| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| FNEC01000074 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1074, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000080 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1080, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000021 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1021, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000013 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1013, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000095 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1095, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000076 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1076, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000001 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1001, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000093 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1093, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000004 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1004, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000073 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1073, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000090 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1090, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000039 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1039, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000089 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1089, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000101 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1101, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000072 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1072, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000020 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1020, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000043 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1043, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000009 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1009, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000032 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1032, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000053 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1053, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 1 | |
| FNEC01000012 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1012, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000049 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1049, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000011 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1011, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000084 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1084, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000035 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000050 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1050, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000086 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1086, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000028 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1028, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000025 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1025, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000085 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1085, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000097 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1097, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000034 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1034, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000081 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1081, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000044 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1044, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000071 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1071, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000007 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1007, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000051 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1051, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000031 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1031, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| FNEC01000052 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1052, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000098 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1098, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000062 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1062, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000022 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1022, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000094 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1094, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000026 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1026, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000096 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1096, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000055 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1055, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000067 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1067, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000100 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1100, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000038 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1038, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000005 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1005, whole genome shotgun sequence | 3 crisprs | 1 | 10 | 0 | 0 | |
| FNEC01000006 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1006, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000019 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1019, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000017 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1017, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| FNEC01000075 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1075, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000069 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1069, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000082 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1082, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000056 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1056, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000042 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1042, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000077 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1077, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000047 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1047, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| FNEC01000070 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1070, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000033 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1033, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000045 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1045, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000015 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1015, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000059 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1059, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000079 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1079, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000064 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1064, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000065 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1065, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000016 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1016, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000087 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1087, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000046 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1046, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000030 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1030, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000099 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1099, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000091 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1091, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000058 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1058, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000024 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1024, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000068 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1068, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000063 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1063, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000078 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1078, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000002 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1002, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000014 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1014, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 2 | 0 | |
| FNEC01000061 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1061, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000036 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1036, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000018 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1018, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000060 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1060, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000054 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1054, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000041 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1041, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000088 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1088, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000092 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1092, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000057 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1057, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000008 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1008, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000010 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1010, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| FNEC01000040 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1040, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000048 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1048, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000003 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1003, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000083 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1083, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000029 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1029, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000066 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1066, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| FNEC01000037 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1037, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 3 | |
| FNEC01000023 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1023, whole genome shotgun sequence | 1 crisprs | 1 | 3 | 0 | 0 | |
| FNEC01000027 | Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1027, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 20915 : 27944 | 8 | Ectocarpus_siliculosus_virus(16.67%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 14497 : 21036 | 9 | Pseudomonas_phage(50.0%) | NA | ||
| DBSCAN-SWA_2 | 55837 : 66209 | 8 | Caulobacter_phage(16.67%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 114 : 34736 | 50 | Pseudomonas_phage(28.57%) | NA |
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 98 aa aa | AcrIF4 | NA | FNEC01000037.1_31216_31456_- | 114-34736 | NA |
| 66 aa aa | AcrIE3 | NA | FNEC01000037.1_31216_31456_- | 114-34736 | NA |
| 60 aa aa | AcrIC5 | NA | FNEC01000037.1_31216_31456_- | 114-34736 | NA |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| FNEC01000023_1 | 12735-12766 | 32 | FNEC01000053.1 | 38388-38419 | 2 | 0.938 |
caacgacgccgccgtgtgttcatcgtcgcaag CRISPR spacer caacgacgccgccgtgtgttcgttgtcgcaag Protospacer *********************.*.********
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| FNEC01000023_1 | 12735-12766 | 32 | MN693903 | Marine virus AFVG_250M471, complete genome | 3878-3909 | 5 | 0.844 | |
| FNEC01000023_1 | 12616-12644 | 29 | NZ_CP029452 | Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence | 1858068-1858096 | 6 | 0.793 | |
| FNEC01000023_1 | 12735-12766 | 32 | NZ_CP020399 | Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence | 78182-78213 | 6 | 0.812 | |
| FNEC01000023_1 | 12735-12766 | 32 | NZ_CP023739 | Methylosinus trichosporium OB3b plasmid pOB3b2, complete sequence | 64045-64076 | 8 | 0.75 | |
| FNEC01000023_1 | 12615-12646 | 32 | NZ_CP029452 | Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence | 1858065-1858096 | 9 | 0.719 | |
| FNEC01000023_1 | 12735-12766 | 32 | NZ_CP029830 | Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence | 460868-460899 | 9 | 0.719 | |
| FNEC01000023_1 | 12735-12766 | 32 | NZ_LR134456 | Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence | 151904-151935 | 10 | 0.688 | |
| FNEC01000023_1 | 12735-12766 | 32 | NC_019202 | Pseudomonas aeruginosa plasmid pKLC102, complete sequence | 77613-77644 | 10 | 0.688 |
caacgacgccgccgtgtgttcatcgtcgcaag CRISPR spacer cagtggcggcgccgggtgttcatcgtcgcaag Protospacer **..*.** ***** *****************
agatggagcgctatgcggcgcgcttgaac CRISPR spacer agatggggcgctatgcggcccgcgccatc Protospacer ******.************ *** . * *
caacg-acgccgccgtgtgttcatcgtcgcaag CRISPR spacer -aacgcacgccgccatgtgttcatcgccggcgg Protospacer **** ********.***********.** .*
caacgacgccgccgtgtgttcatcgtcgcaag CRISPR spacer acaggacgccgccgtctattcatcgtcgcggc Protospacer * *********** *.***********..
agatggagcgctatgcggcgcgcttgaacaaa CRISPR spacer agatggggcgctatgcggcccgcgccatcctc Protospacer ******.************ *** . * *
caacgacgccgccgtgtgttcatcgtcgcaag CRISPR spacer gagccccgcctccgtgtgctcatcgtcgcgcc Protospacer *.* **** *******.**********.
caacgacgccgccgtgtgttcatcgtcgcaag CRISPR spacer tgggaccggcgccgcgtgttcatcgtcgccaa Protospacer ... . ** *****.************** *.
caacgacgccgccgtgtgttcatcgtcgcaag CRISPR spacer ttcccgtttcgccgcgtgttcatcgtcgccag Protospacer . * .. .*****.************** **
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| FNEC01000005_1 | 49839-50300 | TypeI-E |
I-E
|
7 spacers
|
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2 |
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| FNEC01000005_2 | 58876-59267 | TypeI-E |
I-E
|
6 spacers
|
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3 |
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| FNEC01000005_3 | 59435-59710 | TypeI-E |
I-E
|
4 spacers
|
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3 |
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| FNEC01000005_3 | 59537-59556 | 20 | FNEC01000001.1 | 56752-56771 | 2 | 0.9 |
tcgcggcgggccgccagcca CRISPR spacer tcggcgcgggccgccagcca Protospacer *** ***************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| FNEC01000005_3 | 59537-59556 | 20 | NZ_CP039697 | Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence | 593191-593210 | 1 | 0.95 | |
| FNEC01000005_3 | 59537-59556 | 20 | NZ_CP013054 | Sinorhizobium americanum CCGM7 plasmid C, complete sequence | 1874822-1874841 | 1 | 0.95 | |
| FNEC01000005_1 | 50112-50143 | 32 | NZ_LR134420 | Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 11 | 168548-168579 | 6 | 0.812 | |
| FNEC01000005_1 | 50051-50082 | 32 | NC_007353 | Sphingomonas sp. A1 plasmid pA1 DNA, complete sequence | 18505-18536 | 7 | 0.781 | |
| FNEC01000005_1 | 50051-50082 | 32 | NZ_CP034351 | Streptomyces sp. W1SF4 plasmid p1, complete sequence | 130937-130968 | 7 | 0.781 | |
| FNEC01000005_1 | 50051-50082 | 32 | NC_019369 | Burkholderia cepacia plasmid pYS1, complete sequence | 31744-31775 | 7 | 0.781 | |
| FNEC01000005_1 | 50112-50143 | 32 | MN310542 | Mycobacterium phage Keziacharles14, complete genome | 17178-17209 | 7 | 0.781 | |
| FNEC01000005_2 | 59087-59116 | 30 | NZ_CP030764 | Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence | 40318-40347 | 7 | 0.767 | |
| FNEC01000005_2 | 59087-59116 | 30 | NZ_CP015881 | Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence | 978624-978653 | 7 | 0.767 | |
| FNEC01000005_3 | 59527-59558 | 32 | NZ_CP016024 | Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence | 153345-153376 | 7 | 0.781 | |
| FNEC01000005_1 | 49868-49899 | 32 | NC_014840 | Pantoea sp. At-9b plasmid pPAT9B03, complete sequence | 70300-70331 | 8 | 0.75 | |
| FNEC01000005_1 | 49990-50021 | 32 | KT339177 | Lactococcus phage GE1, complete genome | 11732-11763 | 8 | 0.75 | |
| FNEC01000005_1 | 50051-50082 | 32 | NZ_AP022319 | Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence | 1365128-1365159 | 8 | 0.75 | |
| FNEC01000005_1 | 50112-50143 | 32 | NZ_CP054621 | Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence | 539732-539763 | 8 | 0.75 | |
| FNEC01000005_1 | 50112-50143 | 32 | NZ_CP014675 | Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence | 370-401 | 8 | 0.75 | |
| FNEC01000005_1 | 50112-50143 | 32 | NZ_LT900339 | Gluconobacter oxydans 621H isolate WT-DSMZ plasmid 2 | 157621-157652 | 8 | 0.75 | |
| FNEC01000005_1 | 50112-50143 | 32 | NC_006672 | Gluconobacter oxydans 621H plasmid pGOX1, complete sequence | 157620-157651 | 8 | 0.75 | |
| FNEC01000005_1 | 50112-50143 | 32 | NZ_CP015167 | Acetobacter ascendens strain LMG 1590 plasmid unnamed3, complete sequence | 5996-6027 | 8 | 0.75 | |
| FNEC01000005_1 | 50112-50143 | 32 | NZ_CP043044 | Gluconobacter thailandicus strain HD924 plasmid unnamed1, complete sequence | 102086-102117 | 8 | 0.75 | |
| FNEC01000005_2 | 59087-59116 | 30 | NC_016586 | Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence | 631043-631072 | 8 | 0.733 | |
| FNEC01000005_2 | 59087-59116 | 30 | MF417841 | Uncultured Caudovirales phage clone 7S_11, partial genome | 6037-6066 | 8 | 0.733 | |
| FNEC01000005_3 | 59527-59558 | 32 | NZ_CP012185 | Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence | 371837-371868 | 8 | 0.75 | |
| FNEC01000005_3 | 59527-59558 | 32 | NZ_CP013054 | Sinorhizobium americanum CCGM7 plasmid C, complete sequence | 1874822-1874853 | 8 | 0.75 | |
| FNEC01000005_3 | 59527-59558 | 32 | NZ_CP012182 | Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence | 675570-675601 | 8 | 0.75 | |
| FNEC01000005_3 | 59527-59558 | 32 | NC_012849 | Ralstonia pickettii 12D plasmid pRp12D02, complete sequence | 168254-168285 | 8 | 0.75 | |
| FNEC01000005_3 | 59527-59558 | 32 | NZ_CP033582 | Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence | 402679-402710 | 8 | 0.75 | |
| FNEC01000005_3 | 59527-59558 | 32 | NZ_AP018687 | Vibrio rumoiensis strain FERM P-14531 plasmid 1, complete sequence | 45433-45464 | 8 | 0.75 | |
| FNEC01000005_3 | 59527-59558 | 32 | KY697807 | Microcystis phage MACPNOA1, complete genome | 2497-2528 | 8 | 0.75 | |
| FNEC01000005_1 | 50051-50082 | 32 | NZ_KJ599675 | Micrococcus sp. A7 plasmid pLMA7, complete sequence | 54479-54510 | 9 | 0.719 | |
| FNEC01000005_1 | 50051-50082 | 32 | NZ_CP029209 | Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence | 555508-555539 | 9 | 0.719 | |
| FNEC01000005_1 | 50112-50143 | 32 | NZ_CP041043 | Paracoccus sp. AK26 plasmid pAK3, complete sequence | 70765-70796 | 9 | 0.719 | |
| FNEC01000005_1 | 50173-50204 | 32 | NC_001884 | Bacillus phage SPBc2, complete genome | 61109-61140 | 9 | 0.719 | |
| FNEC01000005_1 | 50173-50204 | 32 | AF020713 | Bacteriophage SPBc2 complete genome | 61109-61140 | 9 | 0.719 | |
| FNEC01000005_1 | 50173-50204 | 32 | MT366948 | Bacillus phage Hyb3phi3Ts-SPbeta, complete genome | 50598-50629 | 9 | 0.719 | |
| FNEC01000005_1 | 50173-50204 | 32 | MT601274 | Bacillus phage vB_BsuS-Goe13, complete genome | 51305-51336 | 9 | 0.719 | |
| FNEC01000005_1 | 50173-50204 | 32 | MT601273 | Bacillus phage vB_BsuS-Goe12, complete genome | 51305-51336 | 9 | 0.719 | |
| FNEC01000005_2 | 59087-59116 | 30 | NZ_CP013412 | Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence | 107066-107095 | 9 | 0.7 | |
| FNEC01000005_2 | 59087-59116 | 30 | NZ_CP010016 | Burkholderia thailandensis 34 plasmid unnamed, complete sequence | 324576-324605 | 9 | 0.7 | |
| FNEC01000005_3 | 59527-59558 | 32 | NZ_CP015420 | Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence | 50675-50706 | 9 | 0.719 | |
| FNEC01000005_3 | 59527-59558 | 32 | NZ_AP014801 | Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351 | 35492-35523 | 9 | 0.719 | |
| FNEC01000005_3 | 59650-59681 | 32 | NZ_AP014883 | Acetobacter pasteurianus NBRC 101655 plasmid plasmid2 DNA, complete genome | 4558-4589 | 9 | 0.719 | |
| FNEC01000005_1 | 49868-49899 | 32 | NZ_CP033873 | Caulobacter sp. FWC26 plasmid p1, complete sequence | 155472-155503 | 10 | 0.688 | |
| FNEC01000005_1 | 49868-49899 | 32 | NZ_AP022320 | Burkholderia sp. THE68 plasmid BTHE68_p2, complete sequence | 49886-49917 | 10 | 0.688 | |
| FNEC01000005_1 | 49868-49899 | 32 | NC_016626 | Burkholderia sp. YI23 plasmid byi_1p, complete sequence | 1745477-1745508 | 10 | 0.688 | |
| FNEC01000005_1 | 49990-50021 | 32 | NZ_AP022593 | Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence | 2991031-2991062 | 10 | 0.688 | |
| FNEC01000005_1 | 50051-50082 | 32 | NZ_CP050083 | Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence | 581781-581812 | 10 | 0.688 | |
| FNEC01000005_1 | 50051-50082 | 32 | NZ_CP025017 | Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence | 233775-233806 | 10 | 0.688 | |
| FNEC01000005_1 | 50051-50082 | 32 | NZ_CP049733 | Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence | 569467-569498 | 10 | 0.688 | |
| FNEC01000005_1 | 50051-50082 | 32 | NZ_CP040819 | Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence | 179118-179149 | 10 | 0.688 | |
| FNEC01000005_1 | 50051-50082 | 32 | NZ_CP054026 | Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence | 274763-274794 | 10 | 0.688 | |
| FNEC01000005_1 | 50051-50082 | 32 | NZ_CP054036 | Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence | 116215-116246 | 10 | 0.688 | |
| FNEC01000005_1 | 50051-50082 | 32 | NZ_CP053207 | Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence | 598645-598676 | 10 | 0.688 | |
| FNEC01000005_1 | 50051-50082 | 32 | NZ_CP050088 | Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence | 350954-350985 | 10 | 0.688 | |
| FNEC01000005_1 | 50112-50143 | 32 | NZ_CP054841 | Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence | 53983-54014 | 10 | 0.688 | |
| FNEC01000005_1 | 50112-50143 | 32 | NZ_CP046330 | Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed1, complete sequence | 19666-19697 | 10 | 0.688 | |
| FNEC01000005_1 | 50112-50143 | 32 | NC_006525 | Cupriavidus metallidurans CH34 plasmid pMOL28, complete sequence | 87022-87053 | 10 | 0.688 | |
| FNEC01000005_3 | 59466-59497 | 32 | NZ_CP029434 | Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-61, complete sequence | 6826-6857 | 10 | 0.688 | |
| FNEC01000005_3 | 59466-59497 | 32 | NZ_CP029428 | Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-51, complete sequence | 1758-1789 | 10 | 0.688 | |
| FNEC01000005_3 | 59466-59497 | 32 | NZ_CP029440 | Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-61, complete sequence | 54812-54843 | 10 | 0.688 | |
| FNEC01000005_3 | 59527-59558 | 32 | NZ_CP020385 | Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence | 129236-129267 | 10 | 0.688 | |
| FNEC01000005_3 | 59527-59558 | 32 | NC_016972 | Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence | 64412-64443 | 11 | 0.656 |
tcgcggcgggccgccagcca CRISPR spacer gcgcggcgggccgccagcca Protospacer *******************
tcgcggcgggccgccagcca CRISPR spacer tcgcggcgggccgccagccg Protospacer *******************.
ttctgcagctcggcacgcccctgctgggcatc CRISPR spacer tttaccagctcggcatgcccctcctgggcagc Protospacer **. **********.****** ******* *
gcctggaacaccggggcgccgaactggacgga CRISPR spacer gcttcgcgcaccggggccgcgaactggacggc Protospacer **.* * .********* ************
gcctggaacaccggggcgccgaactggacgga-- CRISPR spacer gccaggaacaccgaggcgccgaa--ggtcgcctt Protospacer *** *********.********* ** **
gcctggaacaccggggcgccgaactggacgga CRISPR spacer gcttcgcgcaccggggccgcgaactggacggc Protospacer **.* * .********* ************
ttctgca-gctcggcacgcccctgctgggcatc CRISPR spacer -ccgacacgctcggcacgctcctggtgggcaac Protospacer .* .** ***********.**** ****** *
caggacgctgatgacggtccagccgatgat CRISPR spacer cttcatgtcgatgacggtccagccggtgat Protospacer * *.*..****************.****
caggacgctgatgacggtccagccgatgat CRISPR spacer gaggccgctgatgacggtcgagcccgttgt Protospacer *** ************** **** .* .*
tcgcggcgggccgccagccaggccttgtaggc CRISPR spacer aggccggacgccgccagccaggcctcgtaggc Protospacer ** * . ****************.******
actccttgcgggtgcgctcttgcttgcgctta CRISPR spacer gctggtggcgggtgcgctgttgattgcgctgg Protospacer .** * *********** *** ******* .
gttttcttcggagcttccatgtcggtcgtggc CRISPR spacer agtttcttaggagcttccatatcggctttgga Protospacer . ****** ***********.****.. ***
gcctggaacaccggggcgccgaactggacgga CRISPR spacer acctggaaaaccggggcgccaaacatggctgg Protospacer .******* ***********.*** *.* *.
ttctgcagctcggcacgcccctgctgggcatc CRISPR spacer aggcgcagcccggcacgcccctgctgggacgc Protospacer .*****.****************** *
ttctgcag----ctcggcacgcccctgctgggcatc CRISPR spacer
----gtggctttctcggcatgccactgctgggcatc Protospacer
*..* *******.*** ************
ttctgcag----ctcggcacgcccctgctgggcatc CRISPR spacer
----gtggctttctcggcatgccactgctgggcatc Protospacer
*..* *******.*** ************
ttctgcag----ctcggcacgcccctgctgggcatc CRISPR spacer
----gtggctttctcggcatgccactgctgggcatc Protospacer
*..* *******.*** ************
ttctgcag----ctcggcacgcccctgctgggcatc CRISPR spacer
----gtggctttctcggcatgccactgctgggcatc Protospacer
*..* *******.*** ************
ttctgcag----ctcggcacgcccctgctgggcatc CRISPR spacer
----gtggctttctcggcatgccactgctgggcatc Protospacer
*..* *******.*** ************
caggacgctgatgacggtccagccgatgat CRISPR spacer gatacggctgatgacgggcctgccgatgaa Protospacer * . *********** ** ********
caggacgctgatgacggtccagccgatgat CRISPR spacer ttgctcgctgatgacggtcccgcggatggg Protospacer . * *************** ** ****.
tcgcggcgggccgccagccaggccttgtaggc CRISPR spacer gcgcggtcggccgccagccaggcctcgatgat Protospacer *****. *****************.* *..
tcgcggcgggccgccagccaggccttgtaggc CRISPR spacer tcgcggcgggccgccagccggaccgtcgaaag Protospacer *******************.*.** * *..
tcgcggcgggccgccagccaggccttgtaggc CRISPR spacer gcgcggtcggccgccagccaggcctcgatgat Protospacer *****. *****************.* *..
tcgcggcgggccgccagccaggccttgtaggc CRISPR spacer aggccggacgccgccaaccaggcctcgtaggc Protospacer ** * . *******.********.******
tcgcggcgggccgccagccaggccttgtaggc CRISPR spacer tccgggtgggccgccagccaggccgtgacgtg Protospacer ** **.***************** ** *
tcgc-ggcgggccgccagccaggccttgtaggc CRISPR spacer -cgcgggcggcccgccaaccaggccttgacctt Protospacer *** ***** ******.********** .
tcgcggcgggccgccagccaggccttgtaggc CRISPR spacer cagccgcgcgccgccagccaggcctcgaactc Protospacer . ** *** ****************.* * *
gcctggaacaccggggcgccgaactggacgga CRISPR spacer agggcgcgcaccggggcgccaagctggacgga Protospacer . * .************.*.*********
gcctggaacaccggggcgccgaactggacgga CRISPR spacer ctgttctacacctggacgccgaactggacggt Protospacer . * ***** **.***************
ttctgcagctcggcacgcccctgctgggcatc CRISPR spacer tgatcgcgcccggcacgccgctgctgggcaag Protospacer * * **.********* **********
tcataatcagcttcctcctaagtg--agcaggtt CRISPR spacer tcataatcaatttcctcctaagtattattaaa-- Protospacer *********..************. * .*..
tcataatcagcttcctcctaagtg--agcaggtt CRISPR spacer tcataatcaatttcctcctaagtattattaaa-- Protospacer *********..************. * .*..
tcataatcagcttcctcctaagtg--agcaggtt CRISPR spacer tcataatcaatttcctcctaagtattattaaa-- Protospacer *********..************. * .*..
tcataatcagcttcctcctaagtg--agcaggtt CRISPR spacer tcataatcaatttcctcctaagtattattaaa-- Protospacer *********..************. * .*..
tcataatcagcttcctcctaagtg--agcaggtt CRISPR spacer tcataatcaatttcctcctaagtattattaaa-- Protospacer *********..************. * .*..
caggacgctgatgacggtccagccgatgat CRISPR spacer gtagtcgctgacgacggtccagccgagcgc Protospacer .* ******.************** ..
caggacgctgatgacggtccagccgatgat CRISPR spacer gtagtcgctgacgacggtccagccgagcgc Protospacer .* ******.************** ..
tcgcggcgggccgccagccaggccttgtaggc CRISPR spacer gcgccgctggccgccagccaggccgcgccttc Protospacer *** ** **************** .*. *
tcgcggcgggccgccagccaggccttgtaggc CRISPR spacer gcgccgctggccgccagccaggccgcgccttc Protospacer *** ** **************** .*. *
aacaacaagttgctcgttcgccccgtccgtag CRISPR spacer gtttgctagttcatcgttcgccccgtccgtgg Protospacer . . .* **** *****************.*
actccttgcgggtgcgctcttgcttgcgctta CRISPR spacer ccaatggtcgcgtgcgctctggcttgcgcttc Protospacer * . ** ********* **********
actccttgcgggtgcgctcttgcttgcgctta CRISPR spacer ggtatgcacggttgcgctcttgcttgagcttg Protospacer . * . ..*** ************** ****.
actccttgcgggtgcgctcttgcttgcgctta CRISPR spacer ggtatgcacggttgcgctcttgcttgagcttg Protospacer . * . ..*** ************** ****.
gttttcttcggagcttccatgtcggtcgtggc CRISPR spacer ggcgcgttcggagcgtcgatgtcggtcgtcat Protospacer * . . ******** ** *********** ..
gcctggaacaccggggcgccgaactggacgga CRISPR spacer aggattagcacccgggcgccgaagtggacggc Protospacer . *.**** ********** *******
gcctggaacaccggggcgccgaactggacgga CRISPR spacer aggatcagcacccgggcgccgaagtggacggc Protospacer . *.**** ********** *******
gcctggaacaccggggcgccgaactggacgga CRISPR spacer aggattagcacccgggcgccgaagtggacggc Protospacer . *.**** ********** *******
gcctggaacaccggggcgccgaactggacgga CRISPR spacer atggagaacaccgaggcgccgaacaggatgat Protospacer .. .********.********** ***.*.
gcctggaacaccggggcgccgaactggacgga CRISPR spacer aggatcagcacccgggcgccgaagtggacggc Protospacer . *.**** ********** *******
gcctggaacaccggggcgccgaactggacgga CRISPR spacer aggatcagcacccgggcgccgaagtggacggc Protospacer . *.**** ********** *******
gcctggaacaccggggcgccgaactggacgga CRISPR spacer aggattagcacccgggcgccgaagtggacggc Protospacer . *.**** ********** *******
gcctggaacaccggggcgccgaactggacgga CRISPR spacer aggatcagcacccgggcgccgaagtggacggc Protospacer . *.**** ********** *******
ttctgcagctcggcacgcccctgctgggcatc CRISPR spacer aagtgcagctgggcacgcgcctgctgcagcgc Protospacer ******* ******* ******* . *
ttctgcagctcggcacgcccctgctgggcatc CRISPR spacer gccagcagctcggcatgccccagctggatcgt Protospacer .* ***********.***** *****.. .
ttctgcagctcggcacgcccctgctgggcatc CRISPR spacer gccagcagctcggcatgccccagctggatcgt Protospacer .* ***********.***** *****.. .
gcgacgagtccggatgtcttggcctagtcgcg CRISPR spacer tggacgagttcggatgtgttggcctgaaaatg Protospacer *******.******* *******.. ..*
gcgacgagtccggatgtcttggcctagtcgcg CRISPR spacer tggacgagttcggatgtgttggcctgaaaatg Protospacer *******.******* *******.. ..*
gcgacgagtccggatgtcttggcctagtcgcg CRISPR spacer tggacgagttcggatgtgttggcctgaaaatg Protospacer *******.******* *******.. ..*
tcgcggcgggccgccagccaggccttgtaggc CRISPR spacer gcgccgctggccgccagccaggccgcaccatc Protospacer *** ** **************** ... . *
tcgcggcgggccgccagccaggccttgtaggc CRISPR spacer gtgcggcgggccgccaccctggcctaccgact Protospacer .************** ** ***** ... .
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 33743 : 39996 | 9 | Powai_lake_megavirus(16.67%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 19467 : 25457 | 8 | uncultured_Caudovirales_phage(75.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 6559 : 16553 | 15 | Pseudomonas_phage(62.5%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 29609 : 40490 | 15 | Pseudomonas_phage(60.0%) | NA |
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 91 aa aa | NA | NA | NA | 29609-40490 | yes |