Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AARP04000032 Listeria monocytogenes FSL N1-017 cont5.32, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000007 Listeria monocytogenes FSL N1-017 cont5.7, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000041 Listeria monocytogenes FSL N1-017 cont5.41, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000022 Listeria monocytogenes FSL N1-017 cont5.22, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000023 Listeria monocytogenes FSL N1-017 cont5.23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000004 Listeria monocytogenes FSL N1-017 cont5.4, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000056 Listeria monocytogenes FSL N1-017 cont5.56, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000062 Listeria monocytogenes FSL N1-017 cont5.62, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000045 Listeria monocytogenes FSL N1-017 cont5.45, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000058 Listeria monocytogenes FSL N1-017 cont5.58, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_AARP04000016 Listeria monocytogenes FSL N1-017 cont5.16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000069 Listeria monocytogenes FSL N1-017 cont5.69, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000021 Listeria monocytogenes FSL N1-017 cont5.21, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_AARP04000050 Listeria monocytogenes FSL N1-017 cont5.50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000020 Listeria monocytogenes FSL N1-017 cont5.20, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_AARP04000044 Listeria monocytogenes FSL N1-017 cont5.44, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000037 Listeria monocytogenes FSL N1-017 cont5.37, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000060 Listeria monocytogenes FSL N1-017 cont5.60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000051 Listeria monocytogenes FSL N1-017 cont5.51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000047 Listeria monocytogenes FSL N1-017 cont5.47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000018 Listeria monocytogenes FSL N1-017 cont5.18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000074 Listeria monocytogenes FSL N1-017 cont5.74, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000055 Listeria monocytogenes FSL N1-017 cont5.55, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000033 Listeria monocytogenes FSL N1-017 cont5.33, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000038 Listeria monocytogenes FSL N1-017 cont5.38, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
NZ_AARP04000075 Listeria monocytogenes FSL N1-017 cont5.75, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000034 Listeria monocytogenes FSL N1-017 cont5.34, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_AARP04000013 Listeria monocytogenes FSL N1-017 cont5.13, whole genome shotgun sequence 1 crisprs RT,cas6,cas8b2,cas7,cas5,cas3,cas2 2 14 0 0
NZ_AARP04000014 Listeria monocytogenes FSL N1-017 cont5.14, whole genome shotgun sequence 0 crisprs WYL 0 0 1 1
NZ_AARP04000057 Listeria monocytogenes FSL N1-017 cont5.57, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000067 Listeria monocytogenes FSL N1-017 cont5.67, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000042 Listeria monocytogenes FSL N1-017 cont5.42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000010 Listeria monocytogenes FSL N1-017 cont5.10, whole genome shotgun sequence 0 crisprs DinG 0 0 1 0
NZ_AARP04000006 Listeria monocytogenes FSL N1-017 cont5.6, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000028 Listeria monocytogenes FSL N1-017 cont5.28, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000065 Listeria monocytogenes FSL N1-017 cont5.65, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000072 Listeria monocytogenes FSL N1-017 cont5.72, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000017 Listeria monocytogenes FSL N1-017 cont5.17, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_AARP04000053 Listeria monocytogenes FSL N1-017 cont5.53, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_AARP04000054 Listeria monocytogenes FSL N1-017 cont5.54, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_AARP04000068 Listeria monocytogenes FSL N1-017 cont5.68, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000027 Listeria monocytogenes FSL N1-017 cont5.27, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_AARP04000026 Listeria monocytogenes FSL N1-017 cont5.26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000036 Listeria monocytogenes FSL N1-017 cont5.36, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000030 Listeria monocytogenes FSL N1-017 cont5.30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000066 Listeria monocytogenes FSL N1-017 cont5.66, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000076 Listeria monocytogenes FSL N1-017 cont5.76, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000025 Listeria monocytogenes FSL N1-017 cont5.25, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_AARP04000001 Listeria monocytogenes FSL N1-017 cont5.1, whole genome shotgun sequence 1 crisprs cas9,cas1,cas2,csn2 0 30 0 0
NZ_AARP04000049 Listeria monocytogenes FSL N1-017 cont5.49, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_AARP04000046 Listeria monocytogenes FSL N1-017 cont5.46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000003 Listeria monocytogenes FSL N1-017 cont5.3, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000079 Listeria monocytogenes FSL N1-017 cont5.79, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000063 Listeria monocytogenes FSL N1-017 cont5.63, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000039 Listeria monocytogenes FSL N1-017 cont5.39, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_AARP04000073 Listeria monocytogenes FSL N1-017 cont5.73, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000071 Listeria monocytogenes FSL N1-017 cont5.71, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000035 Listeria monocytogenes FSL N1-017 cont5.35, whole genome shotgun sequence 0 crisprs csa3,cas5 0 0 1 0
NZ_AARP04000077 Listeria monocytogenes FSL N1-017 cont5.77, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000024 Listeria monocytogenes FSL N1-017 cont5.24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000070 Listeria monocytogenes FSL N1-017 cont5.70, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000015 Listeria monocytogenes FSL N1-017 cont5.15, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_AARP04000031 Listeria monocytogenes FSL N1-017 cont5.31, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000002 Listeria monocytogenes FSL N1-017 cont5.2, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_AARP04000009 Listeria monocytogenes FSL N1-017 cont5.9, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000048 Listeria monocytogenes FSL N1-017 cont5.48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000008 Listeria monocytogenes FSL N1-017 cont5.8, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_AARP04000029 Listeria monocytogenes FSL N1-017 cont5.29, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_AARP04000052 Listeria monocytogenes FSL N1-017 cont5.52, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_AARP04000040 Listeria monocytogenes FSL N1-017 cont5.40, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_AARP04000061 Listeria monocytogenes FSL N1-017 cont5.61, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000005 Listeria monocytogenes FSL N1-017 cont5.5, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_AARP04000078 Listeria monocytogenes FSL N1-017 cont5.78, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000043 Listeria monocytogenes FSL N1-017 cont5.43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000011 Listeria monocytogenes FSL N1-017 cont5.11, whole genome shotgun sequence 0 crisprs csa3 0 0 2 0
NZ_AARP04000059 Listeria monocytogenes FSL N1-017 cont5.59, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000012 Listeria monocytogenes FSL N1-017 cont5.12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000019 Listeria monocytogenes FSL N1-017 cont5.19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AARP04000064 Listeria monocytogenes FSL N1-017 cont5.64, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_AARP04000013
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AARP04000013_1 49328-50655 Unclear I-A
20 spacers
cas2,cas3,cas5,cas7,cas8b2,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_AARP04000013_1 1.2|49433|32|NZ_AARP04000013|PILER-CR 49433-49464 32 NZ_AARP04000038.1 23393-23424 0 1.0
NZ_AARP04000013_1 1.4|49423|36|NZ_AARP04000013|CRISPRCasFinder,CRT 49423-49458 36 NZ_AARP04000038.1 23389-23424 0 1.0

1. spacer 1.2|49433|32|NZ_AARP04000013|PILER-CR matches to position: 23393-23424, mismatch: 0, identity: 1.0

cagtacaagcaagggttattgagttaaatatt	CRISPR spacer
cagtacaagcaagggttattgagttaaatatt	Protospacer
********************************

2. spacer 1.4|49423|36|NZ_AARP04000013|CRISPRCasFinder,CRT matches to position: 23389-23424, mismatch: 0, identity: 1.0

attacagtacaagcaagggttattgagttaaatatt	CRISPR spacer
attacagtacaagcaagggttattgagttaaatatt	Protospacer
************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AARP04000013_1 1.2|49433|32|NZ_AARP04000013|PILER-CR 49433-49464 32 DQ003642 Listeria phage A006, complete genome 16676-16707 0 1.0
NZ_AARP04000013_1 1.4|49423|36|NZ_AARP04000013|CRISPRCasFinder,CRT 49423-49458 36 DQ003642 Listeria phage A006, complete genome 16672-16707 0 1.0
NZ_AARP04000013_1 1.5|49488|35|NZ_AARP04000013|CRISPRCasFinder,CRT 49488-49522 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 31167-31201 0 1.0
NZ_AARP04000013_1 1.9|49751|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 49751-49786 36 KJ094023 Listeria phage LP-101, complete genome 18341-18376 0 1.0
NZ_AARP04000013_1 1.14|50076|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 50076-50111 36 NC_003216 Listeria phage A118, complete genome 18563-18598 0 1.0
NZ_AARP04000013_1 1.14|50076|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 50076-50111 36 AJ242593 Bacteriophage A118 complete genome 18563-18598 0 1.0
NZ_AARP04000013_1 1.18|50333|34|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 50333-50366 34 NC_003216 Listeria phage A118, complete genome 19172-19205 0 1.0
NZ_AARP04000013_1 1.18|50333|34|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 50333-50366 34 AJ242593 Bacteriophage A118 complete genome 19172-19205 0 1.0
NZ_AARP04000013_1 1.1|49362|37|NZ_AARP04000013|PILER-CR 49362-49398 37 KJ094023 Listeria phage LP-101, complete genome 9186-9222 1 0.973
NZ_AARP04000013_1 1.3|49357|37|NZ_AARP04000013|CRISPRCasFinder,CRT 49357-49393 37 KJ094023 Listeria phage LP-101, complete genome 9186-9222 1 0.973
NZ_AARP04000013_1 1.8|49686|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 49686-49721 36 KJ094023 Listeria phage LP-101, complete genome 17910-17945 1 0.972
NZ_AARP04000013_1 1.1|49362|37|NZ_AARP04000013|PILER-CR 49362-49398 37 MT500540 Listeria phage LP-HM00113468, complete genome 35729-35765 2 0.946
NZ_AARP04000013_1 1.3|49357|37|NZ_AARP04000013|CRISPRCasFinder,CRT 49357-49393 37 MT500540 Listeria phage LP-HM00113468, complete genome 35729-35765 2 0.946
NZ_AARP04000013_1 1.13|50011|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 50011-50046 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 26132-26167 2 0.944
NZ_AARP04000013_1 1.19|50396|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 50396-50431 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 41996-42031 3 0.917
NZ_AARP04000013_1 1.8|49686|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 49686-49721 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 227438-227473 4 0.889
NZ_AARP04000013_1 1.21|50527|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 50527-50562 36 FW590615 JP 2010534058-A/25: ANTIBIOTIC RESISTANCE FREE LISTERIA STRAINS AND METHODS FOR CONSTRUCTING AND USING SAME 3844-3879 4 0.889
NZ_AARP04000013_1 1.21|50527|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 50527-50562 36 HI504184 Sequence 26 from Patent EP2147092 3844-3879 4 0.889
NZ_AARP04000013_1 1.21|50527|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 50527-50562 36 AJ417489 bacteriophage U153 int gene for U153 integrase 3844-3879 4 0.889
NZ_AARP04000013_1 1.19|50396|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 50396-50431 36 KJ094023 Listeria phage LP-101, complete genome 32760-32795 5 0.861
NZ_AARP04000013_1 1.16|50204|34|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 50204-50237 34 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 1764851-1764884 6 0.824
NZ_AARP04000013_1 1.22|50592|35|NZ_AARP04000013|CRISPRCasFinder,CRT 50592-50626 35 MN694189 Marine virus AFVG_250M578, complete genome 47879-47913 6 0.829
NZ_AARP04000013_1 1.21|50527|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 50527-50562 36 NC_019743 Microcoleus sp. PCC 7113 plasmid pMIC7113.08, complete sequence 4997-5032 8 0.778
NZ_AARP04000013_1 1.5|49488|35|NZ_AARP04000013|CRISPRCasFinder,CRT 49488-49522 35 NZ_CP013615 Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence 176358-176392 9 0.743
NZ_AARP04000013_1 1.16|50204|34|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR 50204-50237 34 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 39302-39335 9 0.735
NZ_AARP04000013_1 1.22|50592|35|NZ_AARP04000013|CRISPRCasFinder,CRT 50592-50626 35 MK448625 Streptococcus satellite phage Javan738, complete genome 5960-5994 9 0.743
NZ_AARP04000013_1 1.22|50592|35|NZ_AARP04000013|CRISPRCasFinder,CRT 50592-50626 35 MK448449 Streptococcus satellite phage Javan356, complete genome 4490-4524 9 0.743
NZ_AARP04000013_1 1.22|50592|35|NZ_AARP04000013|CRISPRCasFinder,CRT 50592-50626 35 MK448636 Streptococcus satellite phage Javan749, complete genome 6112-6146 9 0.743
NZ_AARP04000013_1 1.22|50592|35|NZ_AARP04000013|CRISPRCasFinder,CRT 50592-50626 35 NZ_CP045037 Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence 34734-34768 9 0.743
NZ_AARP04000013_1 1.22|50592|35|NZ_AARP04000013|CRISPRCasFinder,CRT 50592-50626 35 NZ_CP018177 Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence 11325-11359 9 0.743
NZ_AARP04000013_1 1.22|50592|35|NZ_AARP04000013|CRISPRCasFinder,CRT 50592-50626 35 NZ_CP018181 Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence 63608-63642 9 0.743

1. spacer 1.2|49433|32|NZ_AARP04000013|PILER-CR matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

cagtacaagcaagggttattgagttaaatatt	CRISPR spacer
cagtacaagcaagggttattgagttaaatatt	Protospacer
********************************

2. spacer 1.4|49423|36|NZ_AARP04000013|CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

attacagtacaagcaagggttattgagttaaatatt	CRISPR spacer
attacagtacaagcaagggttattgagttaaatatt	Protospacer
************************************

3. spacer 1.5|49488|35|NZ_AARP04000013|CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 0, identity: 1.0

attaatgataagagcggaaagaaaactttcaaggg	CRISPR spacer
attaatgataagagcggaaagaaaactttcaaggg	Protospacer
***********************************

4. spacer 1.9|49751|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

aagttcaaaacctcccacacccgctatgaataaatt	CRISPR spacer
aagttcaaaacctcccacacccgctatgaataaatt	Protospacer
************************************

5. spacer 1.14|50076|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

6. spacer 1.14|50076|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

7. spacer 1.18|50333|34|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

agaagcgttagcggcattgttcgaaagtaattta	CRISPR spacer
agaagcgttagcggcattgttcgaaagtaattta	Protospacer
**********************************

8. spacer 1.18|50333|34|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

agaagcgttagcggcattgttcgaaagtaattta	CRISPR spacer
agaagcgttagcggcattgttcgaaagtaattta	Protospacer
**********************************

9. spacer 1.1|49362|37|NZ_AARP04000013|PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.973

caatgcttaaaccgagagcatcaaattgttcccatgc	CRISPR spacer
caatgcttaaacctagagcatcaaattgttcccatgc	Protospacer
************* ***********************

10. spacer 1.3|49357|37|NZ_AARP04000013|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.973

caatgcttaaaccgagagcatcaaattgttcccatgc	CRISPR spacer
caatgcttaaacctagagcatcaaattgttcccatgc	Protospacer
************* ***********************

11. spacer 1.8|49686|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

cttcctactttttgacataaaaaataagccgagttg	CRISPR spacer
cttcctactttttgacataaaaaataagccgaattg	Protospacer
********************************.***

12. spacer 1.1|49362|37|NZ_AARP04000013|PILER-CR matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 2, identity: 0.946

caatgcttaaaccgagagcatcaaattgttcccatgc	CRISPR spacer
caatgcttaacccaagagcatcaaattgttcccatgc	Protospacer
********** **.***********************

13. spacer 1.3|49357|37|NZ_AARP04000013|CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 2, identity: 0.946

caatgcttaaaccgagagcatcaaattgttcccatgc	CRISPR spacer
caatgcttaacccaagagcatcaaattgttcccatgc	Protospacer
********** **.***********************

14. spacer 1.13|50011|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 2, identity: 0.944

gtccacatcgacaataaaaaacacattgtatcactt	CRISPR spacer
gtccacattgacaacaaaaaacacattgtatcactt	Protospacer
********.*****.*********************

15. spacer 1.19|50396|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 3, identity: 0.917

tataaaatattgcccaatgtgcggaaggagtttgga	CRISPR spacer
tataaaatattgtccaatgtgtggaaggagtttggg	Protospacer
************.********.*************.

16. spacer 1.8|49686|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 4, identity: 0.889

cttcctactttttgacataaaaaataagccgagttg	CRISPR spacer
cttcctactttttgacataaaaaataagccttgctc	Protospacer
******************************  *.* 

17. spacer 1.21|50527|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to FW590615 (JP 2010534058-A/25: ANTIBIOTIC RESISTANCE FREE LISTERIA STRAINS AND METHODS FOR CONSTRUCTING AND USING SAME) position: , mismatch: 4, identity: 0.889

gtgtaattcttaattccgtattgattcgctagtttt	CRISPR spacer
ttataatccttaattccgtattgatttgctagtttt	Protospacer
 *.****.******************.*********

18. spacer 1.21|50527|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to HI504184 (Sequence 26 from Patent EP2147092) position: , mismatch: 4, identity: 0.889

gtgtaattcttaattccgtattgattcgctagtttt	CRISPR spacer
ttataatccttaattccgtattgatttgctagtttt	Protospacer
 *.****.******************.*********

19. spacer 1.21|50527|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to AJ417489 (bacteriophage U153 int gene for U153 integrase) position: , mismatch: 4, identity: 0.889

gtgtaattcttaattccgtattgattcgctagtttt	CRISPR spacer
ttataatccttaattccgtattgatttgctagtttt	Protospacer
 *.****.******************.*********

20. spacer 1.19|50396|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 5, identity: 0.861

tataaaatattgcccaatgtgcggaaggagtttgga	CRISPR spacer
cattgaattttgcccaatgtgcggaaggagcttgga	Protospacer
.** .*** *********************.*****

21. spacer 1.16|50204|34|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.824

agaaaaaaaacatctttccaatttgttgttttgc	CRISPR spacer
agcaaaaaaacatctttcctatttgttttatcac	Protospacer
** **************** ******* * *..*

22. spacer 1.22|50592|35|NZ_AARP04000013|CRISPRCasFinder,CRT matches to MN694189 (Marine virus AFVG_250M578, complete genome) position: , mismatch: 6, identity: 0.829

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
taataaaaaatgagggcttagaaaatgaaaaaatt	Protospacer
*  *.*** ******.***************** *

23. spacer 1.21|50527|36|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to NC_019743 (Microcoleus sp. PCC 7113 plasmid pMIC7113.08, complete sequence) position: , mismatch: 8, identity: 0.778

gtgtaattcttaattccgtattgattcgctagtttt---	CRISPR spacer
gtgtaattcttactgccgtattgatt---taactctgaa	Protospacer
************ * ***********   **..*.*   

24. spacer 1.5|49488|35|NZ_AARP04000013|CRISPRCasFinder,CRT matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 9, identity: 0.743

attaatgataagagcggaaagaaaactttcaaggg	CRISPR spacer
gaaattaaaaagagagcaaagaaaactttcaagga	Protospacer
.  * *.* ***** * *****************.

25. spacer 1.16|50204|34|NZ_AARP04000013|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

agaaaaaaaacatctttccaatttgttgttttgc-----	CRISPR spacer
aagaaaaaaacatatttccaatt-----ttttccaaaaa	Protospacer
*..********** *********     **** *     

26. spacer 1.22|50592|35|NZ_AARP04000013|CRISPRCasFinder,CRT matches to MK448625 (Streptococcus satellite phage Javan738, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtatgaactatgaggacttagaaagtgaagacctg	Protospacer
 * **** ****************.****.*    

27. spacer 1.22|50592|35|NZ_AARP04000013|CRISPRCasFinder,CRT matches to MK448449 (Streptococcus satellite phage Javan356, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtatgaactatgaggacttagaaagtgaagacctg	Protospacer
 * **** ****************.****.*    

28. spacer 1.22|50592|35|NZ_AARP04000013|CRISPRCasFinder,CRT matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtctgaactatgaggacttagaaagtgaagacctg	Protospacer
 *.**** ****************.****.*    

29. spacer 1.22|50592|35|NZ_AARP04000013|CRISPRCasFinder,CRT matches to NZ_CP045037 (Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

30. spacer 1.22|50592|35|NZ_AARP04000013|CRISPRCasFinder,CRT matches to NZ_CP018177 (Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

31. spacer 1.22|50592|35|NZ_AARP04000013|CRISPRCasFinder,CRT matches to NZ_CP018181 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_AARP04000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11181 : 21910 17 Listeria_phage(40.0%) holin,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_AARP04000038
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1202 : 23947 32 Listeria_phage(100.0%) terminase,tail NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_AARP04000038.1|WP_003731707.1|3684_3945_+|hypothetical-protein 3684_3945_+ 86 aa aa NA NA NA 1202-23947 yes
4. NZ_AARP04000034
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 464 : 28753 32 Listeria_phage(96.15%) protease,portal,terminase,tail,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_AARP04000027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 30132 : 38418 8 Prochlorococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_AARP04000058
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AARP04000058_1 156-740 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_AARP04000049
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3026 : 6887 7 Listeria_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_AARP04000052
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 59 : 4049 6 Listeria_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_AARP04000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 50912 : 81832 35 Erysipelothrix_phage(71.43%) head,protease,portal,tail,capsid,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_AARP04000039
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2 : 21833 25 Listeria_phage(92.0%) terminase,plate,portal,tail,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_AARP04000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2775 : 10197 8 Hokovirus(33.33%) NA NA
DBSCAN-SWA_2 130334 : 134620 8 Listeria_phage(100.0%) integrase attL 126366:126380|attR 132134:132148
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_AARP04000053
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 74 : 3982 7 Listeria_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_AARP04000025
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 68 : 47585 72 Listeria_phage(98.57%) integrase,holin,plate,terminase,head attL 16:35|attR 48120:48139
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_AARP04000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11 : 2822 7 Listeria_phage(85.71%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_AARP04000014.1|WP_003731276.1|983_1235_-|hypothetical-protein 983_1235_- 83 aa aa AcrIIA12 NA NA 11-2822 NA
15. NZ_AARP04000035
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 6626 10 Streptococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
16. NZ_AARP04000011
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 72834 : 80676 7 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 84594 : 91131 10 Listeria_phage(80.0%) integrase attL 82351:82363|attR 89638:89650
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
17. NZ_AARP04000054
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 3349 9 Listeria_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
18. NZ_AARP04000001
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AARP04000001_1 312885-315497 TypeII II-A,II-B
39 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AARP04000001_1 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT 312987-313016 30 MH299806 Listeria phage LP-KV022, complete genome 52817-52846 0 1.0
NZ_AARP04000001_1 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT 312987-313016 30 MN114083 Listeria phage LP-013, complete genome 48513-48542 0 1.0
NZ_AARP04000001_1 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT 312987-313016 30 NC_021785 Listeria phage LP-110, complete genome 10535-10564 0 1.0
NZ_AARP04000001_1 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT 312987-313016 30 KJ094026 Listeria phage LP-032 contig 3, partial genome 10007-10036 0 1.0
NZ_AARP04000001_1 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT 312987-313016 30 MN128593 Listeria phage LP-031, complete genome 47633-47662 0 1.0
NZ_AARP04000001_1 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT 312987-313016 30 NC_021787 Listeria phage LP-037, complete genome 5014-5043 0 1.0
NZ_AARP04000001_1 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT 312987-313016 30 JX442241 Listeria phage P70, complete genome 54951-54980 0 1.0
NZ_AARP04000001_1 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT 312987-313016 30 KJ094020 Listeria phage LP-026, complete genome 31166-31195 0 1.0
NZ_AARP04000001_1 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT 312987-313016 30 KJ094021 Listeria phage LP-114, complete genome 38339-38368 0 1.0
NZ_AARP04000001_1 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT 312987-313016 30 MN114082 Listeria phage LP-010, complete genome 47798-47827 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 MT438761 Listeria virus P61, complete genome 7010-7039 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 MT668624 Listeria phage LP-Mix_6.2, complete genome 131100-131129 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 KJ668718 Listeria phage LMTA-34 hypothetical proteins and DNA modification protein genes, complete cds 1258-1287 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 MT178766 Listeria virus P100plus, complete genome 96120-96149 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 NC_047872 Listeria phage LMTA-94, complete genome 2498-2527 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 MT178767 Listeria virus P200, complete genome 96121-96150 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 KJ591605 Listeria phage LMTA-57, complete genome 12879-12908 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 MN128594 Listeria phage LP-066, complete genome 131590-131619 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 NC_042048 Listeria phage LMTA-34, complete genome 8562-8591 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 MK792752 UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome 6613-6642 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 NC_041862 Listeria phage LP-064, complete genome 3914-3943 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 KJ094030 Listeria phage LP-083-2, complete genome 981-1010 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 JX126918 Listeria phage LP-125, complete genome 3914-3943 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 NC_024360 Listeria phage LMSP-25, complete genome 8562-8591 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 JQ797329 Listeria phage vB_LmoM_AG20, complete genome 129717-129746 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 KJ094031 Listeria phage LP-124, complete genome 98866-98895 0 1.0
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 DQ003638 Listeria phage A511, complete genome 129539-129568 0 1.0
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 DQ003637 Listeria phage A500, complete genome 28012-28041 0 1.0
NZ_AARP04000001_1 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313515-313544 30 DQ003637 Listeria phage A500, complete genome 37232-37261 0 1.0
NZ_AARP04000001_1 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313515-313544 30 KJ094022 Listeria phage LP-030-3, complete genome 6787-6816 0 1.0
NZ_AARP04000001_1 1.11|313581|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313581-313610 30 MH341453 Listeria phage PSU-VKH-LP041, complete genome 12781-12810 0 1.0
NZ_AARP04000001_1 1.11|313581|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313581-313610 30 NC_009813 Listeria phage B054, complete genome 12781-12810 0 1.0
NZ_AARP04000001_1 1.18|314044|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314044-314073 30 MH341452 Listeria phage PSU-VKH-LP040, complete genome 8193-8222 0 1.0
NZ_AARP04000001_1 1.18|314044|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314044-314073 30 KJ094022 Listeria phage LP-030-3, complete genome 16573-16602 0 1.0
NZ_AARP04000001_1 1.18|314044|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314044-314073 30 KP399678 Listeria phage vB_LmoS_293, complete genome 8180-8209 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 MT438761 Listeria virus P61, complete genome 11622-11651 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NC_047872 Listeria phage LMTA-94, complete genome 132605-132634 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 DQ003638 Listeria phage A511, complete genome 1407-1436 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 DQ003638 Listeria phage A511, complete genome 135901-135930 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 KJ591604 Listeria phage LMTA-148, complete genome 9938-9967 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 KJ591605 Listeria phage LMTA-57, complete genome 6420-6449 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 MN128594 Listeria phage LP-066, complete genome 1223-1252 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 MN128594 Listeria phage LP-066, complete genome 137013-137042 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NC_042048 Listeria phage LMTA-34, complete genome 15008-15037 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NC_041862 Listeria phage LP-064, complete genome 9612-9641 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 KJ094030 Listeria phage LP-083-2, complete genome 6404-6433 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 JX126918 Listeria phage LP-125, complete genome 9612-9641 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NC_024360 Listeria phage LMSP-25, complete genome 15008-15037 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 KJ535721 Listeria phage List-36, complete genome 128990-129019 0 1.0
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 KJ094031 Listeria phage LP-124, complete genome 104289-104318 0 1.0
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 MN172529 Listeria phage LP-039, complete genome 132759-132788 0 1.0
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 MT438761 Listeria virus P61, complete genome 10099-10128 0 1.0
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 MT668624 Listeria phage LP-Mix_6.2, complete genome 135301-135330 0 1.0
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 KJ591604 Listeria phage LMTA-148, complete genome 8664-8693 0 1.0
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 KJ094033 Listeria phage LP-048, complete genome 2187-2216 0 1.0
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 NC_041862 Listeria phage LP-064, complete genome 8109-8138 0 1.0
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 JX126918 Listeria phage LP-125, complete genome 8109-8138 0 1.0
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 JQ797329 Listeria phage vB_LmoM_AG20, complete genome 132782-132811 0 1.0
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 KJ535721 Listeria phage List-36, complete genome 130430-130459 0 1.0
NZ_AARP04000001_1 1.28|314704|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314704-314733 30 MH341451 Listeria phage PSU-VKH-LP019, complete genome 10709-10738 0 1.0
NZ_AARP04000001_1 1.28|314704|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314704-314733 30 DQ003642 Listeria phage A006, complete genome 10725-10754 0 1.0
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 MN172529 Listeria phage LP-039, complete genome 129892-129921 1 0.967
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 NC_025440 Listeria phage WIL-1, complete genome 38247-38276 1 0.967
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 DQ003638 Listeria phage A511, complete genome 129021-129050 1 0.967
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 KJ591604 Listeria phage LMTA-148, complete genome 6287-6316 1 0.967
NZ_AARP04000001_1 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313251-313280 30 KJ094033 Listeria phage LP-048, complete genome 132349-132378 1 0.967
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 MH341452 Listeria phage PSU-VKH-LP040, complete genome 28407-28436 1 0.967
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 KJ094022 Listeria phage LP-030-3, complete genome 37396-37425 1 0.967
NZ_AARP04000001_1 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313515-313544 30 NC_003216 Listeria phage A118, complete genome 39285-39314 1 0.967
NZ_AARP04000001_1 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313515-313544 30 AJ242593 Bacteriophage A118 complete genome 39285-39314 1 0.967
NZ_AARP04000001_1 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313515-313544 30 DQ003642 Listeria phage A006, complete genome 36580-36609 1 0.967
NZ_AARP04000001_1 1.18|314044|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314044-314073 30 NC_003216 Listeria phage A118, complete genome 8179-8208 1 0.967
NZ_AARP04000001_1 1.18|314044|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314044-314073 30 AJ242593 Bacteriophage A118 complete genome 8179-8208 1 0.967
NZ_AARP04000001_1 1.24|314440|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314440-314469 30 KJ094023 Listeria phage LP-101, complete genome 43273-43302 1 0.967
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 MT178766 Listeria virus P100plus, complete genome 101688-101717 1 0.967
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NC_025440 Listeria phage WIL-1, complete genome 31699-31728 1 0.967
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 MT178767 Listeria virus P200, complete genome 101689-101718 1 0.967
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 DQ004855 Listeria bacteriophage P100, complete genome 98043-98072 1 0.967
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 JQ797329 Listeria phage vB_LmoM_AG20, complete genome 1229-1258 1 0.967
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 KT319598 UNVERIFIED: Listeria phage WIL-2 genomic sequence 31421-31450 1 0.967
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 NC_047872 Listeria phage LMTA-94, complete genome 133951-133980 1 0.967
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 MK792752 UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome 2670-2699 1 0.967
NZ_AARP04000001_1 1.29|314770|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314770-314799 30 MH341451 Listeria phage PSU-VKH-LP019, complete genome 28776-28805 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 MT668624 Listeria phage LP-Mix_6.2, complete genome 132068-132097 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 MT178766 Listeria virus P100plus, complete genome 97088-97117 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 NC_025440 Listeria phage WIL-1, complete genome 37279-37308 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 NC_047872 Listeria phage LMTA-94, complete genome 1530-1559 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 DQ003638 Listeria phage A511, complete genome 129989-130018 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 MT178767 Listeria virus P200, complete genome 97089-97118 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 KJ591605 Listeria phage LMTA-57, complete genome 11911-11940 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 MN128594 Listeria phage LP-066, complete genome 132558-132587 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 NC_042048 Listeria phage LMTA-34, complete genome 9530-9559 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 MK792752 UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome 5645-5674 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 NC_041862 Listeria phage LP-064, complete genome 4882-4911 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 KJ094030 Listeria phage LP-083-2, complete genome 1949-1978 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 JX126918 Listeria phage LP-125, complete genome 4882-4911 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 NC_024360 Listeria phage LMSP-25, complete genome 9530-9559 1 0.967
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 KJ094031 Listeria phage LP-124, complete genome 99834-99863 1 0.967
NZ_AARP04000001_1 1.37|315299|31|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 315299-315329 31 KJ094023 Listeria phage LP-101, complete genome 13150-13180 1 0.968
NZ_AARP04000001_1 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT 312987-313016 30 MN904502 Listeria phage LP-018, complete genome 47792-47821 2 0.933
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 KJ668718 Listeria phage LMTA-34 hypothetical proteins and DNA modification protein genes, complete cds 1776-1805 2 0.933
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 MT178766 Listeria virus P100plus, complete genome 96638-96667 2 0.933
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 NC_025440 Listeria phage WIL-1, complete genome 37729-37758 2 0.933
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 MT178767 Listeria virus P200, complete genome 96639-96668 2 0.933
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 KJ591605 Listeria phage LMTA-57, complete genome 12361-12390 2 0.933
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 KP399678 Listeria phage vB_LmoS_293, complete genome 29033-29062 2 0.933
NZ_AARP04000001_1 1.17|313978|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313978-314007 30 NC_003216 Listeria phage A118, complete genome 17880-17909 2 0.933
NZ_AARP04000001_1 1.17|313978|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313978-314007 30 AJ242593 Bacteriophage A118 complete genome 17880-17909 2 0.933
NZ_AARP04000001_1 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314110-314139 30 MN114083 Listeria phage LP-013, complete genome 48006-48035 2 0.933
NZ_AARP04000001_1 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314110-314139 30 MN114082 Listeria phage LP-010, complete genome 47291-47320 2 0.933
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 MN172529 Listeria phage LP-039, complete genome 998-1027 2 0.933
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 MN172529 Listeria phage LP-039, complete genome 134024-134053 2 0.933
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 MT668624 Listeria phage LP-Mix_6.2, complete genome 998-1027 2 0.933
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 MT668624 Listeria phage LP-Mix_6.2, complete genome 136566-136595 2 0.933
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 KJ094033 Listeria phage LP-048, complete genome 3452-3481 2 0.933
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 KJ591605 Listeria phage LMTA-57, complete genome 7852-7881 2 0.933
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 NC_042048 Listeria phage LMTA-34, complete genome 13576-13605 2 0.933
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 NC_024360 Listeria phage LMSP-25, complete genome 13576-13605 2 0.933
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 KJ668718 Listeria phage LMTA-34 hypothetical proteins and DNA modification protein genes, complete cds 2226-2255 2 0.933
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 JQ797329 Listeria phage vB_LmoM_AG20, complete genome 130258-130287 2 0.933
NZ_AARP04000001_1 1.37|315299|31|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 315299-315329 31 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 222677-222707 2 0.935
NZ_AARP04000001_1 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT 312987-313016 30 JB137888 Sequence 7 from Patent WO2012159774 340-369 3 0.9
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 MK792752 UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome 6095-6124 3 0.9
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 NC_047872 Listeria phage LMTA-94, complete genome 1980-2009 3 0.9
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 NC_042048 Listeria phage LMTA-34, complete genome 9080-9109 3 0.9
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 NC_024360 Listeria phage LMSP-25, complete genome 9080-9109 3 0.9
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 KP399677 Listeria phage vB_LmoS_188, complete genome 27664-27693 3 0.9
NZ_AARP04000001_1 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314110-314139 30 MH299806 Listeria phage LP-KV022, complete genome 52479-52508 3 0.9
NZ_AARP04000001_1 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314110-314139 30 JB137888 Sequence 7 from Patent WO2012159774 837-866 3 0.9
NZ_AARP04000001_1 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314110-314139 30 NC_021785 Listeria phage LP-110, complete genome 10197-10226 3 0.9
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 KJ668716 Listeria phage LMTA-34 hypothetical protein genes, complete cds 4369-4398 3 0.9
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 NC_025440 Listeria phage WIL-1, complete genome 33374-33403 3 0.9
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 DQ003638 Listeria phage A511, complete genome 134220-134249 3 0.9
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 MN128594 Listeria phage LP-066, complete genome 135510-135539 3 0.9
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 KJ094030 Listeria phage LP-083-2, complete genome 4901-4930 3 0.9
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 KT319598 UNVERIFIED: Listeria phage WIL-2 genomic sequence 33096-33125 3 0.9
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 KJ094031 Listeria phage LP-124, complete genome 102786-102815 3 0.9
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 MT668624 Listeria phage LP-Mix_6.2, complete genome 131618-131647 4 0.867
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 MN128594 Listeria phage LP-066, complete genome 132108-132137 4 0.867
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 NC_041862 Listeria phage LP-064, complete genome 4432-4461 4 0.867
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 KJ094030 Listeria phage LP-083-2, complete genome 1499-1528 4 0.867
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 JX126918 Listeria phage LP-125, complete genome 4432-4461 4 0.867
NZ_AARP04000001_1 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313317-313346 30 KJ094031 Listeria phage LP-124, complete genome 99384-99413 4 0.867
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 NC_020157 Anabaena cylindrica PCC 7122 plasmid pANACY.02, complete sequence 170220-170249 4 0.867
NZ_AARP04000001_1 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314110-314139 30 KJ094026 Listeria phage LP-032 contig 3, partial genome 10345-10374 5 0.833
NZ_AARP04000001_1 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314110-314139 30 MN128593 Listeria phage LP-031, complete genome 47295-47324 5 0.833
NZ_AARP04000001_1 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314110-314139 30 NC_021787 Listeria phage LP-037, complete genome 4676-4705 5 0.833
NZ_AARP04000001_1 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314110-314139 30 MN904502 Listeria phage LP-018, complete genome 47454-47483 5 0.833
NZ_AARP04000001_1 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314110-314139 30 JX442241 Listeria phage P70, complete genome 54613-54642 5 0.833
NZ_AARP04000001_1 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314110-314139 30 KJ094020 Listeria phage LP-026, complete genome 30828-30857 5 0.833
NZ_AARP04000001_1 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314110-314139 30 KJ094021 Listeria phage LP-114, complete genome 38019-38048 5 0.833
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NC_013373 Staphylococcus sp. CDC3 plasmid SAP020A, complete sequence 38151-38180 5 0.833
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 347991-348020 6 0.8
NZ_AARP04000001_1 1.15|313846|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313846-313875 30 NZ_CP014203 Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence 84179-84208 6 0.8
NZ_AARP04000001_1 1.15|313846|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313846-313875 30 NC_004574 Ruegeria sp. PR1b plasmid pSD25, complete sequence 34184-34213 6 0.8
NZ_AARP04000001_1 1.17|313978|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313978-314007 30 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1490341-1490370 6 0.8
NZ_AARP04000001_1 1.22|314308|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314308-314337 30 NZ_CP021170 Paenibacillus bovis strain BD3526 plasmid unnamed1, complete sequence 32901-32930 6 0.8
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP031989 Acinetobacter haemolyticus strain 5227 plasmid pAhaem5227b, complete sequence 7271-7300 6 0.8
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 NZ_AP014867 Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK3, complete sequence 63187-63216 6 0.8
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 NC_011730 Gloeothece citriformis PCC 7424 plasmid pP742403, complete sequence 25037-25066 6 0.8
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 NC_022774 Bacillus phage Slash, complete genome 76691-76720 7 0.767
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 KT345706 Vibrio phage vB_VorS-PVo5, complete genome 58694-58723 7 0.767
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 MN693549 Marine virus AFVG_25M89, complete genome 4908-4937 7 0.767
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 AP014070 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C2-MedDCM-OCT-S42-C71, *** SEQUENCING IN PROGRESS *** 20151-20180 7 0.767
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 AP014069 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C2-MedDCM-OCT-S40-C35, *** SEQUENCING IN PROGRESS *** 13878-13907 7 0.767
NZ_AARP04000001_1 1.21|314242|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314242-314271 30 MN694303 Marine virus AFVG_250M806, complete genome 45836-45865 7 0.767
NZ_AARP04000001_1 1.22|314308|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314308-314337 30 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 948785-948814 7 0.767
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NC_008226 Clostridioides difficile 630 plasmid pCD630, complete sequence 2090-2119 7 0.767
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP016319 Clostridioides difficile strain 630 delta erm plasmid pCD630, complete sequence 4992-5021 7 0.767
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_MG019959 Clostridioides difficile isolate ERR017368_NODE12 plasmid pCD-WTSI1, complete sequence 1498-1527 7 0.767
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_MG019961 Clostridioides difficile isolate ERR125910_NODE5 plasmid pCD-WTSI3, complete sequence 1502-1531 7 0.767
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_MG019962 Clostridioides difficile isolate ERR125911_NODE11 plasmid pCD-WTSI4, complete sequence 1498-1527 7 0.767
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_MG019960 Clostridioides difficile isolate ERR022513_NODE32 plasmid pCD-WTSI2, complete sequence 1498-1527 7 0.767
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_MG266000 Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence 2096-2125 7 0.767
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP017574 Bacillus thuringiensis strain SCG04-02 plasmid PSCG364, complete sequence 158655-158684 7 0.767
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP012100 Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence 369433-369462 7 0.767
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NC_008014 Lawsonia intracellularis PHE/MN1-00 plasmid 3, complete sequence 117071-117100 7 0.767
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NC_020130 Lawsonia intracellularis N343 plasmid 3, complete sequence 117093-117122 7 0.767
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 NC_019388 Thermus oshimai JL-2 plasmid pTHEOS02, complete sequence 18295-18324 7 0.767
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 NZ_CP010824 Thermus aquaticus Y51MC23 plasmid pTA16, complete sequence 3497-3526 7 0.767
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 NC_021793 Cellulophaga phage phi48:2, complete genome 2953-2982 7 0.767
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 HQ683709 Planktothrix phage PaV-LD, complete genome 41599-41628 7 0.767
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 HQ683709 Planktothrix phage PaV-LD, complete genome 45663-45692 7 0.767
NZ_AARP04000001_1 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314836-314865 30 MF417937 Uncultured Caudovirales phage clone 10F_6, partial genome 16982-17011 7 0.767
NZ_AARP04000001_1 1.1|312921|30|NZ_AARP04000001|CRISPRCasFinder,CRT 312921-312950 30 NZ_CP040765 Paracoccus sp. 2251 plasmid unnamed1, complete sequence 223230-223259 8 0.733
NZ_AARP04000001_1 1.5|313185|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313185-313214 30 NC_012970 Methylovorus glucosetrophus SIP3-4 plasmid pMsip01, complete sequence 63330-63359 8 0.733
NZ_AARP04000001_1 1.5|313185|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313185-313214 30 MN552143 Lactococcus phage P1046, complete genome 19997-20026 8 0.733
NZ_AARP04000001_1 1.5|313185|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313185-313214 30 NC_010576 Lactococcus phage 1706, complete genome 21200-21229 8 0.733
NZ_AARP04000001_1 1.5|313185|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313185-313214 30 MK779875 Lactococcus phage CHPC971, complete genome 20962-20991 8 0.733
NZ_AARP04000001_1 1.8|313383|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313383-313412 30 MN035989 Leviviridae sp. isolate H3_Bulk_41_scaffold_462 RNA-dependent RNA polymerase (H3Bulk41462_000001), hypothetical protein (H3Bulk41462_000002), hypothetical protein (H3Bulk41462_000003), and hypothetical protein (H3Bulk41462_000004) genes, complete cds 382-411 8 0.733
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 NZ_CP017574 Bacillus thuringiensis strain SCG04-02 plasmid PSCG364, complete sequence 345792-345821 8 0.733
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 NZ_CP031992 Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chf, complete sequence 52422-52451 8 0.733
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 NZ_CP010111 Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-5, complete sequence 158431-158460 8 0.733
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 NZ_CP026415 Acinetobacter sp. ACNIH2 plasmid pACI-55cf, complete sequence 60676-60705 8 0.733
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 NZ_CP018872 Acinetobacter haemolyticus strain TJS01 plasmid pAHTJS1, complete sequence 51103-51132 8 0.733
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 MH319731 Marine virus AG-345-E02 Ga0172268_11 genomic sequence 38422-38451 8 0.733
NZ_AARP04000001_1 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313449-313478 30 MN694545 Marine virus AFVG_250M894, complete genome 12846-12875 8 0.733
NZ_AARP04000001_1 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313515-313544 30 AP017924 Ralstonia phage RP12 DNA, complete genome 83724-83753 8 0.733
NZ_AARP04000001_1 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313515-313544 30 AP017925 Ralstonia phage RP31 DNA, complete genome 80469-80498 8 0.733
NZ_AARP04000001_1 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313515-313544 30 AP014501 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S32-C4, *** SEQUENCING IN PROGRESS ***, 3 ordered pieces 19152-19181 8 0.733
NZ_AARP04000001_1 1.12|313647|30|NZ_AARP04000001|CRISPRCasFinder,CRT 313647-313676 30 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 1092818-1092847 8 0.733
NZ_AARP04000001_1 1.13|313713|31|NZ_AARP04000001|CRISPRCasFinder,CRT 313713-313743 31 NZ_CP047439 Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-2, complete sequence 32089-32119 8 0.742
NZ_AARP04000001_1 1.13|313713|31|NZ_AARP04000001|CRISPRCasFinder,CRT 313713-313743 31 NZ_CP047440 Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-3, complete sequence 57249-57279 8 0.742
NZ_AARP04000001_1 1.20|314176|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314176-314205 30 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 35867-35896 8 0.733
NZ_AARP04000001_1 1.21|314242|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314242-314271 30 HM452126 Aeromonas phage phiAS5, complete genome 156053-156082 8 0.733
NZ_AARP04000001_1 1.25|314506|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314506-314535 30 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 21888-21917 8 0.733
NZ_AARP04000001_1 1.25|314506|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314506-314535 30 MT786458 Staphylococcus phage vB_SauH_SAP1, complete genome 114164-114193 8 0.733
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP017256 Clostridium taeniosporum strain 1/k plasmid pCt3, complete sequence 132795-132824 8 0.733
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP018746 Borreliella garinii strain CIP 103362 isolate 20047 plasmid unnamed1 27747-27776 8 0.733
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP028865 Borreliella garinii strain 20047 plasmid lp36, complete sequence 9252-9281 8 0.733
NZ_AARP04000001_1 1.31|314902|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314902-314931 30 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1233492-1233521 8 0.733
NZ_AARP04000001_1 1.32|314968|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314968-314997 30 NZ_CP019039 Bacillus velezensis strain GH1-13 plasmid unnamed, complete sequence 8876-8905 8 0.733
NZ_AARP04000001_1 1.32|314968|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314968-314997 30 NZ_CP019234 Bacillus thuringiensis strain YGd22-03 plasmid pYGD83, complete sequence 12438-12467 8 0.733
NZ_AARP04000001_1 1.34|315100|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 315100-315129 30 MH791404 UNVERIFIED: Aeromonas phage Assk, partial genome 139787-139816 8 0.733
NZ_AARP04000001_1 1.34|315100|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 315100-315129 30 NC_019538 Aeromonas phage CC2, complete genome 139696-139725 8 0.733
NZ_AARP04000001_1 1.39|315432|30|NZ_AARP04000001|CRISPRCasFinder,CRT 315432-315461 30 MN855765 Myoviridae sp. isolate 14, complete genome 24949-24978 8 0.733
NZ_AARP04000001_1 1.20|314176|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314176-314205 30 NZ_CP045296 Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence 142346-142375 9 0.7
NZ_AARP04000001_1 1.21|314242|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314242-314271 30 MN393079 Salmonella virus VSiA, complete genome 26795-26824 9 0.7
NZ_AARP04000001_1 1.21|314242|30|NZ_AARP04000001|CRISPRCasFinder,CRT 314242-314271 30 MH424444 Salmonella virus VSiP, complete genome 26915-26944 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP039210 Piscirickettsia salmonis strain Psal-103 plasmid unnamed1, complete sequence 65715-65744 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP048067 Piscirickettsia salmonis strain Ps-8079A plasmid Ps8079A-p1, complete sequence 52445-52474 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP039033 Piscirickettsia salmonis strain Psal-070 plasmid unnamed1, complete sequence 68222-68251 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038894 Piscirickettsia salmonis strain Psal-006a plasmid unnamed1, complete sequence 68982-69011 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038924 Piscirickettsia salmonis strain Psal-011 plasmid unnamed1, complete sequence 103349-103378 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038953 Piscirickettsia salmonis strain Psal-040 plasmid unnamed1, complete sequence 136654-136683 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038958 Piscirickettsia salmonis strain Psal-041 plasmid unnamed1, complete sequence 90864-90893 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP039196 Piscirickettsia salmonis strain Psal-161 plasmid unnamed1, complete sequence 154015-154044 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038812 Piscirickettsia salmonis strain Psal-001 plasmid unnamed1, complete sequence 83314-83343 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP013769 Piscirickettsia salmonis strain PM23019A plasmid p1PS3, complete sequence 48925-48954 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP033942 Piscirickettsia salmonis strain EM-90 plasmid pPSEM90-5, complete sequence 18798-18827 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP039228 Piscirickettsia salmonis strain SR1 plasmid unnamed1, complete sequence 112577-112606 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP013761 Piscirickettsia salmonis strain AY6492A plasmid p4PS1, complete sequence 50274-50303 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP013774 Piscirickettsia salmonis strain PM37984A plasmid p1PS4, complete sequence 125910-125939 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP013779 Piscirickettsia salmonis strain PM51819A plasmid p1PS5, complete sequence 8585-8614 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP050945 Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p7, complete sequence 171443-171472 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038892 Piscirickettsia salmonis strain Psal-005 plasmid unnamed1, complete sequence 103636-103665 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038914 Piscirickettsia salmonis strain Psal-010a plasmid unnamed1, complete sequence 68221-68250 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038968 Piscirickettsia salmonis strain Psal-068 plasmid unnamed1, complete sequence 83316-83345 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP039202 Piscirickettsia salmonis strain Psal-163 plasmid unnamed1, complete sequence 99674-99703 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP039205 Piscirickettsia salmonis strain Psal-182 plasmid unnamed1, complete sequence 90282-90311 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP039235 Piscirickettsia salmonis strain BI1 plasmid unnamed1, complete sequence 50265-50294 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP039241 Piscirickettsia salmonis strain MR5 plasmid unnamed1, complete sequence 113202-113231 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP039042 Piscirickettsia salmonis strain Psal-072 plasmid unnamed2, complete sequence 68983-69012 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP039187 Piscirickettsia salmonis strain Psal-159 plasmid unnamed1, complete sequence 99678-99707 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038948 Piscirickettsia salmonis strain Psal-028 plasmid unnamed1, complete sequence 130763-130792 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038933 Piscirickettsia salmonis strain Psal-025 plasmid unnamed1, complete sequence 143191-143220 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038973 Piscirickettsia salmonis strain Psal-069 plasmid unnamed1, complete sequence 103637-103666 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP039036 Piscirickettsia salmonis strain Psal-071 plasmid unnamed1, complete sequence 68983-69012 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP039066 Piscirickettsia salmonis strain Psal-107 plasmid unnamed1, complete sequence 99678-99707 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038887 Piscirickettsia salmonis strain Psal-004 plasmid unnamed1, complete sequence 38330-38359 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP039215 Piscirickettsia salmonis strain Psal-104a plasmid unnamed1, complete sequence 83262-83291 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038909 Piscirickettsia salmonis strain Psal-009 plasmid unnamed1, complete sequence 85913-85942 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038938 Piscirickettsia salmonis strain Psal-026 plasmid unnamed1, complete sequence 57693-57722 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038963 Piscirickettsia salmonis strain Psal-051 plasmid unnamed1, complete sequence 68983-69012 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038877 Piscirickettsia salmonis strain Psal-002 plasmid unnamed1, complete sequence 83263-83292 9 0.7
NZ_AARP04000001_1 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314572-314601 30 NZ_CP038882 Piscirickettsia salmonis strain Psal-003 plasmid unnamed1, complete sequence 39289-39318 9 0.7
NZ_AARP04000001_1 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 314638-314667 30 NZ_AP017376 Stanieria sp. NIES-3757 plasmid plasmid1 DNA, complete genome 67436-67465 9 0.7
NZ_AARP04000001_1 1.37|315299|31|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR 315299-315329 31 NZ_LR136959 Alteromonas sp. 76-1 plasmid pAlt76, complete sequence 31733-31763 10 0.677

1. spacer 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MH299806 (Listeria phage LP-KV022, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

2. spacer 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

3. spacer 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_021785 (Listeria phage LP-110, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

4. spacer 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094026 (Listeria phage LP-032 contig 3, partial genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

5. spacer 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

6. spacer 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_021787 (Listeria phage LP-037, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

7. spacer 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

8. spacer 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

9. spacer 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094021 (Listeria phage LP-114, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

10. spacer 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

11. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MT438761 (Listeria virus P61, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

12. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MT668624 (Listeria phage LP-Mix_6.2, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

13. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ668718 (Listeria phage LMTA-34 hypothetical proteins and DNA modification protein genes, complete cds) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

14. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MT178766 (Listeria virus P100plus, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

15. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_047872 (Listeria phage LMTA-94, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

16. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MT178767 (Listeria virus P200, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

17. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ591605 (Listeria phage LMTA-57, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

18. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN128594 (Listeria phage LP-066, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

19. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_042048 (Listeria phage LMTA-34, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

20. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MK792752 (UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

21. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_041862 (Listeria phage LP-064, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

22. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094030 (Listeria phage LP-083-2, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

23. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to JX126918 (Listeria phage LP-125, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

24. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_024360 (Listeria phage LMSP-25, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

25. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to JQ797329 (Listeria phage vB_LmoM_AG20, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

26. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094031 (Listeria phage LP-124, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

27. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to DQ003638 (Listeria phage A511, complete genome) position: , mismatch: 0, identity: 1.0

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaattccaagtaactcatcatta	Protospacer
******************************

28. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0

taactttagatactgctaaagaattagcaa	CRISPR spacer
taactttagatactgctaaagaattagcaa	Protospacer
******************************

29. spacer 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0

tgtctgaatgtagttaatatcttcaacttg	CRISPR spacer
tgtctgaatgtagttaatatcttcaacttg	Protospacer
******************************

30. spacer 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0

tgtctgaatgtagttaatatcttcaacttg	CRISPR spacer
tgtctgaatgtagttaatatcttcaacttg	Protospacer
******************************

31. spacer 1.11|313581|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 0, identity: 1.0

cttcagtttcacctgtgaatacgccgttta	CRISPR spacer
cttcagtttcacctgtgaatacgccgttta	Protospacer
******************************

32. spacer 1.11|313581|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 0, identity: 1.0

cttcagtttcacctgtgaatacgccgttta	CRISPR spacer
cttcagtttcacctgtgaatacgccgttta	Protospacer
******************************

33. spacer 1.18|314044|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 0, identity: 1.0

tccacttcgacgctggacgggctctcctca	CRISPR spacer
tccacttcgacgctggacgggctctcctca	Protospacer
******************************

34. spacer 1.18|314044|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0

tccacttcgacgctggacgggctctcctca	CRISPR spacer
tccacttcgacgctggacgggctctcctca	Protospacer
******************************

35. spacer 1.18|314044|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0

tccacttcgacgctggacgggctctcctca	CRISPR spacer
tccacttcgacgctggacgggctctcctca	Protospacer
******************************

36. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MT438761 (Listeria virus P61, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

37. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_047872 (Listeria phage LMTA-94, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

38. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to DQ003638 (Listeria phage A511, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

39. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to DQ003638 (Listeria phage A511, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

40. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ591604 (Listeria phage LMTA-148, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

41. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ591605 (Listeria phage LMTA-57, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

42. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MN128594 (Listeria phage LP-066, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

43. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MN128594 (Listeria phage LP-066, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

44. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_042048 (Listeria phage LMTA-34, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

45. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_041862 (Listeria phage LP-064, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

46. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ094030 (Listeria phage LP-083-2, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

47. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to JX126918 (Listeria phage LP-125, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

48. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_024360 (Listeria phage LMSP-25, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

49. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ535721 (Listeria phage List-36, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

50. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ094031 (Listeria phage LP-124, complete genome) position: , mismatch: 0, identity: 1.0

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacttttgtata	Protospacer
******************************

51. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MN172529 (Listeria phage LP-039, complete genome) position: , mismatch: 0, identity: 1.0

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
cgtattcaaaagtatatccgctagcctcaa	Protospacer
******************************

52. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MT438761 (Listeria virus P61, complete genome) position: , mismatch: 0, identity: 1.0

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
cgtattcaaaagtatatccgctagcctcaa	Protospacer
******************************

53. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MT668624 (Listeria phage LP-Mix_6.2, complete genome) position: , mismatch: 0, identity: 1.0

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
cgtattcaaaagtatatccgctagcctcaa	Protospacer
******************************

54. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ591604 (Listeria phage LMTA-148, complete genome) position: , mismatch: 0, identity: 1.0

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
cgtattcaaaagtatatccgctagcctcaa	Protospacer
******************************

55. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ094033 (Listeria phage LP-048, complete genome) position: , mismatch: 0, identity: 1.0

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
cgtattcaaaagtatatccgctagcctcaa	Protospacer
******************************

56. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_041862 (Listeria phage LP-064, complete genome) position: , mismatch: 0, identity: 1.0

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
cgtattcaaaagtatatccgctagcctcaa	Protospacer
******************************

57. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to JX126918 (Listeria phage LP-125, complete genome) position: , mismatch: 0, identity: 1.0

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
cgtattcaaaagtatatccgctagcctcaa	Protospacer
******************************

58. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to JQ797329 (Listeria phage vB_LmoM_AG20, complete genome) position: , mismatch: 0, identity: 1.0

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
cgtattcaaaagtatatccgctagcctcaa	Protospacer
******************************

59. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ535721 (Listeria phage List-36, complete genome) position: , mismatch: 0, identity: 1.0

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
cgtattcaaaagtatatccgctagcctcaa	Protospacer
******************************

60. spacer 1.28|314704|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 0, identity: 1.0

taggtttagggagtaaattagctcctttgg	CRISPR spacer
taggtttagggagtaaattagctcctttgg	Protospacer
******************************

61. spacer 1.28|314704|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

taggtttagggagtaaattagctcctttgg	CRISPR spacer
taggtttagggagtaaattagctcctttgg	Protospacer
******************************

62. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN172529 (Listeria phage LP-039, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

63. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_025440 (Listeria phage WIL-1, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

64. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to DQ003638 (Listeria phage A511, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

65. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ591604 (Listeria phage LMTA-148, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

66. spacer 1.6|313251|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094033 (Listeria phage LP-048, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

67. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 1, identity: 0.967

taactttagatactgctaaagaattagcaa	CRISPR spacer
taactttagacactgctaaagaattagcaa	Protospacer
**********.*******************

68. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 1, identity: 0.967

taactttagatactgctaaagaattagcaa	CRISPR spacer
taactttagacactgctaaagaattagcaa	Protospacer
**********.*******************

69. spacer 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 1, identity: 0.967

tgtctgaatgtagttaatatcttcaacttg	CRISPR spacer
tgtctggatgtagttaatatcttcaacttg	Protospacer
******.***********************

70. spacer 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 1, identity: 0.967

tgtctgaatgtagttaatatcttcaacttg	CRISPR spacer
tgtctggatgtagttaatatcttcaacttg	Protospacer
******.***********************

71. spacer 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 1, identity: 0.967

tgtctgaatgtagttaatatcttcaacttg	CRISPR spacer
tgtctggatgtagttaatatcttcaacttg	Protospacer
******.***********************

72. spacer 1.18|314044|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 1, identity: 0.967

tccacttcgacgctggacgggctctcctca	CRISPR spacer
cccacttcgacgctggacgggctctcctca	Protospacer
.*****************************

73. spacer 1.18|314044|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 1, identity: 0.967

tccacttcgacgctggacgggctctcctca	CRISPR spacer
cccacttcgacgctggacgggctctcctca	Protospacer
.*****************************

74. spacer 1.24|314440|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.967

atatacaatgtctaagcttaatctttcggt	CRISPR spacer
atatacaatgtctaagtttaatctttcggt	Protospacer
****************.*************

75. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MT178766 (Listeria virus P100plus, complete genome) position: , mismatch: 1, identity: 0.967

agtatttattatctctattacttttgtata	CRISPR spacer
agtgtttattatctctattacttttgtata	Protospacer
***.**************************

76. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_025440 (Listeria phage WIL-1, complete genome) position: , mismatch: 1, identity: 0.967

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacgtttgtata	Protospacer
********************* ********

77. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MT178767 (Listeria virus P200, complete genome) position: , mismatch: 1, identity: 0.967

agtatttattatctctattacttttgtata	CRISPR spacer
agtgtttattatctctattacttttgtata	Protospacer
***.**************************

78. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to DQ004855 (Listeria bacteriophage P100, complete genome) position: , mismatch: 1, identity: 0.967

agtatttattatctctattacttttgtata	CRISPR spacer
agtgtttattatctctattacttttgtata	Protospacer
***.**************************

79. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to JQ797329 (Listeria phage vB_LmoM_AG20, complete genome) position: , mismatch: 1, identity: 0.967

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattgtctctattacttttgtata	Protospacer
**********.*******************

80. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KT319598 (UNVERIFIED: Listeria phage WIL-2 genomic sequence) position: , mismatch: 1, identity: 0.967

agtatttattatctctattacttttgtata	CRISPR spacer
agtatttattatctctattacgtttgtata	Protospacer
********************* ********

81. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_047872 (Listeria phage LMTA-94, complete genome) position: , mismatch: 1, identity: 0.967

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
catattcaaaagtatatccgctagcctcaa	Protospacer
*.****************************

82. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MK792752 (UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome) position: , mismatch: 1, identity: 0.967

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
cgtattcaaaagtatatccgctagcctcga	Protospacer
****************************.*

83. spacer 1.29|314770|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 1, identity: 0.967

ggtaaaacaagcatcggcgaagcagtaaca	CRISPR spacer
ggtaaaacaagcattggcgaagcagtaaca	Protospacer
**************.***************

84. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MT668624 (Listeria phage LP-Mix_6.2, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tcctaaatctgaaaacaaaaattacgagtt	Protospacer
*********************.********

85. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MT178766 (Listeria virus P100plus, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tccaaaatctgaaaacaaaaactacgagtt	Protospacer
*** **************************

86. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_025440 (Listeria phage WIL-1, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tcctaaatctgaaaacaaaaattacgagtt	Protospacer
*********************.********

87. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_047872 (Listeria phage LMTA-94, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tcctaaatctgaaaacaaaaattacgagtt	Protospacer
*********************.********

88. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to DQ003638 (Listeria phage A511, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tcctaaatctgaaaacaaaaattacgagtt	Protospacer
*********************.********

89. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MT178767 (Listeria virus P200, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tccaaaatctgaaaacaaaaactacgagtt	Protospacer
*** **************************

90. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ591605 (Listeria phage LMTA-57, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tccaaaatctgaaaacaaaaactacgagtt	Protospacer
*** **************************

91. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MN128594 (Listeria phage LP-066, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tcctaaatctgaaaacaaaaattacgagtt	Protospacer
*********************.********

92. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_042048 (Listeria phage LMTA-34, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tcctaaatctgaaaacaaaaattacgagtt	Protospacer
*********************.********

93. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MK792752 (UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tcctaaatctgaaaacaaaaattacgagtt	Protospacer
*********************.********

94. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_041862 (Listeria phage LP-064, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tcctaaatctgaaaacaaaaattacgagtt	Protospacer
*********************.********

95. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ094030 (Listeria phage LP-083-2, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tcctaaatctgaaaacaaaaattacgagtt	Protospacer
*********************.********

96. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to JX126918 (Listeria phage LP-125, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tcctaaatctgaaaacaaaaattacgagtt	Protospacer
*********************.********

97. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_024360 (Listeria phage LMSP-25, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tcctaaatctgaaaacaaaaattacgagtt	Protospacer
*********************.********

98. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ094031 (Listeria phage LP-124, complete genome) position: , mismatch: 1, identity: 0.967

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tcctaaatctgaaaacaaaaattacgagtt	Protospacer
*********************.********

99. spacer 1.37|315299|31|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.968

ttgggcaaaatgaccgtaataaatccattcg	CRISPR spacer
ttgggcaaaatgaccgtaataaatccattct	Protospacer
****************************** 

100. spacer 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 2, identity: 0.933

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaaaatag	Protospacer
************************* **.*

101. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ668718 (Listeria phage LMTA-34 hypothetical proteins and DNA modification protein genes, complete cds) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaattccaagtaactcatcctca	Protospacer
************************** *.*

102. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MT178766 (Listeria virus P100plus, complete genome) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcatca	Protospacer
***********.****************.*

103. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_025440 (Listeria phage WIL-1, complete genome) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcatca	Protospacer
***********.****************.*

104. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MT178767 (Listeria virus P200, complete genome) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcatca	Protospacer
***********.****************.*

105. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ591605 (Listeria phage LMTA-57, complete genome) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcatca	Protospacer
***********.****************.*

106. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 2, identity: 0.933

taactttagatactgctaaagaattagcaa	CRISPR spacer
tgactttagacactgctaaagaattagcaa	Protospacer
*.********.*******************

107. spacer 1.17|313978|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 2, identity: 0.933

tcctcagataaggtttagtacgcaagactc	CRISPR spacer
tcctcagataaaatttagtacgcaagactc	Protospacer
***********..*****************

108. spacer 1.17|313978|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 2, identity: 0.933

tcctcagataaggtttagtacgcaagactc	CRISPR spacer
tcctcagataaaatttagtacgcaagactc	Protospacer
***********..*****************

109. spacer 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 2, identity: 0.933

caatgcttggggctatgatggcatggataa	CRISPR spacer
caatgcttggggatatgatggaatggataa	Protospacer
************ ******** ********

110. spacer 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 2, identity: 0.933

caatgcttggggctatgatggcatggataa	CRISPR spacer
caatgcttggggatatgatggaatggataa	Protospacer
************ ******** ********

111. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MN172529 (Listeria phage LP-039, complete genome) position: , mismatch: 2, identity: 0.933

agtatttattatctctattacttttgtata	CRISPR spacer
agtgtttattatctctattacgtttgtata	Protospacer
***.***************** ********

112. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MN172529 (Listeria phage LP-039, complete genome) position: , mismatch: 2, identity: 0.933

agtatttattatctctattacttttgtata	CRISPR spacer
agtgtttattatctctattacgtttgtata	Protospacer
***.***************** ********

113. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MT668624 (Listeria phage LP-Mix_6.2, complete genome) position: , mismatch: 2, identity: 0.933

agtatttattatctctattacttttgtata	CRISPR spacer
agtgtttattatctctattacgtttgtata	Protospacer
***.***************** ********

114. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MT668624 (Listeria phage LP-Mix_6.2, complete genome) position: , mismatch: 2, identity: 0.933

agtatttattatctctattacttttgtata	CRISPR spacer
agtgtttattatctctattacgtttgtata	Protospacer
***.***************** ********

115. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ094033 (Listeria phage LP-048, complete genome) position: , mismatch: 2, identity: 0.933

agtatttattatctctattacttttgtata	CRISPR spacer
agtgtttattatctctattacgtttgtata	Protospacer
***.***************** ********

116. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ591605 (Listeria phage LMTA-57, complete genome) position: , mismatch: 2, identity: 0.933

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
catattcaaaagtatatccactagcctcaa	Protospacer
*.*****************.**********

117. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_042048 (Listeria phage LMTA-34, complete genome) position: , mismatch: 2, identity: 0.933

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
catattcaaaagtatatccactagcctcaa	Protospacer
*.*****************.**********

118. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_024360 (Listeria phage LMSP-25, complete genome) position: , mismatch: 2, identity: 0.933

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
catattcaaaagtatatccactagcctcaa	Protospacer
*.*****************.**********

119. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ668718 (Listeria phage LMTA-34 hypothetical proteins and DNA modification protein genes, complete cds) position: , mismatch: 2, identity: 0.933

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tccaaaatctgaaaacaaaaattacgagtt	Protospacer
*** *****************.********

120. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to JQ797329 (Listeria phage vB_LmoM_AG20, complete genome) position: , mismatch: 2, identity: 0.933

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
tccaaaatctgagaacaaaaactacgagtt	Protospacer
*** ********.*****************

121. spacer 1.37|315299|31|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 2, identity: 0.935

ttgggcaaaatgaccgtaataaatccattcg	CRISPR spacer
ttgagcaaaatgaccgtaataaatccattcc	Protospacer
***.************************** 

122. spacer 1.2|312987|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 3, identity: 0.9

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataacagtactaatatag	Protospacer
***************** **.*******.*

123. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MK792752 (UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome) position: , mismatch: 3, identity: 0.9

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcacca	Protospacer
***********.***************..*

124. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_047872 (Listeria phage LMTA-94, complete genome) position: , mismatch: 3, identity: 0.9

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcgtcatca	Protospacer
***********.***********.****.*

125. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_042048 (Listeria phage LMTA-34, complete genome) position: , mismatch: 3, identity: 0.9

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcgtcatca	Protospacer
***********.***********.****.*

126. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_024360 (Listeria phage LMSP-25, complete genome) position: , mismatch: 3, identity: 0.9

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcgtcatca	Protospacer
***********.***********.****.*

127. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 3, identity: 0.9

taactttagatactgctaaagaattagcaa	CRISPR spacer
taactttagacactgctaaggaattagcga	Protospacer
**********.********.********.*

128. spacer 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MH299806 (Listeria phage LP-KV022, complete genome) position: , mismatch: 3, identity: 0.9

caatgcttggggctatgatggcatggataa	CRISPR spacer
taatgcttggggatatgatggaatggataa	Protospacer
.*********** ******** ********

129. spacer 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 3, identity: 0.9

caatgcttggggctatgatggcatggataa	CRISPR spacer
taatgcgtggggatatgatggcatggataa	Protospacer
.***** ***** *****************

130. spacer 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_021785 (Listeria phage LP-110, complete genome) position: , mismatch: 3, identity: 0.9

caatgcttggggctatgatggcatggataa	CRISPR spacer
taatgcttggggatatgatggaatggataa	Protospacer
.*********** ******** ********

131. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ668716 (Listeria phage LMTA-34 hypothetical protein genes, complete cds) position: , mismatch: 3, identity: 0.9

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
catattcaaaagtatacccactagcctcaa	Protospacer
*.**************.**.**********

132. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_025440 (Listeria phage WIL-1, complete genome) position: , mismatch: 3, identity: 0.9

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
catattcaaaagtatacccgctagcctcga	Protospacer
*.**************.***********.*

133. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to DQ003638 (Listeria phage A511, complete genome) position: , mismatch: 3, identity: 0.9

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
catattcaaaagtatacccgctagcctcga	Protospacer
*.**************.***********.*

134. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MN128594 (Listeria phage LP-066, complete genome) position: , mismatch: 3, identity: 0.9

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
catattcaaaagtatacccgctagcctcga	Protospacer
*.**************.***********.*

135. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ094030 (Listeria phage LP-083-2, complete genome) position: , mismatch: 3, identity: 0.9

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
catattcaaaagtatacccgctagcctcga	Protospacer
*.**************.***********.*

136. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KT319598 (UNVERIFIED: Listeria phage WIL-2 genomic sequence) position: , mismatch: 3, identity: 0.9

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
catattcaaaagtatacccgctagcctcga	Protospacer
*.**************.***********.*

137. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ094031 (Listeria phage LP-124, complete genome) position: , mismatch: 3, identity: 0.9

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
catattcaaaagtatacccgctagcctcga	Protospacer
*.**************.***********.*

138. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MT668624 (Listeria phage LP-Mix_6.2, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

139. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN128594 (Listeria phage LP-066, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

140. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_041862 (Listeria phage LP-064, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

141. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094030 (Listeria phage LP-083-2, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

142. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to JX126918 (Listeria phage LP-125, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

143. spacer 1.7|313317|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094031 (Listeria phage LP-124, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

144. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_020157 (Anabaena cylindrica PCC 7122 plasmid pANACY.02, complete sequence) position: , mismatch: 4, identity: 0.867

taactt--tagatactgctaaagaattagcaa	CRISPR spacer
--actttgtagatactgctacacaattagcaa	Protospacer
  ****  ************ * *********

145. spacer 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094026 (Listeria phage LP-032 contig 3, partial genome) position: , mismatch: 5, identity: 0.833

caatgcttggggctatgatggcatggataa	CRISPR spacer
caatgcttggggttatgatggaatgaaaga	Protospacer
************.******** ***.* .*

146. spacer 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 5, identity: 0.833

caatgcttggggctatgatggcatggataa	CRISPR spacer
caatgcttggggttatgatggaatgaaaga	Protospacer
************.******** ***.* .*

147. spacer 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_021787 (Listeria phage LP-037, complete genome) position: , mismatch: 5, identity: 0.833

caatgcttggggctatgatggcatggataa	CRISPR spacer
caatgcttggggttatgatggaatgaaaga	Protospacer
************.******** ***.* .*

148. spacer 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 5, identity: 0.833

caatgcttggggctatgatggcatggataa	CRISPR spacer
caatgcttggggttatgatggaatgaaaga	Protospacer
************.******** ***.* .*

149. spacer 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 5, identity: 0.833

caatgcttggggctatgatggcatggataa	CRISPR spacer
caatgcttggggttatgatggaatgaaaga	Protospacer
************.******** ***.* .*

150. spacer 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 5, identity: 0.833

caatgcttggggctatgatggcatggataa	CRISPR spacer
caatgcttggggttatgatggaatgaaaga	Protospacer
************.******** ***.* .*

151. spacer 1.19|314110|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KJ094021 (Listeria phage LP-114, complete genome) position: , mismatch: 5, identity: 0.833

caatgcttggggctatgatggcatggataa	CRISPR spacer
caatgcttggggttatgatggaatgaaaga	Protospacer
************.******** ***.* .*

152. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_013373 (Staphylococcus sp. CDC3 plasmid SAP020A, complete sequence) position: , mismatch: 5, identity: 0.833

-agtatttattatctctattacttttgtata	CRISPR spacer
tagt-tttattatctctattattttagtctt	Protospacer
 *** ****************.*** ** * 

153. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 6, identity: 0.8

taactttagatactgctaaagaattagcaa	CRISPR spacer
aaattagagatactgctaaaaaattaggaa	Protospacer
 **.*  *************.****** **

154. spacer 1.15|313846|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP014203 (Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence) position: , mismatch: 6, identity: 0.8

atatgggggcttattgtatggctaatatac	CRISPR spacer
ctatgggggcatatggtatggctaagaaag	Protospacer
 ********* *** ********** * * 

155. spacer 1.15|313846|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_004574 (Ruegeria sp. PR1b plasmid pSD25, complete sequence) position: , mismatch: 6, identity: 0.8

atatgggggcttattgtatggctaatatac	CRISPR spacer
ctatgggggcttattgcatggcgattttgc	Protospacer
 ***************.***** * * *.*

156. spacer 1.17|313978|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 6, identity: 0.8

tcctcagataaggtttagtacgcaagactc	CRISPR spacer
tcctcagataaggtgtcgtacgcaaatccg	Protospacer
************** * ********. *. 

157. spacer 1.22|314308|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP021170 (Paenibacillus bovis strain BD3526 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ccagagtcgctttttcttccggccagtctg--	CRISPR spacer
ccagattcgctttttcttccagc--gtccatt	Protospacer
***** **************.**  ***..  

158. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031989 (Acinetobacter haemolyticus strain 5227 plasmid pAhaem5227b, complete sequence) position: , mismatch: 6, identity: 0.8

agtatttattatctctattacttttgtata	CRISPR spacer
tgtttctattatctctattactttctaata	Protospacer
 ** *.******************.  ***

159. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014867 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK3, complete sequence) position: , mismatch: 6, identity: 0.8

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
aactaaatctgaaaacaaaaactacataat	Protospacer
  ***********************. . *

160. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_011730 (Gloeothece citriformis PCC 7424 plasmid pP742403, complete sequence) position: , mismatch: 6, identity: 0.8

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
ttctaaatctcaaaacaaaaactcccgttt	Protospacer
*.******** ************ * . **

161. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_022774 (Bacillus phage Slash, complete genome) position: , mismatch: 7, identity: 0.767

taactttagatactgctaaagaattagcaa	CRISPR spacer
aaactttagatgctgctaaacaattccgca	Protospacer
 **********.******** ****    *

162. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to KT345706 (Vibrio phage vB_VorS-PVo5, complete genome) position: , mismatch: 7, identity: 0.767

taactttagatactgctaaagaattagcaa	CRISPR spacer
ttgatttagatactgctaaacaattactta	Protospacer
* . **************** ***** . *

163. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN693549 (Marine virus AFVG_25M89, complete genome) position: , mismatch: 7, identity: 0.767

taactttagatactgctaaagaattagcaa	CRISPR spacer
attgttcagatgctgctaaagaattagcta	Protospacer
    **.****.**************** *

164. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to AP014070 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C2-MedDCM-OCT-S42-C71, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767

taactttagatactgctaaagaattagcaa	CRISPR spacer
aaactttagctactgctaaagagtatgaca	Protospacer
 ******** ************.*  *  *

165. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to AP014069 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C2-MedDCM-OCT-S40-C35, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767

taactttagatactgctaaagaattagcaa	CRISPR spacer
aaactttagctactgctaaagagtatgaca	Protospacer
 ******** ************.*  *  *

166. spacer 1.21|314242|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN694303 (Marine virus AFVG_250M806, complete genome) position: , mismatch: 7, identity: 0.767

cttttgtgtcttcggtagctttgtccatta-	CRISPR spacer
ctttagtgtcttcgatagctttg-atgtcac	Protospacer
**** *********.********  ..*.* 

167. spacer 1.22|314308|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

ccagagtcgctttttcttccggccagtctg	CRISPR spacer
ctagaggcgctttttcttccggccttattc	Protospacer
*.**** *****************   .* 

168. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_008226 (Clostridioides difficile 630 plasmid pCD630, complete sequence) position: , mismatch: 7, identity: 0.767

agtatttattatctctattacttttgtata	CRISPR spacer
attatttagtatctctattactttcccaat	Protospacer
* ****** ***************. .*  

169. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016319 (Clostridioides difficile strain 630 delta erm plasmid pCD630, complete sequence) position: , mismatch: 7, identity: 0.767

agtatttattatctctattacttttgtata	CRISPR spacer
attatttagtatctctattactttcccaat	Protospacer
* ****** ***************. .*  

170. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG019959 (Clostridioides difficile isolate ERR017368_NODE12 plasmid pCD-WTSI1, complete sequence) position: , mismatch: 7, identity: 0.767

agtatttattatctctattacttttgtata	CRISPR spacer
attatttagtatctctattactttcccaat	Protospacer
* ****** ***************. .*  

171. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG019961 (Clostridioides difficile isolate ERR125910_NODE5 plasmid pCD-WTSI3, complete sequence) position: , mismatch: 7, identity: 0.767

agtatttattatctctattacttttgtata	CRISPR spacer
attatttagtatctctattactttcccaat	Protospacer
* ****** ***************. .*  

172. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG019962 (Clostridioides difficile isolate ERR125911_NODE11 plasmid pCD-WTSI4, complete sequence) position: , mismatch: 7, identity: 0.767

agtatttattatctctattacttttgtata	CRISPR spacer
attatttagtatctctattactttcccaat	Protospacer
* ****** ***************. .*  

173. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG019960 (Clostridioides difficile isolate ERR022513_NODE32 plasmid pCD-WTSI2, complete sequence) position: , mismatch: 7, identity: 0.767

agtatttattatctctattacttttgtata	CRISPR spacer
attatttagtatctctattactttcccaat	Protospacer
* ****** ***************. .*  

174. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG266000 (Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence) position: , mismatch: 7, identity: 0.767

agtatttattatctctattacttttgtata	CRISPR spacer
attatttagtatctctattactttcccaat	Protospacer
* ****** ***************. .*  

175. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017574 (Bacillus thuringiensis strain SCG04-02 plasmid PSCG364, complete sequence) position: , mismatch: 7, identity: 0.767

agtatttattatctctattacttttgtata	CRISPR spacer
catatttataatctctattattttttcatt	Protospacer
 .******* **********.**** .** 

176. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012100 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence) position: , mismatch: 7, identity: 0.767

agtatttattatctctattacttttgtata	CRISPR spacer
catatttataatctctattattttttcatt	Protospacer
 .******* **********.**** .** 

177. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_008014 (Lawsonia intracellularis PHE/MN1-00 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.767

agtatttattatctctattacttttgtata	CRISPR spacer
tttacttattatctctattatttttatttt	Protospacer
  **.***************.****.* * 

178. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_020130 (Lawsonia intracellularis N343 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.767

agtatttattatctctattacttttgtata	CRISPR spacer
tttacttattatctctattatttttatttt	Protospacer
  **.***************.****.* * 

179. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_019388 (Thermus oshimai JL-2 plasmid pTHEOS02, complete sequence) position: , mismatch: 7, identity: 0.767

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
tccaaacaaaagtataaccgctagcctaaa	Protospacer
. .*  ********** ********** **

180. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010824 (Thermus aquaticus Y51MC23 plasmid pTA16, complete sequence) position: , mismatch: 7, identity: 0.767

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
tccaaacaaaagtataaccgctagcctaaa	Protospacer
. .*  ********** ********** **

181. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_021793 (Cellulophaga phage phi48:2, complete genome) position: , mismatch: 7, identity: 0.767

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
ttctaaatctgaaaacaacaactatagaat	Protospacer
*.**************** *****.... *

182. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to HQ683709 (Planktothrix phage PaV-LD, complete genome) position: , mismatch: 7, identity: 0.767

tcctaaatctgaaaacaaaaa-----ctacgagtt	CRISPR spacer
tcctaaatctgaaaccaaaaaggaacttac-----	Protospacer
************** ******     .***     

183. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to HQ683709 (Planktothrix phage PaV-LD, complete genome) position: , mismatch: 7, identity: 0.767

tcctaaatctgaaaacaaaaa-----ctacgagtt	CRISPR spacer
tcctaaatctgaaaccaaaaaagaacccac-----	Protospacer
************** ******     *.**     

184. spacer 1.30|314836|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MF417937 (Uncultured Caudovirales phage clone 10F_6, partial genome) position: , mismatch: 7, identity: 0.767

tcctaaatctgaaaacaaaaactacgagtt	CRISPR spacer
aactaaatctgaaactaaaaactacaactc	Protospacer
  ************ .*********.* *.

185. spacer 1.1|312921|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP040765 (Paracoccus sp. 2251 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

gcaatagaccagttaggtgtcacaggtgcg	CRISPR spacer
gccatagaccagttcggtgtcactcagccc	Protospacer
** *********** ********  .  * 

186. spacer 1.5|313185|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_012970 (Methylovorus glucosetrophus SIP3-4 plasmid pMsip01, complete sequence) position: , mismatch: 8, identity: 0.733

aaatattattcaatgctgtaactgtaaaag	CRISPR spacer
taatatttttcaatgctgcaactgctgtcg	Protospacer
 ****** **********.*****. .  *

187. spacer 1.5|313185|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN552143 (Lactococcus phage P1046, complete genome) position: , mismatch: 8, identity: 0.733

aaatattattcaatgctgtaactgtaaaag	CRISPR spacer
ctaatctattcaatgcagtaactgtaactg	Protospacer
  *  .********** **********  *

188. spacer 1.5|313185|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NC_010576 (Lactococcus phage 1706, complete genome) position: , mismatch: 8, identity: 0.733

aaatattattcaatgctgtaactgtaaaag	CRISPR spacer
ctaatctattcaatgcagtaactgtaactg	Protospacer
  *  .********** **********  *

189. spacer 1.5|313185|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MK779875 (Lactococcus phage CHPC971, complete genome) position: , mismatch: 8, identity: 0.733

aaatattattcaatgctgtaactgtaaaag	CRISPR spacer
ctaatctattcaatgcagtaactgtaactg	Protospacer
  *  .********** **********  *

190. spacer 1.8|313383|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN035989 (Leviviridae sp. isolate H3_Bulk_41_scaffold_462 RNA-dependent RNA polymerase (H3Bulk41462_000001), hypothetical protein (H3Bulk41462_000002), hypothetical protein (H3Bulk41462_000003), and hypothetical protein (H3Bulk41462_000004) genes, complete cds) position: , mismatch: 8, identity: 0.733

------tttttcacgtttgtactgtctctcctcgta	CRISPR spacer
gggaaat------cgtttctactgtctctcttcgta	Protospacer
      *      ***** ***********.*****

191. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP017574 (Bacillus thuringiensis strain SCG04-02 plasmid PSCG364, complete sequence) position: , mismatch: 8, identity: 0.733

taactttagatactgctaaagaattagcaa	CRISPR spacer
taactttagatactgttaaagcacatgggg	Protospacer
***************.***** *.  * ..

192. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP031992 (Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chf, complete sequence) position: , mismatch: 8, identity: 0.733

taactttagatactgctaaagaattagcaa	CRISPR spacer
cagaagaagatgcttctaaagaattagcaa	Protospacer
.*.    ****.** ***************

193. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP010111 (Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-5, complete sequence) position: , mismatch: 8, identity: 0.733

taactttagatactgctaaagaattagcaa	CRISPR spacer
taactttagatactgttaaagcacatgggg	Protospacer
***************.***** *.  * ..

194. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP026415 (Acinetobacter sp. ACNIH2 plasmid pACI-55cf, complete sequence) position: , mismatch: 8, identity: 0.733

taactttagatactgctaaagaattagcaa	CRISPR spacer
cagaagaagatgcttctaaagaattagcaa	Protospacer
.*.    ****.** ***************

195. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP018872 (Acinetobacter haemolyticus strain TJS01 plasmid pAHTJS1, complete sequence) position: , mismatch: 8, identity: 0.733

taactttagatactgctaaagaattagcaa	CRISPR spacer
cagaagaagatgcttctaaagaattagcaa	Protospacer
.*.    ****.** ***************

196. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MH319731 (Marine virus AG-345-E02 Ga0172268_11 genomic sequence) position: , mismatch: 8, identity: 0.733

taactttagatactgctaaagaattagcaa	CRISPR spacer
atatattagatactgctaaaaaattaagac	Protospacer
  *. ***************.*****. * 

197. spacer 1.9|313449|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN694545 (Marine virus AFVG_250M894, complete genome) position: , mismatch: 8, identity: 0.733

taactttagatactgctaaagaattagcaa	CRISPR spacer
catctttagagactgctaaacaattaatgg	Protospacer
.* ******* ********* *****....

198. spacer 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to AP017924 (Ralstonia phage RP12 DNA, complete genome) position: , mismatch: 8, identity: 0.733

tgtctgaatgtagttaatatcttcaacttg	CRISPR spacer
gctctgattgaagttaatatcttcaaggac	Protospacer
  ***** ** ***************    

199. spacer 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to AP017925 (Ralstonia phage RP31 DNA, complete genome) position: , mismatch: 8, identity: 0.733

tgtctgaatgtagttaatatcttcaacttg	CRISPR spacer
gctctgattgaagttaatatcttcaaggac	Protospacer
  ***** ** ***************    

200. spacer 1.10|313515|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to AP014501 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S32-C4, *** SEQUENCING IN PROGRESS ***, 3 ordered pieces) position: , mismatch: 8, identity: 0.733

tgtctgaatgtagttaatatcttcaacttg	CRISPR spacer
tagaccgatgtaattaatatcttcatcttg	Protospacer
*.  . .*****.************ ****

201. spacer 1.12|313647|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

gcgcttcagtttcagcattggtcttcttag	CRISPR spacer
tgccgtcagtgtcaccattggtcttcttca	Protospacer
   * ***** *** ************* .

202. spacer 1.13|313713|31|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP047439 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-2, complete sequence) position: , mismatch: 8, identity: 0.742

tctcttgcatttggttctgaataatctcgta	CRISPR spacer
aaccttgcttttggttttgaataatcttttt	Protospacer
  .***** *******.**********. * 

203. spacer 1.13|313713|31|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP047440 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-3, complete sequence) position: , mismatch: 8, identity: 0.742

tctcttgcatttggttctgaataatctcgta	CRISPR spacer
aaccttgcttttggttttgaataatcttttt	Protospacer
  .***** *******.**********. * 

204. spacer 1.20|314176|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.733

ctcttttcgatattccggaagaggtactcc	CRISPR spacer
cgatgttcgatatgccggaagaggtaaggg	Protospacer
*  * ******** ************    

205. spacer 1.21|314242|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to HM452126 (Aeromonas phage phiAS5, complete genome) position: , mismatch: 8, identity: 0.733

cttttgtgtcttcggtagctttgtccatta	CRISPR spacer
ggatggtgtcttcggtagctttcaccatct	Protospacer
   * *****************  ****. 

206. spacer 1.25|314506|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 8, identity: 0.733

gaaataatattgataatatcgctcttgcta	CRISPR spacer
gtatcgtcattaataatatcgctcttgctg	Protospacer
* * .. .***.*****************.

207. spacer 1.25|314506|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MT786458 (Staphylococcus phage vB_SauH_SAP1, complete genome) position: , mismatch: 8, identity: 0.733

gaaataatattgataatatcgctcttgcta	CRISPR spacer
aaggtaatattgataatatggctctaataa	Protospacer
.*..*************** ***** .. *

208. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017256 (Clostridium taeniosporum strain 1/k plasmid pCt3, complete sequence) position: , mismatch: 8, identity: 0.733

agtatttattatctctattacttttgtata	CRISPR spacer
ctagattattaactcttttacttttgtatc	Protospacer
   . ****** **** ************ 

209. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018746 (Borreliella garinii strain CIP 103362 isolate 20047 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agtatttattatctctattacttttgtata	CRISPR spacer
tttatttattatttcttttacttttacttt	Protospacer
  **********.*** ********.. * 

210. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028865 (Borreliella garinii strain 20047 plasmid lp36, complete sequence) position: , mismatch: 8, identity: 0.733

agtatttattatctctattacttttgtata	CRISPR spacer
tttatttattatttcttttacttttacttt	Protospacer
  **********.*** ********.. * 

211. spacer 1.31|314902|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.733

tattggtgccgcgattaaagtgtttgactt	CRISPR spacer
cgccggtgccgcgatcaaagcgtttgacga	Protospacer
....***********.****.*******  

212. spacer 1.32|314968|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019039 (Bacillus velezensis strain GH1-13 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

aaagcaataaatcagatcataaaggagcct	CRISPR spacer
aaagcaataaaacagatcataattggatac	Protospacer
*********** **********  *... .

213. spacer 1.32|314968|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019234 (Bacillus thuringiensis strain YGd22-03 plasmid pYGD83, complete sequence) position: , mismatch: 8, identity: 0.733

aaagcaataaatcagatcataaaggagcct	CRISPR spacer
gtaaaaattaataagatcataaaggagcag	Protospacer
. *. *** *** ***************  

214. spacer 1.34|315100|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to MH791404 (UNVERIFIED: Aeromonas phage Assk, partial genome) position: , mismatch: 8, identity: 0.733

gggcaacgatatttgtagataacagggagt	CRISPR spacer
gttatcccatatttgtatataacagggaga	Protospacer
*     * ********* *********** 

215. spacer 1.34|315100|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_019538 (Aeromonas phage CC2, complete genome) position: , mismatch: 8, identity: 0.733

gggcaacgatatttgtagataacagggagt	CRISPR spacer
gttatcccatatttgtatataacagggaga	Protospacer
*     * ********* *********** 

216. spacer 1.39|315432|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN855765 (Myoviridae sp. isolate 14, complete genome) position: , mismatch: 8, identity: 0.733

agtgatggggaagagattgaacttatgttt	CRISPR spacer
gctgatgggaaagaggttgaacttaaaggt	Protospacer
. *******.*****.********* .  *

217. spacer 1.20|314176|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

ctcttttcgatattccggaagaggtactcc	CRISPR spacer
aatttttcgatattccggatgaggaatggt	Protospacer
  .**************** **** *.  .

218. spacer 1.21|314242|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MN393079 (Salmonella virus VSiA, complete genome) position: , mismatch: 9, identity: 0.7

cttttgtgtcttcggtagctttgtccatta	CRISPR spacer
gcattgtgtcttcggttgctttgtattcga	Protospacer
 . ************* ******* . . *

219. spacer 1.21|314242|30|NZ_AARP04000001|CRISPRCasFinder,CRT matches to MH424444 (Salmonella virus VSiP, complete genome) position: , mismatch: 9, identity: 0.7

cttttgtgtcttcggtagctttgtccatta	CRISPR spacer
gcattgtgtcttcggttgctttgtattcga	Protospacer
 . ************* ******* . . *

220. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039210 (Piscirickettsia salmonis strain Psal-103 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

221. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048067 (Piscirickettsia salmonis strain Ps-8079A plasmid Ps8079A-p1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

222. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039033 (Piscirickettsia salmonis strain Psal-070 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

223. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038894 (Piscirickettsia salmonis strain Psal-006a plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

224. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038924 (Piscirickettsia salmonis strain Psal-011 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

225. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038953 (Piscirickettsia salmonis strain Psal-040 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

226. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038958 (Piscirickettsia salmonis strain Psal-041 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

227. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039196 (Piscirickettsia salmonis strain Psal-161 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

228. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038812 (Piscirickettsia salmonis strain Psal-001 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

229. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013769 (Piscirickettsia salmonis strain PM23019A plasmid p1PS3, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

230. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033942 (Piscirickettsia salmonis strain EM-90 plasmid pPSEM90-5, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

231. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039228 (Piscirickettsia salmonis strain SR1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

232. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013761 (Piscirickettsia salmonis strain AY6492A plasmid p4PS1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

233. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013774 (Piscirickettsia salmonis strain PM37984A plasmid p1PS4, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

234. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013779 (Piscirickettsia salmonis strain PM51819A plasmid p1PS5, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

235. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050945 (Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p7, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

236. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038892 (Piscirickettsia salmonis strain Psal-005 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

237. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038914 (Piscirickettsia salmonis strain Psal-010a plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

238. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038968 (Piscirickettsia salmonis strain Psal-068 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

239. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039202 (Piscirickettsia salmonis strain Psal-163 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

240. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039205 (Piscirickettsia salmonis strain Psal-182 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

241. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039235 (Piscirickettsia salmonis strain BI1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

242. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039241 (Piscirickettsia salmonis strain MR5 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

243. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039042 (Piscirickettsia salmonis strain Psal-072 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

244. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039187 (Piscirickettsia salmonis strain Psal-159 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

245. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038948 (Piscirickettsia salmonis strain Psal-028 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

246. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038933 (Piscirickettsia salmonis strain Psal-025 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

247. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038973 (Piscirickettsia salmonis strain Psal-069 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

248. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039036 (Piscirickettsia salmonis strain Psal-071 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

249. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039066 (Piscirickettsia salmonis strain Psal-107 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

250. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038887 (Piscirickettsia salmonis strain Psal-004 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

251. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039215 (Piscirickettsia salmonis strain Psal-104a plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

252. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038909 (Piscirickettsia salmonis strain Psal-009 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

253. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038938 (Piscirickettsia salmonis strain Psal-026 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

254. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038963 (Piscirickettsia salmonis strain Psal-051 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

255. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038877 (Piscirickettsia salmonis strain Psal-002 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

256. spacer 1.26|314572|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038882 (Piscirickettsia salmonis strain Psal-003 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

agtatttattatctctattacttttgtata	CRISPR spacer
gtctttttttatatctattacttttgtgag	Protospacer
. . *** **** **************. .

257. spacer 1.27|314638|30|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP017376 (Stanieria sp. NIES-3757 plasmid plasmid1 DNA, complete genome) position: , mismatch: 9, identity: 0.7

cgtattcaaaagtatatccgctagcctcaa	CRISPR spacer
taactgtaaaagtatatcctctagcctctg	Protospacer
..  * .************ ******** .

258. spacer 1.37|315299|31|NZ_AARP04000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR136959 (Alteromonas sp. 76-1 plasmid pAlt76, complete sequence) position: , mismatch: 10, identity: 0.677

ttgggcaaaatgaccgtaataaatccattcg	CRISPR spacer
gctttcaaaatgatcgtaataaatcaatagt	Protospacer
 .   ********.*********** **   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage