Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AAXG02000021 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont237, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000056 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont50.1, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_AAXG02000041 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont333, whole genome shotgun sequence 0 crisprs csa3,RT 0 0 1 1
NZ_AAXG02000028 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont255, whole genome shotgun sequence 1 crisprs cas3,DinG 0 0 1 0
NZ_AAXG02000062 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont61.1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000007 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont39, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
NZ_AAXG02000020 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont235, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000057 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont54.1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000022 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont239, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000066 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont402, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000019 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont21.1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000025 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont247, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000032 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont278, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000006 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont34, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_AAXG02000047 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont352, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_AAXG02000053 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont400, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000017 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont185, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000054 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont41.1, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_AAXG02000052 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont372, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_AAXG02000042 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont334, whole genome shotgun sequence 0 crisprs DEDDh,csa3 0 0 0 0
NZ_AAXG02000030 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont264, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_AAXG02000029 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont263, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000039 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont331, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000059 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont58.1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000061 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont60.2, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000031 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont275, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000036 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont321, whole genome shotgun sequence 0 crisprs RT,DinG 0 0 0 0
NZ_AAXG02000038 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont330, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000045 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont345, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_AAXG02000065 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont91, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000033 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont29.2, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000002 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont13.1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000048 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont353, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000005 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont30, whole genome shotgun sequence 0 crisprs WYL 0 0 1 0
NZ_AAXG02000011 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont151, whole genome shotgun sequence 0 crisprs csa3,WYL,DinG 0 0 1 1
NZ_AAXG02000040 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont332, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000058 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont57.1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000035 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont319, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000004 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont29, whole genome shotgun sequence 1 crisprs cas3,WYL 0 0 0 0
NZ_AAXG02000037 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont327, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000060 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont60.1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000001 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont12.1, whole genome shotgun sequence 1 crisprs cas3,cas5,cas8c,cas7,cas4,cas1,cas2 0 18 0 0
NZ_AAXG02000043 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont338, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000026 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont248, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000012 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont157, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_AAXG02000051 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont370, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000044 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont34.1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000063 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont64.1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000050 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont367, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000023 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont242, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000015 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont176, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000009 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont133, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_AAXG02000049 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont354, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_AAXG02000018 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont209, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000064 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont65.1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000016 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont181, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000008 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont79, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_AAXG02000034 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont317, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000014 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont173, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000013 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont162, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000010 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont138, whole genome shotgun sequence 2 crisprs cas10,csm3gr7,csx1,cas6 0 2 1 0
NZ_AAXG02000055 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont43.1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000046 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont351, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AAXG02000027 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont251, whole genome shotgun sequence 0 crisprs cas3HD 0 0 0 0
NZ_AAXG02000024 Pseudoflavonifractor capillosus ATCC 29799 B_capillosus-2.0.1_Cont244, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_AAXG02000004
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AAXG02000004_1 56793-57006 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_AAXG02000056
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3642 : 11889 8 uncultured_Caudovirales_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_AAXG02000010
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AAXG02000010_1 269715-269950 TypeIII NA
3 spacers
cas10,csm3gr7,csx1,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AAXG02000010_2 282817-283676 TypeIII NA
12 spacers
cas6,csx1,csm3gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AAXG02000010_1 1.4|269818|32|NZ_AAXG02000010|PILER-CR 269818-269849 32 NC_015383 Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence 279044-279075 6 0.812
NZ_AAXG02000010_1 1.4|269818|32|NZ_AAXG02000010|PILER-CR 269818-269849 32 NZ_CP010898 Pandoraea vervacti strain NS15 plasmid pPV15, complete sequence 64966-64997 8 0.75
NZ_AAXG02000010_2 2.11|283542|36|NZ_AAXG02000010|CRISPRCasFinder,PILER-CR 283542-283577 36 MH321490 Staphylococcus phage Quidividi, complete genome 16848-16883 8 0.778
NZ_AAXG02000010_1 1.4|269818|32|NZ_AAXG02000010|PILER-CR 269818-269849 32 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 323243-323274 9 0.719
NZ_AAXG02000010_1 1.4|269818|32|NZ_AAXG02000010|PILER-CR 269818-269849 32 KX455876 Aeromonas phage Ahp2, complete genome 10074-10105 9 0.719
NZ_AAXG02000010_2 2.11|283542|36|NZ_AAXG02000010|CRISPRCasFinder,PILER-CR 283542-283577 36 KP942676 Pectobacterium carotovorum plasmid Drgb1, complete sequence 60739-60774 9 0.75

1. spacer 1.4|269818|32|NZ_AAXG02000010|PILER-CR matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 6, identity: 0.812

atcgacaagaagcagattgccgctttggaggc	CRISPR spacer
atcgacaagaagcagcttgccgccgaggtagc	Protospacer
*************** *******.  ** .**

2. spacer 1.4|269818|32|NZ_AAXG02000010|PILER-CR matches to NZ_CP010898 (Pandoraea vervacti strain NS15 plasmid pPV15, complete sequence) position: , mismatch: 8, identity: 0.75

atcgacaagaagcagattgccgctttggaggc----	CRISPR spacer
atcgacaagaagctgatagccgcc----aagcccct	Protospacer
************* *** *****.    *.**    

3. spacer 2.11|283542|36|NZ_AAXG02000010|CRISPRCasFinder,PILER-CR matches to MH321490 (Staphylococcus phage Quidividi, complete genome) position: , mismatch: 8, identity: 0.778

cataacttttttatatttatattggaggtaaattag	CRISPR spacer
agtaagggttttatttttatattggaggtatattat	Protospacer
 .***   ****** *************** **** 

4. spacer 1.4|269818|32|NZ_AAXG02000010|PILER-CR matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 9, identity: 0.719

atcgacaagaagcagattgccgctttggaggc	CRISPR spacer
atcggcaagaagcagattgccgcgcagactat	Protospacer
****.****************** . *.  ..

5. spacer 1.4|269818|32|NZ_AAXG02000010|PILER-CR matches to KX455876 (Aeromonas phage Ahp2, complete genome) position: , mismatch: 9, identity: 0.719

atcgacaagaagcagattgccgctttggaggc	CRISPR spacer
cgcgacaagaagcagatcaccgcttacgtctc	Protospacer
  ***************..******  *   *

6. spacer 2.11|283542|36|NZ_AAXG02000010|CRISPRCasFinder,PILER-CR matches to KP942676 (Pectobacterium carotovorum plasmid Drgb1, complete sequence) position: , mismatch: 9, identity: 0.75

cataacttttttatatttatattggaggtaaattag	CRISPR spacer
ttttaattttttatatttatattgtaggttaaaaat	Protospacer
. * * ****************** **** **  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 291218 : 297581 8 Acinetobacter_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_AAXG02000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 205389 : 214509 9 Streptococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_AAXG02000052
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3070 : 14291 13 Streptococcus_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_AAXG02000001
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AAXG02000001_1 7236-12430 TypeI I-C
76 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AAXG02000001_1 1.1|7280|23|NZ_AAXG02000001|PILER-CR 7280-7302 23 NZ_CP049031 Fluviibacterium aquatile strain SC52 plasmid pSC52_3, complete sequence 265240-265262 2 0.913
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MK249139 Blackfly microvirus SF02 isolate 025, complete genome 887-921 2 0.943
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MG945801 UNVERIFIED: Microviridae sp. isolate 4621-1801, complete genome 3232-3266 2 0.943
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MK496724 Capybara microvirus Cap1_SP_141, complete genome 956-990 2 0.943
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MG945691 UNVERIFIED: Microviridae sp. isolate 1422-1801, complete genome 2997-3031 3 0.914
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MH616970 Microviridae sp. isolate ctfd134, complete genome 842-876 4 0.886
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MH572310 Microviridae sp. isolate SD_SC_21, complete genome 869-903 5 0.857
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MG945386 UNVERIFIED: Microviridae sp. isolate 3226-1711, complete genome 3002-3036 5 0.857
NZ_AAXG02000001_1 1.6|7476|34|NZ_AAXG02000001|CRISPRCasFinder,CRT 7476-7509 34 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 971835-971868 6 0.824
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MH617417 Microviridae sp. isolate ctce43, complete genome 902-936 6 0.829
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MK249130 Blackfly microvirus SF02 isolate 013, complete genome 905-939 6 0.829
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MN862338 Kummerowia striata gokushovirus strain pt119-gok-4, complete genome 2397-2431 6 0.829
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MK249170 Blackfly microvirus SF02 isolate 088, complete genome 887-921 6 0.829
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MH572387 Microviridae sp. isolate SD_SF_22, complete genome 860-894 6 0.829
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MK249184 Blackfly microvirus SF02 isolate 116, complete genome 971-1005 6 0.829
NZ_AAXG02000001_1 1.67|11614|33|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11614-11646 33 MG945715 UNVERIFIED: Microviridae sp. isolate 1982-1801, complete genome 597-629 6 0.818
NZ_AAXG02000001_1 1.76|12228|32|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 12228-12259 32 NC_048849 Enterobacter phage vB_EclM_CIP9, complete genome 155112-155143 6 0.812
NZ_AAXG02000001_1 1.3|7272|34|NZ_AAXG02000001|CRISPRCasFinder,CRT 7272-7305 34 NZ_CP049031 Fluviibacterium aquatile strain SC52 plasmid pSC52_3, complete sequence 265229-265262 7 0.794
NZ_AAXG02000001_1 1.8|7612|33|NZ_AAXG02000001|CRISPRCasFinder,CRT 7612-7644 33 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 500582-500614 7 0.788
NZ_AAXG02000001_1 1.43|9992|33|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9992-10024 33 NZ_CP046163 Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence 1154872-1154904 7 0.788
NZ_AAXG02000001_1 1.43|9992|33|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9992-10024 33 NZ_CP046066 Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence 1338264-1338296 7 0.788
NZ_AAXG02000001_1 1.43|9992|33|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9992-10024 33 NZ_CP045356 Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence 421644-421676 7 0.788
NZ_AAXG02000001_1 1.55|10802|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 10802-10835 34 MT889387 Arthrobacter phage DanielleIgnace, complete genome 29942-29975 7 0.794
NZ_AAXG02000001_1 1.55|10802|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 10802-10835 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 2086857-2086890 7 0.794
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MH572497 Microviridae sp. isolate SD_HF_20, complete genome 833-867 7 0.8
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MH616718 Microviridae sp. isolate ctda801, complete genome 887-921 7 0.8
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MH617161 Microviridae sp. isolate ctcc067, complete genome 899-933 7 0.8
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MK249205 Blackfly microvirus SF02 isolate 148, complete genome 875-909 7 0.8
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MH617588 Microviridae sp. isolate ctec913, complete genome 899-933 7 0.8
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MH992193 Apis mellifera associated microvirus 32 isolate INH_SP_209, complete genome 2361-2395 7 0.8
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MH992212 Apis mellifera associated microvirus 10 isolate INH_SP_267, complete genome 2106-2140 7 0.8
NZ_AAXG02000001_1 1.28|8974|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 8974-9007 34 NZ_CP030843 Acidisarcina polymorpha strain SBC82 plasmid pACPOL4, complete sequence 157474-157507 8 0.765
NZ_AAXG02000001_1 1.52|10600|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 10600-10633 34 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 402478-402511 8 0.765
NZ_AAXG02000001_1 1.52|10600|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 10600-10633 34 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 18909-18942 8 0.765
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MG945507 UNVERIFIED: Microviridae sp. isolate 1748-1801, complete genome 2845-2879 8 0.771
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 KT264808 Gokushovirus WZ-2015a isolate 60Brd01, complete genome 887-921 8 0.771
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 KT264823 Gokushovirus WZ-2015a isolate 75Mky05, complete genome 857-891 8 0.771
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MG945243 UNVERIFIED: Microviridae sp. isolate 1823-1602, partial genome 1892-1926 8 0.771
NZ_AAXG02000001_1 1.6|7476|34|NZ_AAXG02000001|CRISPRCasFinder,CRT 7476-7509 34 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 603237-603270 9 0.735
NZ_AAXG02000001_1 1.6|7476|34|NZ_AAXG02000001|CRISPRCasFinder,CRT 7476-7509 34 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1039425-1039458 9 0.735
NZ_AAXG02000001_1 1.6|7476|34|NZ_AAXG02000001|CRISPRCasFinder,CRT 7476-7509 34 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 288652-288685 9 0.735
NZ_AAXG02000001_1 1.6|7476|34|NZ_AAXG02000001|CRISPRCasFinder,CRT 7476-7509 34 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 298392-298425 9 0.735
NZ_AAXG02000001_1 1.20|8427|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 8427-8461 35 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 179609-179643 9 0.743
NZ_AAXG02000001_1 1.52|10600|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 10600-10633 34 CP013100 Candidatus Tenderia electrophaga isolate NRL1 plasmid unnamed, complete sequence 71392-71425 9 0.735
NZ_AAXG02000001_1 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11546-11580 35 MK012456 Microviridae sp. isolate ctcb6, complete genome 3616-3650 9 0.743
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 MN586029 Mycobacterium phage Hannaconda, complete genome 31128-31162 9 0.743
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 KM597530 Mycobacterium phage Bipolar, complete genome 22160-22194 9 0.743
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 MF919504 Mycobacterium phage DmpstrDiver, complete genome 35160-35194 9 0.743
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 MF133445 Mycobacterium phage Lucky2013, complete genome 32646-32680 9 0.743
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 MF072690 Mycobacterium phage Porcelain, complete genome 32331-32365 9 0.743
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 NC_041989 Mycobacterium phage Shauna1, complete genome 22185-22219 9 0.743
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 KY702574 Mycobacterium phage Kingsley, complete genome 21988-22022 9 0.743
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 KM400683 Mycobacterium phage Ariel, complete genome 32115-32149 9 0.743
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 MN693759 Marine virus AFVG_250M56, complete genome 15444-15478 9 0.743
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 MF919534 Mycobacterium phage Superphikiman, complete genome 32513-32547 9 0.743
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 KX610764 Mycobacterium phage Kersh, complete genome 22318-22352 9 0.743
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 NC_023690 Mycobacterium phage Courthouse, complete genome 32519-32553 9 0.743
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 NC_028953 Mycobacterium phage MiaZeal, complete genome 32331-32365 9 0.743
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 MF668284 Mycobacterium phage Squint, complete genome 32448-32482 9 0.743
NZ_AAXG02000001_1 1.3|7272|34|NZ_AAXG02000001|CRISPRCasFinder,CRT 7272-7305 34 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 351105-351138 10 0.706
NZ_AAXG02000001_1 1.6|7476|34|NZ_AAXG02000001|CRISPRCasFinder,CRT 7476-7509 34 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1659099-1659132 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MH107769 Staphylococcus phage vB_SauM_0414_108, complete genome 33674-33707 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MN045228 Staphylococcus phage Maine, complete genome 34548-34581 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 KY794641 Staphylococcus phage vB_Sau_CG, complete genome 134773-134806 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MT554104 Staphylococcus phage ESa1, complete genome 34577-34610 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 KY794642 Staphylococcus phage vB_Sau_Clo6, complete genome 134452-134485 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 NC_023573 Staphylococcus phage phiSA012 DNA, complete genome 26079-26112 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MN539736 UNVERIFIED: Staphylococcus phage vB_SauM-A, complete genome 131878-131911 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 KY581279 Staphylococcus phage pSa-3, complete genome 29573-29606 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 KJ206562 Staphylococcus phage 812 isolate host-range mutant 812F1, complete genome 32392-32425 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MK417514 Staphylococcus virus Sa83, complete genome 32699-32732 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MK584893 Staphylococcus phage vBSM-A1, complete genome 108785-108818 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MN336263 Staphylococcus phage Sb1M_9832, complete genome 25164-25197 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MN336262 Staphylococcus phage Sb1M_6168, complete genome 25164-25197 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 AY954969 Bacteriophage G1, complete genome 128623-128656 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MN539738 UNVERIFIED: Staphylococcus phage vB_SauM-D, complete genome 125406-125439 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MG721208 Staphylococcus phage vB_SauM_LM12, complete genome 114111-114144 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MK331931 Staphylococcus phage Sa30, complete genome 33053-33086 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MT080600 UNVERIFIED: Staphylococcus phage vB_SauM_EW71, complete genome 84210-84243 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 KJ206563 Staphylococcus phage 812 isolate host-range mutant K1/420, complete genome 32405-32438 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 JX080302 Staphylococcus phage 676Z, complete genome 33092-33125 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MN047438 Staphylococcus phage vB_SauM-515A1 32152-32185 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MF405094 Staphylococcus phage JA1, complete genome 32295-32328 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MN336261 Staphylococcus phage Sb1_8383, complete genome 25164-25197 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MN539737 UNVERIFIED: Staphylococcus phage vB_SauM-C, complete genome 132877-132910 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 EU418428 Staphylococcus phage A5W, complete genome 32173-32206 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 KP687431 Staphylococcus phage IME-SA1, complete genome 5525-5558 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MK417516 Staphylococcus virus J-Sa36, complete genome 32199-32232 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MT080602 UNVERIFIED: Staphylococcus phage vB_SauM_EW74, complete genome 125863-125896 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 KJ206561 Staphylococcus phage 812 isolate host-range mutant K1, complete genome 32337-32370 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 NC_047721 Staphylococcus phage SA5, complete genome 38981-39014 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 KP687432 Staphylococcus phage IME-SA2, complete genome 23871-23904 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 NC_047722 Staphylococcus phage Staph1N, complete genome 32170-32203 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MK656892 Staphylococcus phage vBSP-A20, complete genome 104211-104244 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 NC_047723 Staphylococcus phage A3R, complete genome 32045-32078 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 NC_047720 Staphylococcus phage ISP complete genome 128627-128660 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 JX080303 Staphylococcus phage Fi200W, complete genome 33048-33081 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MG656408 Staphylococcus phage B1, complete genome 32722-32755 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 KF766114 Staphylococcus phage K, complete genome 32201-32234 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 KR902361 Staphylococcus phage IME-SA118, complete genome 38620-38653 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MH844529 Staphylococcus phage 812h1, complete genome 33075-33108 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 KC012913 Staphylococcus phage Team1, complete genome 32707-32740 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 JX080305 Staphylococcus phage P4W, complete genome 32150-32183 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 KJ206560 Staphylococcus phage 812 isolate host-range mutant 812a, complete genome 32405-32438 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MF398190 Staphylococcus phage vB_SauM-fRuSau02, complete genome 32721-32754 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 KR908644 Staphylococcus phage IME-SA119, complete genome 13072-13105 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MK417515 Staphylococcus virus Sa87, complete genome 33540-33573 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MH844528 Staphylococcus phage 812, complete genome 32199-32232 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 NC_007066 Staphylococcus phage G1, complete genome 128623-128656 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 JX080304 Staphylococcus phage MSA6, complete genome 32691-32724 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 MH136584 Staphylococcus phage HYZ21, complete genome 23186-23219 10 0.706
NZ_AAXG02000001_1 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9313-9346 34 NC_023009 Staphylococcus phage Sb-1, complete genome 25102-25135 10 0.706
NZ_AAXG02000001_1 1.36|9518|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9518-9551 34 NZ_CP013005 Xanthomonas citri pv. malvacearum strain XcmH1005 plasmid pXcmH, complete sequence 5084-5117 10 0.706
NZ_AAXG02000001_1 1.36|9518|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9518-9551 34 NZ_CP046020 Xanthomonas citri pv. malvacearum strain HD-1 plasmid unnamed1, complete sequence 29356-29389 10 0.706
NZ_AAXG02000001_1 1.36|9518|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 9518-9551 34 MN369758 Gordonia phage NHagos, complete genome 17171-17204 10 0.706
NZ_AAXG02000001_1 1.49|10397|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 10397-10431 35 MN694806 Marine virus AFVG_250M690, complete genome 27767-27801 10 0.714
NZ_AAXG02000001_1 1.55|10802|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 10802-10835 34 NZ_CP039651 Azospirillum sp. TSA2s plasmid p1 221048-221081 10 0.706
NZ_AAXG02000001_1 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 11747-11781 35 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190456-190490 10 0.714
NZ_AAXG02000001_1 1.18|8290|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 8290-8324 35 NZ_CP026539 Desulfovibrio carbinolicus strain DSM 3852 plasmid pDCAR1, complete sequence 95237-95271 11 0.686
NZ_AAXG02000001_1 1.26|8840|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 8840-8874 35 NC_013697 Deftia phage phiW-14, complete genome 71163-71197 11 0.686
NZ_AAXG02000001_1 1.52|10600|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR 10600-10633 34 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 380322-380355 11 0.676

1. spacer 1.1|7280|23|NZ_AAXG02000001|PILER-CR matches to NZ_CP049031 (Fluviibacterium aquatile strain SC52 plasmid pSC52_3, complete sequence) position: , mismatch: 2, identity: 0.913

aaccccgcgcccacgcaggagca	CRISPR spacer
caccccgcgcccacgcacgagca	Protospacer
 **************** *****

2. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MK249139 (Blackfly microvirus SF02 isolate 025, complete genome) position: , mismatch: 2, identity: 0.943

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
agaagatttacgagcgtgatgctcgtggtggtact	Protospacer
***** *************.***************

3. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MG945801 (UNVERIFIED: Microviridae sp. isolate 4621-1801, complete genome) position: , mismatch: 2, identity: 0.943

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
agaagttgtacgagcgtgacgctcgcggtggtact	Protospacer
******* *****************.*********

4. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MK496724 (Capybara microvirus Cap1_SP_141, complete genome) position: , mismatch: 2, identity: 0.943

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
agaagttctacgagcgtgatgctcgtggtggtact	Protospacer
*******.***********.***************

5. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MG945691 (UNVERIFIED: Microviridae sp. isolate 1422-1801, complete genome) position: , mismatch: 3, identity: 0.914

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
aaaagctttatgagcgtgacgctcgtggtggtact	Protospacer
*.***.****.************************

6. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MH616970 (Microviridae sp. isolate ctfd134, complete genome) position: , mismatch: 4, identity: 0.886

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
aaaaaatctacgagcgtgacgctcgtggtggtact	Protospacer
*.**. *.***************************

7. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MH572310 (Microviridae sp. isolate SD_SC_21, complete genome) position: , mismatch: 5, identity: 0.857

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
aaaaaatgtacgagcgcgacgctcgtggtggtact	Protospacer
*.**. * ********.******************

8. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MG945386 (UNVERIFIED: Microviridae sp. isolate 3226-1711, complete genome) position: , mismatch: 5, identity: 0.857

agaagttt--tacgagcgtgacgctcgtggtggtact	CRISPR spacer
--aagctcagtatgagcgtgacgctcgtggtggtact	Protospacer
  ***.*.  **.************************

9. spacer 1.6|7476|34|NZ_AAXG02000001|CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 6, identity: 0.824

tcccaggccgacctgctccaggcgcagaagaacc	CRISPR spacer
acccaggccgacctgatccaggcggagaagatgg	Protospacer
 ************** ******** ******   

10. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MH617417 (Microviridae sp. isolate ctce43, complete genome) position: , mismatch: 6, identity: 0.829

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
aacgattgtacgagcgtgatgctcgtggtggtact	Protospacer
*. ..** ***********.***************

11. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MK249130 (Blackfly microvirus SF02 isolate 013, complete genome) position: , mismatch: 6, identity: 0.829

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
agcgaatgtatgagcgtgacgctcgtggtggtact	Protospacer
** .. * **.************************

12. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MN862338 (Kummerowia striata gokushovirus strain pt119-gok-4, complete genome) position: , mismatch: 6, identity: 0.829

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
agcgtatttacgagcgcgatgctcgtggtggtact	Protospacer
** .  **********.**.***************

13. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MK249170 (Blackfly microvirus SF02 isolate 088, complete genome) position: , mismatch: 6, identity: 0.829

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
agcgtttgtacgagcgtgatgctcgtggtggtacc	Protospacer
** . ** ***********.**************.

14. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MH572387 (Microviridae sp. isolate SD_SF_22, complete genome) position: , mismatch: 6, identity: 0.829

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
aaagattatacgagcgtgacgctcgaggtggtaca	Protospacer
*.*..** ***************** ******** 

15. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MK249184 (Blackfly microvirus SF02 isolate 116, complete genome) position: , mismatch: 6, identity: 0.829

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
agcggatgtacgagcgtgatgctcgtggtggtacg	Protospacer
** .* * ***********.************** 

16. spacer 1.67|11614|33|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MG945715 (UNVERIFIED: Microviridae sp. isolate 1982-1801, complete genome) position: , mismatch: 6, identity: 0.818

tcctatcggg--tttgctgttatcggtaatgtaac	CRISPR spacer
--gaatcagggctttgctgttctcggtaatgtaac	Protospacer
    ***.**  ********* *************

17. spacer 1.76|12228|32|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_048849 (Enterobacter phage vB_EclM_CIP9, complete genome) position: , mismatch: 6, identity: 0.812

tctacggcggcctgggtgccagggtctccggt	CRISPR spacer
tctacgtcggcctgagtgccagggtctacacc	Protospacer
****** *******.************ *. .

18. spacer 1.3|7272|34|NZ_AAXG02000001|CRISPRCasFinder,CRT matches to NZ_CP049031 (Fluviibacterium aquatile strain SC52 plasmid pSC52_3, complete sequence) position: , mismatch: 7, identity: 0.794

aaccccgcgcccacgcaggagcaga-gaaaccggg	CRISPR spacer
caccccgcgcccacgcacgagcagatggcaacgt-	Protospacer
 **************** ******* *. * **  

19. spacer 1.8|7612|33|NZ_AAXG02000001|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 7, identity: 0.788

tccgcatggtccacaaccagaccg--cagcagaac	CRISPR spacer
tccgcctggtccaccaccagaccggcctgcgta--	Protospacer
***** ******** *********  * **. *  

20. spacer 1.43|9992|33|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 7, identity: 0.788

----aatgccgcgaaggactgagcaaaagttcgcccg	CRISPR spacer
cccaaat----cgatggattgagcaaaagttcgccct	Protospacer
    ***    *** ***.***************** 

21. spacer 1.43|9992|33|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 7, identity: 0.788

----aatgccgcgaaggactgagcaaaagttcgcccg	CRISPR spacer
cccaaat----cgatggattgagcaaaagttcgccct	Protospacer
    ***    *** ***.***************** 

22. spacer 1.43|9992|33|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 7, identity: 0.788

----aatgccgcgaaggactgagcaaaagttcgcccg	CRISPR spacer
cccaaat----cgatggattgagcaaaagttcgccct	Protospacer
    ***    *** ***.***************** 

23. spacer 1.55|10802|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MT889387 (Arthrobacter phage DanielleIgnace, complete genome) position: , mismatch: 7, identity: 0.794

catccgg--gggctggacgtgctgccggcggatgac	CRISPR spacer
--accggacgggctggacgtgccgccggcagatgga	Protospacer
   ****  *************.******.****. 

24. spacer 1.55|10802|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

---catccgggggctggacgtgctgccggcggatgac	CRISPR spacer
gcgcat---gagcctggacgtgctgctggccgatgac	Protospacer
   ***   *.* *************.*** ******

25. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MH572497 (Microviridae sp. isolate SD_HF_20, complete genome) position: , mismatch: 7, identity: 0.8

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
aacgctttttagagcgtgacgctcgtggtggtacc	Protospacer
*. . ****  ***********************.

26. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MH616718 (Microviridae sp. isolate ctda801, complete genome) position: , mismatch: 7, identity: 0.8

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
agcgtatgtacgagcgtgatgctcgtggtggtacg	Protospacer
** .  * ***********.************** 

27. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MH617161 (Microviridae sp. isolate ctcc067, complete genome) position: , mismatch: 7, identity: 0.8

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
agcgtatgtacgagcgggacgctcgtggtggtacg	Protospacer
** .  * ******** ***************** 

28. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MK249205 (Blackfly microvirus SF02 isolate 148, complete genome) position: , mismatch: 7, identity: 0.8

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
agcgtttgctcgagcgtgacgcgcgtggtggtact	Protospacer
** . ** . ************ ************

29. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MH617588 (Microviridae sp. isolate ctec913, complete genome) position: , mismatch: 7, identity: 0.8

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
aaaaaatattcgagcgtgatgctcgtggcggtact	Protospacer
*.**. * * *********.********.******

30. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MH992193 (Apis mellifera associated microvirus 32 isolate INH_SP_209, complete genome) position: , mismatch: 7, identity: 0.8

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
agcagatgctcgagcttgatgctcgtggtggtact	Protospacer
** ** * . ***** ***.***************

31. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MH992212 (Apis mellifera associated microvirus 10 isolate INH_SP_267, complete genome) position: , mismatch: 7, identity: 0.8

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
agaaaatgctcgaacgtgatgctcgtggtggtact	Protospacer
****. * . ***.*****.***************

32. spacer 1.28|8974|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030843 (Acidisarcina polymorpha strain SBC82 plasmid pACPOL4, complete sequence) position: , mismatch: 8, identity: 0.765

gttgcccaggtactggacaaccgcaccggcgaac	CRISPR spacer
gttgccctggtactggacaaacgcgaccgggacg	Protospacer
******* ************ ***. * * **  

33. spacer 1.52|10600|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 8, identity: 0.765

ctctccctctccgccgccatctctgcggccctgg	CRISPR spacer
ctctagaactccgccgccatagctgcggccctca	Protospacer
****    ************  ********** .

34. spacer 1.52|10600|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 8, identity: 0.765

ctctccctctccgccgccatctctgcggccctgg	CRISPR spacer
agcgccagcgccgccgccatcgctgcggcgctgg	Protospacer
  * **  * *********** ******* ****

35. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MG945507 (UNVERIFIED: Microviridae sp. isolate 1748-1801, complete genome) position: , mismatch: 8, identity: 0.771

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
aacgttggtatgagcgtgccgctcgtggtggtact	Protospacer
*. . *  **.******* ****************

36. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KT264808 (Gokushovirus WZ-2015a isolate 60Brd01, complete genome) position: , mismatch: 8, identity: 0.771

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
aacgcctatatgagcgtgatgctcgtggtggtact	Protospacer
*. . .* **.********.***************

37. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KT264823 (Gokushovirus WZ-2015a isolate 75Mky05, complete genome) position: , mismatch: 8, identity: 0.771

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
aacgttggtatgagcgtgccgctcgtggtggtact	Protospacer
*. . *  **.******* ****************

38. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MG945243 (UNVERIFIED: Microviridae sp. isolate 1823-1602, partial genome) position: , mismatch: 8, identity: 0.771

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
agcgtctgctcgagcgtgacgctcgcggtggtact	Protospacer
** . .* . ***************.*********

39. spacer 1.6|7476|34|NZ_AAXG02000001|CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 9, identity: 0.735

tcccaggccgacctgctccaggcgcagaagaacc	CRISPR spacer
gcgcatggcgacctgctccaggcgcaggtcgagc	Protospacer
 * ** * *******************.  .* *

40. spacer 1.6|7476|34|NZ_AAXG02000001|CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 9, identity: 0.735

tcccaggccgacctgctccaggcgcagaagaacc	CRISPR spacer
gcgcatggcgacctgctccaggcgcaggtcgagc	Protospacer
 * ** * *******************.  .* *

41. spacer 1.6|7476|34|NZ_AAXG02000001|CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 9, identity: 0.735

tcccaggccgacctgctccaggcgcagaagaacc	CRISPR spacer
gaccaggtcgacctgctccaggcccaactcatcc	Protospacer
  *****.*************** **.   * **

42. spacer 1.6|7476|34|NZ_AAXG02000001|CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 9, identity: 0.735

tcccaggccgacctgctccaggcgcagaagaacc	CRISPR spacer
gaccaggtcgacctgctccaggcccaactcatcc	Protospacer
  *****.*************** **.   * **

43. spacer 1.20|8427|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.743

tgggtggcgcaggcggtggttgcgatgtcgtaccg	CRISPR spacer
gtggtggcgtaggcggtggtggcgatgcggacgcg	Protospacer
  *******.********** ******. *   **

44. spacer 1.52|10600|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to CP013100 (Candidatus Tenderia electrophaga isolate NRL1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ctctccctctccgccgccatctctgcggccctgg	CRISPR spacer
gcggccgagtccgccgccatctatgccgccctgg	Protospacer
 .  **   ************* *** *******

45. spacer 1.66|11546|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MK012456 (Microviridae sp. isolate ctcb6, complete genome) position: , mismatch: 9, identity: 0.743

agaagttttacgagcgtgacgctcgtggtggtact	CRISPR spacer
agcgcctcctcgagcgcgacgctcgcggtggtact	Protospacer
** . .*.. ******.********.*********

46. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MN586029 (Mycobacterium phage Hannaconda, complete genome) position: , mismatch: 9, identity: 0.743

cggtggaaca----tacggaggtggcggcggtggcggcg	CRISPR spacer
----ggggtaccgctacggcggaggcggcggtggcggcg	Protospacer
    **...*    ***** ** ****************

47. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KM597530 (Mycobacterium phage Bipolar, complete genome) position: , mismatch: 9, identity: 0.743

cggtggaaca----tacggaggtggcggcggtggcggcg	CRISPR spacer
----ggggtaccgctacggcggaggcggcggtggcggcg	Protospacer
    **...*    ***** ** ****************

48. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MF919504 (Mycobacterium phage DmpstrDiver, complete genome) position: , mismatch: 9, identity: 0.743

cggtggaaca----tacggaggtggcggcggtggcggcg	CRISPR spacer
----ggggtaccgctacggcggaggcggcggtggcggcg	Protospacer
    **...*    ***** ** ****************

49. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MF133445 (Mycobacterium phage Lucky2013, complete genome) position: , mismatch: 9, identity: 0.743

cggtggaaca----tacggaggtggcggcggtggcggcg	CRISPR spacer
----ggggtaccgctacggcggaggcggcggtggcggcg	Protospacer
    **...*    ***** ** ****************

50. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MF072690 (Mycobacterium phage Porcelain, complete genome) position: , mismatch: 9, identity: 0.743

cggtggaaca----tacggaggtggcggcggtggcggcg	CRISPR spacer
----ggggtaccgctacggcggaggcggcggtggcggcg	Protospacer
    **...*    ***** ** ****************

51. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_041989 (Mycobacterium phage Shauna1, complete genome) position: , mismatch: 9, identity: 0.743

cggtggaacatacggaggtggcggcggtggcggcg	CRISPR spacer
cggctaccgctacggcggaggcggcggtggcggcg	Protospacer
***. .    ***** ** ****************

52. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KY702574 (Mycobacterium phage Kingsley, complete genome) position: , mismatch: 9, identity: 0.743

cggtggaacatacggaggtggcggcggtggcggcg	CRISPR spacer
cggctaccgctacggcggaggcggcggtggcggcg	Protospacer
***. .    ***** ** ****************

53. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KM400683 (Mycobacterium phage Ariel, complete genome) position: , mismatch: 9, identity: 0.743

cggtggaaca----tacggaggtggcggcggtggcggcg	CRISPR spacer
----ggggtaccgctacggcggaggcggcggtggcggcg	Protospacer
    **...*    ***** ** ****************

54. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MN693759 (Marine virus AFVG_250M56, complete genome) position: , mismatch: 9, identity: 0.743

cggtggaacatacggaggtggcggcggtggcggcg	CRISPR spacer
cgcttctgactacggaggtggaggcggtggtggcg	Protospacer
** *   .  *********** ********.****

55. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MF919534 (Mycobacterium phage Superphikiman, complete genome) position: , mismatch: 9, identity: 0.743

cggtggaaca----tacggaggtggcggcggtggcggcg	CRISPR spacer
----ggggtaccgctacggcggaggcggcggtggcggcg	Protospacer
    **...*    ***** ** ****************

56. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KX610764 (Mycobacterium phage Kersh, complete genome) position: , mismatch: 9, identity: 0.743

cggtggaaca----tacggaggtggcggcggtggcggcg	CRISPR spacer
----ggggtaccgctacggcggaggcggcggtggcggcg	Protospacer
    **...*    ***** ** ****************

57. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_023690 (Mycobacterium phage Courthouse, complete genome) position: , mismatch: 9, identity: 0.743

cggtggaaca----tacggaggtggcggcggtggcggcg	CRISPR spacer
----ggggtaccgctacggcggaggcggcggtggcggcg	Protospacer
    **...*    ***** ** ****************

58. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_028953 (Mycobacterium phage MiaZeal, complete genome) position: , mismatch: 9, identity: 0.743

cggtggaaca----tacggaggtggcggcggtggcggcg	CRISPR spacer
----ggggtaccgctacggcggaggcggcggtggcggcg	Protospacer
    **...*    ***** ** ****************

59. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MF668284 (Mycobacterium phage Squint, complete genome) position: , mismatch: 9, identity: 0.743

cggtggaaca----tacggaggtggcggcggtggcggcg	CRISPR spacer
----ggggtaccgctacggcggaggcggcggtggcggcg	Protospacer
    **...*    ***** ** ****************

60. spacer 1.3|7272|34|NZ_AAXG02000001|CRISPRCasFinder,CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 10, identity: 0.706

aaccccgcgcccacgcaggagcagagaaaccggg	CRISPR spacer
cggcgcttgcccaggcaggagcaaagaaaccgaa	Protospacer
 . * * .***** *********.********..

61. spacer 1.6|7476|34|NZ_AAXG02000001|CRISPRCasFinder,CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 10, identity: 0.706

tcccaggccgacctgctccaggcgcagaagaacc	CRISPR spacer
cagctcaccgacatgatccaggcgcagaagagct	Protospacer
.  *  .***** ** ***************.*.

62. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MH107769 (Staphylococcus phage vB_SauM_0414_108, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtattaacc	Protospacer
 .. *********.** *************.   

63. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MN045228 (Staphylococcus phage Maine, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtattaacc	Protospacer
 .. *********.** *************.   

64. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KY794641 (Staphylococcus phage vB_Sau_CG, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtattaacc	Protospacer
 .. *********.** *************.   

65. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MT554104 (Staphylococcus phage ESa1, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtattaacc	Protospacer
 .. *********.** *************.   

66. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KY794642 (Staphylococcus phage vB_Sau_Clo6, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtattaacc	Protospacer
 .. *********.** *************.   

67. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_023573 (Staphylococcus phage phiSA012 DNA, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtattaacc	Protospacer
 .. *********.** *************.   

68. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MN539736 (UNVERIFIED: Staphylococcus phage vB_SauM-A, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

69. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KY581279 (Staphylococcus phage pSa-3, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

70. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ206562 (Staphylococcus phage 812 isolate host-range mutant 812F1, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

71. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MK417514 (Staphylococcus virus Sa83, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

72. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MK584893 (Staphylococcus phage vBSM-A1, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

73. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MN336263 (Staphylococcus phage Sb1M_9832, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

74. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MN336262 (Staphylococcus phage Sb1M_6168, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

75. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to AY954969 (Bacteriophage G1, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

76. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MN539738 (UNVERIFIED: Staphylococcus phage vB_SauM-D, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

77. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MG721208 (Staphylococcus phage vB_SauM_LM12, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

78. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MK331931 (Staphylococcus phage Sa30, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

79. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MT080600 (UNVERIFIED: Staphylococcus phage vB_SauM_EW71, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

80. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ206563 (Staphylococcus phage 812 isolate host-range mutant K1/420, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

81. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to JX080302 (Staphylococcus phage 676Z, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

82. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MN047438 (Staphylococcus phage vB_SauM-515A1) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

83. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MF405094 (Staphylococcus phage JA1, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

84. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MN336261 (Staphylococcus phage Sb1_8383, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

85. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MN539737 (UNVERIFIED: Staphylococcus phage vB_SauM-C, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

86. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to EU418428 (Staphylococcus phage A5W, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

87. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KP687431 (Staphylococcus phage IME-SA1, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

88. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MK417516 (Staphylococcus virus J-Sa36, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

89. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MT080602 (UNVERIFIED: Staphylococcus phage vB_SauM_EW74, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

90. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ206561 (Staphylococcus phage 812 isolate host-range mutant K1, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

91. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_047721 (Staphylococcus phage SA5, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

92. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KP687432 (Staphylococcus phage IME-SA2, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

93. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_047722 (Staphylococcus phage Staph1N, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

94. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MK656892 (Staphylococcus phage vBSP-A20, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

95. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_047723 (Staphylococcus phage A3R, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

96. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_047720 (Staphylococcus phage ISP complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

97. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to JX080303 (Staphylococcus phage Fi200W, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

98. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MG656408 (Staphylococcus phage B1, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

99. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KF766114 (Staphylococcus phage K, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

100. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KR902361 (Staphylococcus phage IME-SA118, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

101. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MH844529 (Staphylococcus phage 812h1, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

102. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KC012913 (Staphylococcus phage Team1, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

103. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to JX080305 (Staphylococcus phage P4W, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

104. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ206560 (Staphylococcus phage 812 isolate host-range mutant 812a, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

105. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MF398190 (Staphylococcus phage vB_SauM-fRuSau02, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

106. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to KR908644 (Staphylococcus phage IME-SA119, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

107. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MK417515 (Staphylococcus virus Sa87, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

108. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MH844528 (Staphylococcus phage 812, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

109. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_007066 (Staphylococcus phage G1, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

110. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to JX080304 (Staphylococcus phage MSA6, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

111. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MH136584 (Staphylococcus phage HYZ21, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

112. spacer 1.33|9313|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_023009 (Staphylococcus phage Sb-1, complete genome) position: , mismatch: 10, identity: 0.706

cgctattaaatacgaataaagagaggtattgcaa	CRISPR spacer
gataattaaatacaaaaaaagagaggtaattata	Protospacer
 .. *********.** *********** *   *

113. spacer 1.36|9518|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013005 (Xanthomonas citri pv. malvacearum strain XcmH1005 plasmid pXcmH, complete sequence) position: , mismatch: 10, identity: 0.706

acaaaagcgccctgttccagttcgaaccgcataa	CRISPR spacer
cgacgcgcgccctattccaggtcgaaccgccgac	Protospacer
  * . *******.****** *********  * 

114. spacer 1.36|9518|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046020 (Xanthomonas citri pv. malvacearum strain HD-1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

acaaaagcgccctgttccagttcgaaccgcataa	CRISPR spacer
cgacgcgcgccctattccaggtcgaaccgccgac	Protospacer
  * . *******.****** *********  * 

115. spacer 1.36|9518|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MN369758 (Gordonia phage NHagos, complete genome) position: , mismatch: 10, identity: 0.706

acaaaagcgccctgttccagttcgaaccgcataa	CRISPR spacer
gcgagagcgccctggtccagatcgaaccggccgg	Protospacer
.*.*.********* ***** ********  ...

116. spacer 1.49|10397|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to MN694806 (Marine virus AFVG_250M690, complete genome) position: , mismatch: 10, identity: 0.714

aggacagccaccaggaccaggataaagagaaggcc	CRISPR spacer
cctctatccaccaggaccaggagacagagaaggat	Protospacer
    .* *************** * ******** .

117. spacer 1.55|10802|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039651 (Azospirillum sp. TSA2s plasmid p1) position: , mismatch: 10, identity: 0.706

catccgggggctggacgtgctgccggcggatgac	CRISPR spacer
gttctcggcgctggacgtgctgacggcggaaaca	Protospacer
  **. ** ************* ******* .  

118. spacer 1.69|11747|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 10, identity: 0.714

cggtggaacatacggaggtggcggcggtggcggcg	CRISPR spacer
cccgagctattacggcggcggcggcggtggcggcg	Protospacer
*   .*    ***** **.****************

119. spacer 1.18|8290|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026539 (Desulfovibrio carbinolicus strain DSM 3852 plasmid pDCAR1, complete sequence) position: , mismatch: 11, identity: 0.686

catcctcgcccgccggtcccggcgggccctggagc	CRISPR spacer
ggccacggcccgccggccccagcgggccctgggcg	Protospacer
 ..* . *********.***.***********.  

120. spacer 1.26|8840|35|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_013697 (Deftia phage phiW-14, complete genome) position: , mismatch: 11, identity: 0.686

caggaac-----atcttgatgggctcctggcacttgccaa	CRISPR spacer
-----attcttgatcttgttgggctcctgggacttgctgt	Protospacer
     *.     ****** *********** ******.. 

121. spacer 1.52|10600|34|NZ_AAXG02000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.676

ctctccctctccgccgccatctctgcggccctgg	CRISPR spacer
gcgcgggtggccgccgacatctctgccgccctgg	Protospacer
 . .   *  ****** ********* *******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_AAXG02000028
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AAXG02000028_1 82015-82221 Unclear NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 146322 : 152345 8 Streptococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_AAXG02000011
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 118173 : 126521 13 Erysipelothrix_phage(28.57%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_AAXG02000011.1|WP_006572312.1|114673_115408_+|hypothetical-protein 114673_115408_+ 244 aa aa AcrIIA11 NA NA No NA
9. NZ_AAXG02000007
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 143510 : 153919 11 Lactobacillus_phage(12.5%) integrase attL 141837:141851|attR 151796:151810
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_AAXG02000045
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10900 : 17390 7 Prochlorococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_AAXG02000041
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 74318 : 85816 16 Erysipelothrix_phage(20.0%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_AAXG02000041.1|WP_006574413.1|71722_72220_+|hypothetical-protein 71722_72220_+ 165 aa aa AcrIIA11 NA NA No NA