttatcatcaa	Protospacer
. ********* ****.********* . *

156. spacer 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 7, identity: 0.767

gattatattatctcaaaaagttatcaatca	CRISPR spacer
atttatattatgtcaagaagttatcatcaa	Protospacer
. ********* ****.********* . *

157. spacer 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 7, identity: 0.767

gattatattatctcaaaaagttatcaatca	CRISPR spacer
atttatattatgtcaagaagttatcatcaa	Protospacer
. ********* ****.********* . *

158. spacer 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MK250020 (Prevotella phage Lak-B1, complete genome) position: , mismatch: 7, identity: 0.767

gattatattatctcaaaaagttatcaatca	CRISPR spacer
atttatattatgtcaagaagttatcatcaa	Protospacer
. ********* ****.********* . *

159. spacer 1.14|37342|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NC_047925 (Lactobacillus phage Nyseid, complete genome) position: , mismatch: 7, identity: 0.767

tggttatacatttactaatccatcagcatt	CRISPR spacer
ggacggtactgttactaatccatcagcatt	Protospacer
 *.. .***  *******************

160. spacer 1.14|37342|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to KU052488 (Lactobacillus phage SA-C12, complete genome) position: , mismatch: 7, identity: 0.767

tggttatacatttactaatccatcagcatt	CRISPR spacer
ggacggtactgttactaatccatcagcatt	Protospacer
 *.. .***  *******************

161. spacer 1.14|37342|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MN693473 (Marine virus AFVG_25M504, complete genome) position: , mismatch: 7, identity: 0.767

tggttatacatttactaatccatcagcatt	CRISPR spacer
tggtgatacatttactaatcctatgccatc	Protospacer
**** ****************  .. ***.

162. spacer 1.4|36682|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MH617280 (Inoviridae sp. isolate ctba8, complete genome) position: , mismatch: 8, identity: 0.733

caaaatttattaaacaacgtttgggagatg	CRISPR spacer
ataggcttattaaacaacgtttgaaagatt	Protospacer
  *...*****************..**** 

163. spacer 1.8|36946|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MN582070 (Myoviridae sp. ctThM1, complete genome) position: , mismatch: 8, identity: 0.733

tttctttacagtcttacaacaataaagaga	CRISPR spacer
caggtcaaaagtcttacaacactaaagaga	Protospacer
.   *. * ************ ********

164. spacer 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to MH622943 (Myoviridae sp. isolate ctbc_4, complete genome) position: , mismatch: 8, identity: 0.733

gattatattatctcaaaaagttatcaatca	CRISPR spacer
atccatatcatctgaaaaagttatcaattt	Protospacer
. ..****.**** **************. 

165. spacer 1.13|37276|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047143 (Lactobacillus sp. C25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

gattatattatctcaaaaagttatcaatca	CRISPR spacer
agaaaagttatgtcaaaaacttatcaatca	Protospacer
..  * .**** ******* **********

166. spacer 1.14|37342|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to AP018932 (Escherichia phage KIT03 DNA, complete sequence) position: , mismatch: 8, identity: 0.733

tggttatacatttactaatccatcagcatt	CRISPR spacer
gggtaatacatttactaatccaagcgaagg	Protospacer
 *** *****************   * *  

167. spacer 1.2|36550|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NC_049510 (Erwinia phage phiEaP-8, complete genome) position: , mismatch: 9, identity: 0.7

caacaatgagtgccaatggtgtagacagaa	CRISPR spacer
tccgtatgactgccaatggtgtagacactt	Protospacer
.    **** *****************   

168. spacer 1.6|36814|30|NZ_ALSA01000030|PILER-CR,CRISPRCasFinder,CRT matches to NC_012782 ([Eubacterium] eligens ATCC 27750 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tgaggagattgttaatgattaacttaacat	CRISPR spacer
aatcactattgataatgattaacttaacag	Protospacer
 .  .  **** ***************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage