Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
FNEC01000039 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1039, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000028 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1028, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000101 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1101, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000078 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1078, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000076 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1076, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
FNEC01000087 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1087, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000048 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1048, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000081 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1081, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000021 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1021, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000049 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1049, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000096 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1096, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000025 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1025, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
FNEC01000038 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1038, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000077 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1077, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000075 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1075, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000032 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1032, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000098 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1098, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000029 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1029, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000034 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1034, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000091 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1091, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000023 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1023, whole genome shotgun sequence 1 crisprs NA 1 3 0 0
FNEC01000005 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1005, whole genome shotgun sequence 3 crisprs cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2 1 10 0 0
FNEC01000066 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1066, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000092 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1092, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000063 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1063, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000051 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1051, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000100 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000007 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1007, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000082 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1082, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000047 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1047, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
FNEC01000008 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1008, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
FNEC01000014 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1014, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
FNEC01000040 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1040, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
FNEC01000058 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1058, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000002 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1002, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000084 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1084, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000045 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1045, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000086 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1086, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000016 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1016, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000050 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1050, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
FNEC01000061 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1061, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000011 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1011, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000055 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1055, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000054 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1054, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000052 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1052, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
FNEC01000060 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1060, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000072 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1072, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000083 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1083, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000035 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000094 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1094, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000009 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1009, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000019 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1019, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000069 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1069, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000006 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1006, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
FNEC01000080 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1080, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000053 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1053, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
FNEC01000095 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1095, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000012 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1012, whole genome shotgun sequence 0 crisprs DinG,csa3 0 0 0 0
FNEC01000056 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1056, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000020 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1020, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
FNEC01000070 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1070, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000041 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1041, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000004 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1004, whole genome shotgun sequence 0 crisprs DEDDh,csa3 0 0 0 0
FNEC01000068 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1068, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000010 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1010, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
FNEC01000067 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1067, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000036 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1036, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000037 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1037, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 3
FNEC01000088 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1088, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000001 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1001, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000022 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1022, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000031 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1031, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
FNEC01000079 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1079, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000065 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1065, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000073 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1073, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000097 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1097, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000074 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1074, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000030 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1030, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000099 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1099, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000003 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1003, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000043 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1043, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000026 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1026, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
FNEC01000071 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1071, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
FNEC01000090 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1090, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000017 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1017, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
FNEC01000015 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1015, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
FNEC01000089 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1089, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000018 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1018, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000085 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1085, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000057 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1057, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000042 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1042, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000064 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1064, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000027 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1027, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000062 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1062, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000024 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1024, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000059 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1059, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000013 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1013, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000046 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1046, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000033 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1033, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000093 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1093, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
FNEC01000044 Pseudomonas delhiensis strain CCM 7361 genome assembly, contig: Ga0104656_1044, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. FNEC01000005
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
FNEC01000005_1 49839-50300 TypeI-E I-E
7 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
FNEC01000005_2 58876-59267 TypeI-E I-E
6 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
FNEC01000005_3 59435-59710 TypeI-E I-E
4 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
FNEC01000005_3 3.2|59537|20|FNEC01000005|PILER-CR 59537-59556 20 FNEC01000001.1 56752-56771 2 0.9

1. spacer 3.2|59537|20|FNEC01000005|PILER-CR matches to position: 56752-56771, mismatch: 2, identity: 0.9

tcgcggcgggccgccagcca	CRISPR spacer
tcggcgcgggccgccagcca	Protospacer
***  ***************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
FNEC01000005_3 3.2|59537|20|FNEC01000005|PILER-CR 59537-59556 20 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 593191-593210 1 0.95
FNEC01000005_3 3.2|59537|20|FNEC01000005|PILER-CR 59537-59556 20 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1874822-1874841 1 0.95
FNEC01000005_1 1.5|50112|32|FNEC01000005|CRT 50112-50143 32 NZ_LR134420 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 11 168548-168579 6 0.812
FNEC01000005_1 1.4|50051|32|FNEC01000005|PILER-CR,CRT 50051-50082 32 NC_007353 Sphingomonas sp. A1 plasmid pA1 DNA, complete sequence 18505-18536 7 0.781
FNEC01000005_1 1.4|50051|32|FNEC01000005|PILER-CR,CRT 50051-50082 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 130937-130968 7 0.781
FNEC01000005_1 1.4|50051|32|FNEC01000005|PILER-CR,CRT 50051-50082 32 NC_019369 Burkholderia cepacia plasmid pYS1, complete sequence 31744-31775 7 0.781
FNEC01000005_1 1.5|50112|32|FNEC01000005|CRT 50112-50143 32 MN310542 Mycobacterium phage Keziacharles14, complete genome 17178-17209 7 0.781
FNEC01000005_2 2.7|59087|30|FNEC01000005|PILER-CR 59087-59116 30 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 40318-40347 7 0.767
FNEC01000005_2 2.7|59087|30|FNEC01000005|PILER-CR 59087-59116 30 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 978624-978653 7 0.767
FNEC01000005_3 3.4|59527|32|FNEC01000005|CRT 59527-59558 32 NZ_CP016024 Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence 153345-153376 7 0.781
FNEC01000005_1 1.1|49868|32|FNEC01000005|PILER-CR,CRT 49868-49899 32 NC_014840 Pantoea sp. At-9b plasmid pPAT9B03, complete sequence 70300-70331 8 0.75
FNEC01000005_1 1.3|49990|32|FNEC01000005|PILER-CR,CRT 49990-50021 32 KT339177 Lactococcus phage GE1, complete genome 11732-11763 8 0.75
FNEC01000005_1 1.4|50051|32|FNEC01000005|PILER-CR,CRT 50051-50082 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1365128-1365159 8 0.75
FNEC01000005_1 1.5|50112|32|FNEC01000005|CRT 50112-50143 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 539732-539763 8 0.75
FNEC01000005_1 1.5|50112|32|FNEC01000005|CRT 50112-50143 32 NZ_CP014675 Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence 370-401 8 0.75
FNEC01000005_1 1.5|50112|32|FNEC01000005|CRT 50112-50143 32 NZ_LT900339 Gluconobacter oxydans 621H isolate WT-DSMZ plasmid 2 157621-157652 8 0.75
FNEC01000005_1 1.5|50112|32|FNEC01000005|CRT 50112-50143 32 NC_006672 Gluconobacter oxydans 621H plasmid pGOX1, complete sequence 157620-157651 8 0.75
FNEC01000005_1 1.5|50112|32|FNEC01000005|CRT 50112-50143 32 NZ_CP015167 Acetobacter ascendens strain LMG 1590 plasmid unnamed3, complete sequence 5996-6027 8 0.75
FNEC01000005_1 1.5|50112|32|FNEC01000005|CRT 50112-50143 32 NZ_CP043044 Gluconobacter thailandicus strain HD924 plasmid unnamed1, complete sequence 102086-102117 8 0.75
FNEC01000005_2 2.7|59087|30|FNEC01000005|PILER-CR 59087-59116 30 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 631043-631072 8 0.733
FNEC01000005_2 2.7|59087|30|FNEC01000005|PILER-CR 59087-59116 30 MF417841 Uncultured Caudovirales phage clone 7S_11, partial genome 6037-6066 8 0.733
FNEC01000005_3 3.4|59527|32|FNEC01000005|CRT 59527-59558 32 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 371837-371868 8 0.75
FNEC01000005_3 3.4|59527|32|FNEC01000005|CRT 59527-59558 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1874822-1874853 8 0.75
FNEC01000005_3 3.4|59527|32|FNEC01000005|CRT 59527-59558 32 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 675570-675601 8 0.75
FNEC01000005_3 3.4|59527|32|FNEC01000005|CRT 59527-59558 32 NC_012849 Ralstonia pickettii 12D plasmid pRp12D02, complete sequence 168254-168285 8 0.75
FNEC01000005_3 3.4|59527|32|FNEC01000005|CRT 59527-59558 32 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 402679-402710 8 0.75
FNEC01000005_3 3.4|59527|32|FNEC01000005|CRT 59527-59558 32 NZ_AP018687 Vibrio rumoiensis strain FERM P-14531 plasmid 1, complete sequence 45433-45464 8 0.75
FNEC01000005_3 3.4|59527|32|FNEC01000005|CRT 59527-59558 32 KY697807 Microcystis phage MACPNOA1, complete genome 2497-2528 8 0.75
FNEC01000005_1 1.4|50051|32|FNEC01000005|PILER-CR,CRT 50051-50082 32 NZ_KJ599675 Micrococcus sp. A7 plasmid pLMA7, complete sequence 54479-54510 9 0.719
FNEC01000005_1 1.4|50051|32|FNEC01000005|PILER-CR,CRT 50051-50082 32 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 555508-555539 9 0.719
FNEC01000005_1 1.5|50112|32|FNEC01000005|CRT 50112-50143 32 NZ_CP041043 Paracoccus sp. AK26 plasmid pAK3, complete sequence 70765-70796 9 0.719
FNEC01000005_1 1.6|50173|32|FNEC01000005|CRT 50173-50204 32 NC_001884 Bacillus phage SPBc2, complete genome 61109-61140 9 0.719
FNEC01000005_1 1.6|50173|32|FNEC01000005|CRT 50173-50204 32 AF020713 Bacteriophage SPBc2 complete genome 61109-61140 9 0.719
FNEC01000005_1 1.6|50173|32|FNEC01000005|CRT 50173-50204 32 MT366948 Bacillus phage Hyb3phi3Ts-SPbeta, complete genome 50598-50629 9 0.719
FNEC01000005_1 1.6|50173|32|FNEC01000005|CRT 50173-50204 32 MT601274 Bacillus phage vB_BsuS-Goe13, complete genome 51305-51336 9 0.719
FNEC01000005_1 1.6|50173|32|FNEC01000005|CRT 50173-50204 32 MT601273 Bacillus phage vB_BsuS-Goe12, complete genome 51305-51336 9 0.719
FNEC01000005_2 2.7|59087|30|FNEC01000005|PILER-CR 59087-59116 30 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 107066-107095 9 0.7
FNEC01000005_2 2.7|59087|30|FNEC01000005|PILER-CR 59087-59116 30 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 324576-324605 9 0.7
FNEC01000005_3 3.4|59527|32|FNEC01000005|CRT 59527-59558 32 NZ_CP015420 Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence 50675-50706 9 0.719
FNEC01000005_3 3.4|59527|32|FNEC01000005|CRT 59527-59558 32 NZ_AP014801 Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351 35492-35523 9 0.719
FNEC01000005_3 3.6|59650|32|FNEC01000005|CRT 59650-59681 32 NZ_AP014883 Acetobacter pasteurianus NBRC 101655 plasmid plasmid2 DNA, complete genome 4558-4589 9 0.719
FNEC01000005_1 1.1|49868|32|FNEC01000005|PILER-CR,CRT 49868-49899 32 NZ_CP033873 Caulobacter sp. FWC26 plasmid p1, complete sequence 155472-155503 10 0.688
FNEC01000005_1 1.1|49868|32|FNEC01000005|PILER-CR,CRT 49868-49899 32 NZ_AP022320 Burkholderia sp. THE68 plasmid BTHE68_p2, complete sequence 49886-49917 10 0.688
FNEC01000005_1 1.1|49868|32|FNEC01000005|PILER-CR,CRT 49868-49899 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1745477-1745508 10 0.688
FNEC01000005_1 1.3|49990|32|FNEC01000005|PILER-CR,CRT 49990-50021 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2991031-2991062 10 0.688
FNEC01000005_1 1.4|50051|32|FNEC01000005|PILER-CR,CRT 50051-50082 32 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 581781-581812 10 0.688
FNEC01000005_1 1.4|50051|32|FNEC01000005|PILER-CR,CRT 50051-50082 32 NZ_CP025017 Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence 233775-233806 10 0.688
FNEC01000005_1 1.4|50051|32|FNEC01000005|PILER-CR,CRT 50051-50082 32 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 569467-569498 10 0.688
FNEC01000005_1 1.4|50051|32|FNEC01000005|PILER-CR,CRT 50051-50082 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 179118-179149 10 0.688
FNEC01000005_1 1.4|50051|32|FNEC01000005|PILER-CR,CRT 50051-50082 32 NZ_CP054026 Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence 274763-274794 10 0.688
FNEC01000005_1 1.4|50051|32|FNEC01000005|PILER-CR,CRT 50051-50082 32 NZ_CP054036 Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence 116215-116246 10 0.688
FNEC01000005_1 1.4|50051|32|FNEC01000005|PILER-CR,CRT 50051-50082 32 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 598645-598676 10 0.688
FNEC01000005_1 1.4|50051|32|FNEC01000005|PILER-CR,CRT 50051-50082 32 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 350954-350985 10 0.688
FNEC01000005_1 1.5|50112|32|FNEC01000005|CRT 50112-50143 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 53983-54014 10 0.688
FNEC01000005_1 1.5|50112|32|FNEC01000005|CRT 50112-50143 32 NZ_CP046330 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed1, complete sequence 19666-19697 10 0.688
FNEC01000005_1 1.5|50112|32|FNEC01000005|CRT 50112-50143 32 NC_006525 Cupriavidus metallidurans CH34 plasmid pMOL28, complete sequence 87022-87053 10 0.688
FNEC01000005_3 3.3|59466|32|FNEC01000005|CRT 59466-59497 32 NZ_CP029434 Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-61, complete sequence 6826-6857 10 0.688
FNEC01000005_3 3.3|59466|32|FNEC01000005|CRT 59466-59497 32 NZ_CP029428 Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-51, complete sequence 1758-1789 10 0.688
FNEC01000005_3 3.3|59466|32|FNEC01000005|CRT 59466-59497 32 NZ_CP029440 Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-61, complete sequence 54812-54843 10 0.688
FNEC01000005_3 3.4|59527|32|FNEC01000005|CRT 59527-59558 32 NZ_CP020385 Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence 129236-129267 10 0.688
FNEC01000005_3 3.4|59527|32|FNEC01000005|CRT 59527-59558 32 NC_016972 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence 64412-64443 11 0.656

1. spacer 3.2|59537|20|FNEC01000005|PILER-CR matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 1, identity: 0.95

tcgcggcgggccgccagcca	CRISPR spacer
gcgcggcgggccgccagcca	Protospacer
 *******************

2. spacer 3.2|59537|20|FNEC01000005|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 1, identity: 0.95

tcgcggcgggccgccagcca	CRISPR spacer
tcgcggcgggccgccagccg	Protospacer
*******************.

3. spacer 1.5|50112|32|FNEC01000005|CRT matches to NZ_LR134420 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 11) position: , mismatch: 6, identity: 0.812

ttctgcagctcggcacgcccctgctgggcatc	CRISPR spacer
tttaccagctcggcatgcccctcctgggcagc	Protospacer
**.  **********.****** ******* *

4. spacer 1.4|50051|32|FNEC01000005|PILER-CR,CRT matches to NC_007353 (Sphingomonas sp. A1 plasmid pA1 DNA, complete sequence) position: , mismatch: 7, identity: 0.781

gcctggaacaccggggcgccgaactggacgga	CRISPR spacer
gcttcgcgcaccggggccgcgaactggacggc	Protospacer
**.* * .*********  ************ 

5. spacer 1.4|50051|32|FNEC01000005|PILER-CR,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

gcctggaacaccggggcgccgaactggacgga--	CRISPR spacer
gccaggaacaccgaggcgccgaa--ggtcgcctt	Protospacer
*** *********.*********  ** **    

6. spacer 1.4|50051|32|FNEC01000005|PILER-CR,CRT matches to NC_019369 (Burkholderia cepacia plasmid pYS1, complete sequence) position: , mismatch: 7, identity: 0.781

gcctggaacaccggggcgccgaactggacgga	CRISPR spacer
gcttcgcgcaccggggccgcgaactggacggc	Protospacer
**.* * .*********  ************ 

7. spacer 1.5|50112|32|FNEC01000005|CRT matches to MN310542 (Mycobacterium phage Keziacharles14, complete genome) position: , mismatch: 7, identity: 0.781

ttctgca-gctcggcacgcccctgctgggcatc	CRISPR spacer
-ccgacacgctcggcacgctcctggtgggcaac	Protospacer
 .* .** ***********.**** ****** *

8. spacer 2.7|59087|30|FNEC01000005|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

caggacgctgatgacggtccagccgatgat	CRISPR spacer
cttcatgtcgatgacggtccagccggtgat	Protospacer
*   *.*..****************.****

9. spacer 2.7|59087|30|FNEC01000005|PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 7, identity: 0.767

caggacgctgatgacggtccagccgatgat	CRISPR spacer
gaggccgctgatgacggtcgagcccgttgt	Protospacer
 *** ************** **** .* .*

10. spacer 3.4|59527|32|FNEC01000005|CRT matches to NZ_CP016024 (Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence) position: , mismatch: 7, identity: 0.781

tcgcggcgggccgccagccaggccttgtaggc	CRISPR spacer
aggccggacgccgccagccaggcctcgtaggc	Protospacer
  ** * . ****************.******

11. spacer 1.1|49868|32|FNEC01000005|PILER-CR,CRT matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 8, identity: 0.75

actccttgcgggtgcgctcttgcttgcgctta	CRISPR spacer
gctggtggcgggtgcgctgttgattgcgctgg	Protospacer
.**  * *********** *** ******* .

12. spacer 1.3|49990|32|FNEC01000005|PILER-CR,CRT matches to KT339177 (Lactococcus phage GE1, complete genome) position: , mismatch: 8, identity: 0.75

gttttcttcggagcttccatgtcggtcgtggc	CRISPR spacer
agtttcttaggagcttccatatcggctttgga	Protospacer
. ****** ***********.****.. *** 

13. spacer 1.4|50051|32|FNEC01000005|PILER-CR,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.75

gcctggaacaccggggcgccgaactggacgga	CRISPR spacer
acctggaaaaccggggcgccaaacatggctgg	Protospacer
.******* ***********.***  *.* *.

14. spacer 1.5|50112|32|FNEC01000005|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75

ttctgcagctcggcacgcccctgctgggcatc	CRISPR spacer
aggcgcagcccggcacgcccctgctgggacgc	Protospacer
   .*****.******************   *

15. spacer 1.5|50112|32|FNEC01000005|CRT matches to NZ_CP014675 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence) position: , mismatch: 8, identity: 0.75

ttctgcag----ctcggcacgcccctgctgggcatc	CRISPR spacer
----gtggctttctcggcatgccactgctgggcatc	Protospacer
    *..*    *******.*** ************

16. spacer 1.5|50112|32|FNEC01000005|CRT matches to NZ_LT900339 (Gluconobacter oxydans 621H isolate WT-DSMZ plasmid 2) position: , mismatch: 8, identity: 0.75

ttctgcag----ctcggcacgcccctgctgggcatc	CRISPR spacer
----gtggctttctcggcatgccactgctgggcatc	Protospacer
    *..*    *******.*** ************

17. spacer 1.5|50112|32|FNEC01000005|CRT matches to NC_006672 (Gluconobacter oxydans 621H plasmid pGOX1, complete sequence) position: , mismatch: 8, identity: 0.75

ttctgcag----ctcggcacgcccctgctgggcatc	CRISPR spacer
----gtggctttctcggcatgccactgctgggcatc	Protospacer
    *..*    *******.*** ************

18. spacer 1.5|50112|32|FNEC01000005|CRT matches to NZ_CP015167 (Acetobacter ascendens strain LMG 1590 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

ttctgcag----ctcggcacgcccctgctgggcatc	CRISPR spacer
----gtggctttctcggcatgccactgctgggcatc	Protospacer
    *..*    *******.*** ************

19. spacer 1.5|50112|32|FNEC01000005|CRT matches to NZ_CP043044 (Gluconobacter thailandicus strain HD924 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ttctgcag----ctcggcacgcccctgctgggcatc	CRISPR spacer
----gtggctttctcggcatgccactgctgggcatc	Protospacer
    *..*    *******.*** ************

20. spacer 2.7|59087|30|FNEC01000005|PILER-CR matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 8, identity: 0.733

caggacgctgatgacggtccagccgatgat	CRISPR spacer
gatacggctgatgacgggcctgccgatgaa	Protospacer
 * .  *********** ** ******** 

21. spacer 2.7|59087|30|FNEC01000005|PILER-CR matches to MF417841 (Uncultured Caudovirales phage clone 7S_11, partial genome) position: , mismatch: 8, identity: 0.733

caggacgctgatgacggtccagccgatgat	CRISPR spacer
ttgctcgctgatgacggtcccgcggatggg	Protospacer
. *  *************** ** ****. 

22. spacer 3.4|59527|32|FNEC01000005|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.75

tcgcggcgggccgccagccaggccttgtaggc	CRISPR spacer
gcgcggtcggccgccagccaggcctcgatgat	Protospacer
 *****. *****************.*  *..

23. spacer 3.4|59527|32|FNEC01000005|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75

tcgcggcgggccgccagccaggccttgtaggc	CRISPR spacer
tcgcggcgggccgccagccggaccgtcgaaag	Protospacer
*******************.*.** *  *.. 

24. spacer 3.4|59527|32|FNEC01000005|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgcggcgggccgccagccaggccttgtaggc	CRISPR spacer
gcgcggtcggccgccagccaggcctcgatgat	Protospacer
 *****. *****************.*  *..

25. spacer 3.4|59527|32|FNEC01000005|CRT matches to NC_012849 (Ralstonia pickettii 12D plasmid pRp12D02, complete sequence) position: , mismatch: 8, identity: 0.75

tcgcggcgggccgccagccaggccttgtaggc	CRISPR spacer
aggccggacgccgccaaccaggcctcgtaggc	Protospacer
  ** * . *******.********.******

26. spacer 3.4|59527|32|FNEC01000005|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.75

tcgcggcgggccgccagccaggccttgtaggc	CRISPR spacer
tccgggtgggccgccagccaggccgtgacgtg	Protospacer
**  **.***************** **  *  

27. spacer 3.4|59527|32|FNEC01000005|CRT matches to NZ_AP018687 (Vibrio rumoiensis strain FERM P-14531 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgc-ggcgggccgccagccaggccttgtaggc	CRISPR spacer
-cgcgggcggcccgccaaccaggccttgacctt	Protospacer
 *** ***** ******.**********    .

28. spacer 3.4|59527|32|FNEC01000005|CRT matches to KY697807 (Microcystis phage MACPNOA1, complete genome) position: , mismatch: 8, identity: 0.75

tcgcggcgggccgccagccaggccttgtaggc	CRISPR spacer
cagccgcgcgccgccagccaggcctcgaactc	Protospacer
. ** *** ****************.* *  *

29. spacer 1.4|50051|32|FNEC01000005|PILER-CR,CRT matches to NZ_KJ599675 (Micrococcus sp. A7 plasmid pLMA7, complete sequence) position: , mismatch: 9, identity: 0.719

gcctggaacaccggggcgccgaactggacgga	CRISPR spacer
agggcgcgcaccggggcgccaagctggacgga	Protospacer
.    * .************.*.*********

30. spacer 1.4|50051|32|FNEC01000005|PILER-CR,CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 9, identity: 0.719

gcctggaacaccggggcgccgaactggacgga	CRISPR spacer
ctgttctacacctggacgccgaactggacggt	Protospacer
 . *   ***** **.*************** 

31. spacer 1.5|50112|32|FNEC01000005|CRT matches to NZ_CP041043 (Paracoccus sp. AK26 plasmid pAK3, complete sequence) position: , mismatch: 9, identity: 0.719

ttctgcagctcggcacgcccctgctgggcatc	CRISPR spacer
tgatcgcgcccggcacgccgctgctgggcaag	Protospacer
*  *   **.********* **********  

32. spacer 1.6|50173|32|FNEC01000005|CRT matches to NC_001884 (Bacillus phage SPBc2, complete genome) position: , mismatch: 9, identity: 0.719

tcataatcagcttcctcctaagtg--agcaggtt	CRISPR spacer
tcataatcaatttcctcctaagtattattaaa--	Protospacer
*********..************.  * .*..  

33. spacer 1.6|50173|32|FNEC01000005|CRT matches to AF020713 (Bacteriophage SPBc2 complete genome) position: , mismatch: 9, identity: 0.719

tcataatcagcttcctcctaagtg--agcaggtt	CRISPR spacer
tcataatcaatttcctcctaagtattattaaa--	Protospacer
*********..************.  * .*..  

34. spacer 1.6|50173|32|FNEC01000005|CRT matches to MT366948 (Bacillus phage Hyb3phi3Ts-SPbeta, complete genome) position: , mismatch: 9, identity: 0.719

tcataatcagcttcctcctaagtg--agcaggtt	CRISPR spacer
tcataatcaatttcctcctaagtattattaaa--	Protospacer
*********..************.  * .*..  

35. spacer 1.6|50173|32|FNEC01000005|CRT matches to MT601274 (Bacillus phage vB_BsuS-Goe13, complete genome) position: , mismatch: 9, identity: 0.719

tcataatcagcttcctcctaagtg--agcaggtt	CRISPR spacer
tcataatcaatttcctcctaagtattattaaa--	Protospacer
*********..************.  * .*..  

36. spacer 1.6|50173|32|FNEC01000005|CRT matches to MT601273 (Bacillus phage vB_BsuS-Goe12, complete genome) position: , mismatch: 9, identity: 0.719

tcataatcagcttcctcctaagtg--agcaggtt	CRISPR spacer
tcataatcaatttcctcctaagtattattaaa--	Protospacer
*********..************.  * .*..  

37. spacer 2.7|59087|30|FNEC01000005|PILER-CR matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 9, identity: 0.7

caggacgctgatgacggtccagccgatgat	CRISPR spacer
gtagtcgctgacgacggtccagccgagcgc	Protospacer
  .* ******.**************  ..

38. spacer 2.7|59087|30|FNEC01000005|PILER-CR matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

caggacgctgatgacggtccagccgatgat	CRISPR spacer
gtagtcgctgacgacggtccagccgagcgc	Protospacer
  .* ******.**************  ..

39. spacer 3.4|59527|32|FNEC01000005|CRT matches to NZ_CP015420 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcgggccgccagccaggccttgtaggc	CRISPR spacer
gcgccgctggccgccagccaggccgcgccttc	Protospacer
 *** ** **************** .*.   *

40. spacer 3.4|59527|32|FNEC01000005|CRT matches to NZ_AP014801 (Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351) position: , mismatch: 9, identity: 0.719

tcgcggcgggccgccagccaggccttgtaggc	CRISPR spacer
gcgccgctggccgccagccaggccgcgccttc	Protospacer
 *** ** **************** .*.   *

41. spacer 3.6|59650|32|FNEC01000005|CRT matches to NZ_AP014883 (Acetobacter pasteurianus NBRC 101655 plasmid plasmid2 DNA, complete genome) position: , mismatch: 9, identity: 0.719

aacaacaagttgctcgttcgccccgtccgtag	CRISPR spacer
gtttgctagttcatcgttcgccccgtccgtgg	Protospacer
. . .* ****  *****************.*

42. spacer 1.1|49868|32|FNEC01000005|PILER-CR,CRT matches to NZ_CP033873 (Caulobacter sp. FWC26 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

actccttgcgggtgcgctcttgcttgcgctta	CRISPR spacer
ccaatggtcgcgtgcgctctggcttgcgcttc	Protospacer
 *  .   ** ********* ********** 

43. spacer 1.1|49868|32|FNEC01000005|PILER-CR,CRT matches to NZ_AP022320 (Burkholderia sp. THE68 plasmid BTHE68_p2, complete sequence) position: , mismatch: 10, identity: 0.688

actccttgcgggtgcgctcttgcttgcgctta	CRISPR spacer
ggtatgcacggttgcgctcttgcttgagcttg	Protospacer
. * . ..*** ************** ****.

44. spacer 1.1|49868|32|FNEC01000005|PILER-CR,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 10, identity: 0.688

actccttgcgggtgcgctcttgcttgcgctta	CRISPR spacer
ggtatgcacggttgcgctcttgcttgagcttg	Protospacer
. * . ..*** ************** ****.

45. spacer 1.3|49990|32|FNEC01000005|PILER-CR,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

gttttcttcggagcttccatgtcggtcgtggc	CRISPR spacer
ggcgcgttcggagcgtcgatgtcggtcgtcat	Protospacer
* . . ******** ** *********** ..

46. spacer 1.4|50051|32|FNEC01000005|PILER-CR,CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 10, identity: 0.688

gcctggaacaccggggcgccgaactggacgga	CRISPR spacer
aggattagcacccgggcgccgaagtggacggc	Protospacer
.     *.**** ********** ******* 

47. spacer 1.4|50051|32|FNEC01000005|PILER-CR,CRT matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 10, identity: 0.688

gcctggaacaccggggcgccgaactggacgga	CRISPR spacer
aggatcagcacccgggcgccgaagtggacggc	Protospacer
.     *.**** ********** ******* 

48. spacer 1.4|50051|32|FNEC01000005|PILER-CR,CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 10, identity: 0.688

gcctggaacaccggggcgccgaactggacgga	CRISPR spacer
aggattagcacccgggcgccgaagtggacggc	Protospacer
.     *.**** ********** ******* 

49. spacer 1.4|50051|32|FNEC01000005|PILER-CR,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 10, identity: 0.688

gcctggaacaccggggcgccgaactggacgga	CRISPR spacer
atggagaacaccgaggcgccgaacaggatgat	Protospacer
..  .********.********** ***.*. 

50. spacer 1.4|50051|32|FNEC01000005|PILER-CR,CRT matches to NZ_CP054026 (Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence) position: , mismatch: 10, identity: 0.688

gcctggaacaccggggcgccgaactggacgga	CRISPR spacer
aggatcagcacccgggcgccgaagtggacggc	Protospacer
.     *.**** ********** ******* 

51. spacer 1.4|50051|32|FNEC01000005|PILER-CR,CRT matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 10, identity: 0.688

gcctggaacaccggggcgccgaactggacgga	CRISPR spacer
aggatcagcacccgggcgccgaagtggacggc	Protospacer
.     *.**** ********** ******* 

52. spacer 1.4|50051|32|FNEC01000005|PILER-CR,CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 10, identity: 0.688

gcctggaacaccggggcgccgaactggacgga	CRISPR spacer
aggattagcacccgggcgccgaagtggacggc	Protospacer
.     *.**** ********** ******* 

53. spacer 1.4|50051|32|FNEC01000005|PILER-CR,CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 10, identity: 0.688

gcctggaacaccggggcgccgaactggacgga	CRISPR spacer
aggatcagcacccgggcgccgaagtggacggc	Protospacer
.     *.**** ********** ******* 

54. spacer 1.5|50112|32|FNEC01000005|CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ttctgcagctcggcacgcccctgctgggcatc	CRISPR spacer
aagtgcagctgggcacgcgcctgctgcagcgc	Protospacer
   ******* ******* ******* .   *

55. spacer 1.5|50112|32|FNEC01000005|CRT matches to NZ_CP046330 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ttctgcagctcggcacgcccctgctgggcatc	CRISPR spacer
gccagcagctcggcatgccccagctggatcgt	Protospacer
 .* ***********.***** *****..  .

56. spacer 1.5|50112|32|FNEC01000005|CRT matches to NC_006525 (Cupriavidus metallidurans CH34 plasmid pMOL28, complete sequence) position: , mismatch: 10, identity: 0.688

ttctgcagctcggcacgcccctgctgggcatc	CRISPR spacer
gccagcagctcggcatgccccagctggatcgt	Protospacer
 .* ***********.***** *****..  .

57. spacer 3.3|59466|32|FNEC01000005|CRT matches to NZ_CP029434 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-61, complete sequence) position: , mismatch: 10, identity: 0.688

gcgacgagtccggatgtcttggcctagtcgcg	CRISPR spacer
tggacgagttcggatgtgttggcctgaaaatg	Protospacer
  *******.******* *******..  ..*

58. spacer 3.3|59466|32|FNEC01000005|CRT matches to NZ_CP029428 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-51, complete sequence) position: , mismatch: 10, identity: 0.688

gcgacgagtccggatgtcttggcctagtcgcg	CRISPR spacer
tggacgagttcggatgtgttggcctgaaaatg	Protospacer
  *******.******* *******..  ..*

59. spacer 3.3|59466|32|FNEC01000005|CRT matches to NZ_CP029440 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-61, complete sequence) position: , mismatch: 10, identity: 0.688

gcgacgagtccggatgtcttggcctagtcgcg	CRISPR spacer
tggacgagttcggatgtgttggcctgaaaatg	Protospacer
  *******.******* *******..  ..*

60. spacer 3.4|59527|32|FNEC01000005|CRT matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcggcgggccgccagccaggccttgtaggc	CRISPR spacer
gcgccgctggccgccagccaggccgcaccatc	Protospacer
 *** ** **************** ... . *

61. spacer 3.4|59527|32|FNEC01000005|CRT matches to NC_016972 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence) position: , mismatch: 11, identity: 0.656

tcgcggcgggccgccagccaggccttgtaggc	CRISPR spacer
gtgcggcgggccgccaccctggcctaccgact	Protospacer
 .************** ** *****  ... .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. FNEC01000017
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 20915 : 27944 8 Ectocarpus_siliculosus_virus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. FNEC01000053
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29609 : 40490 15 Pseudomonas_phage(60.0%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
FNEC01000053.1|SDK82432.1|34105_34381_-|hypothetical-protein 34105_34381_- 91 aa aa NA NA NA 29609-40490 yes
4. FNEC01000037
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 114 : 34736 50 Pseudomonas_phage(28.57%) terminase,head,plate NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
FNEC01000037.1|SDK41283.1|31418_31715_-|hypothetical-protein 31418_31715_- 98 aa aa AcrIF4 NA FNEC01000037.1_31216_31456_- 114-34736 NA
FNEC01000037.1|SDK41332.1|31716_31917_-|hypothetical-protein 31716_31917_- 66 aa aa AcrIE3 NA FNEC01000037.1_31216_31456_- 114-34736 NA
FNEC01000037.1|SDK41378.1|31964_32147_-|hypothetical-protein 31964_32147_- 60 aa aa AcrIC5 NA FNEC01000037.1_31216_31456_- 114-34736 NA
5. FNEC01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. FNEC01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14497 : 21036 9 Pseudomonas_phage(50.0%) holin NA
DBSCAN-SWA_2 55837 : 66209 8 Caulobacter_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. FNEC01000047
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6559 : 16553 15 Pseudomonas_phage(62.5%) capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. FNEC01000031
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19467 : 25457 8 uncultured_Caudovirales_phage(75.0%) protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. FNEC01000023
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
FNEC01000023_1 12585-12794 Orphan I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
FNEC01000023_1 1.5|12735|32|FNEC01000023|CRT 12735-12766 32 FNEC01000053.1 38388-38419 2 0.938

1. spacer 1.5|12735|32|FNEC01000023|CRT matches to position: 38388-38419, mismatch: 2, identity: 0.938

caacgacgccgccgtgtgttcatcgtcgcaag	CRISPR spacer
caacgacgccgccgtgtgttcgttgtcgcaag	Protospacer
*********************.*.********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
FNEC01000023_1 1.5|12735|32|FNEC01000023|CRT 12735-12766 32 MN693903 Marine virus AFVG_250M471, complete genome 3878-3909 5 0.844
FNEC01000023_1 1.1|12616|29|FNEC01000023|PILER-CR 12616-12644 29 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1858068-1858096 6 0.793
FNEC01000023_1 1.5|12735|32|FNEC01000023|CRT 12735-12766 32 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 78182-78213 6 0.812
FNEC01000023_1 1.5|12735|32|FNEC01000023|CRT 12735-12766 32 NZ_CP023739 Methylosinus trichosporium OB3b plasmid pOB3b2, complete sequence 64045-64076 8 0.75
FNEC01000023_1 1.3|12615|32|FNEC01000023|CRT 12615-12646 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1858065-1858096 9 0.719
FNEC01000023_1 1.5|12735|32|FNEC01000023|CRT 12735-12766 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 460868-460899 9 0.719
FNEC01000023_1 1.5|12735|32|FNEC01000023|CRT 12735-12766 32 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 151904-151935 10 0.688
FNEC01000023_1 1.5|12735|32|FNEC01000023|CRT 12735-12766 32 NC_019202 Pseudomonas aeruginosa plasmid pKLC102, complete sequence 77613-77644 10 0.688

1. spacer 1.5|12735|32|FNEC01000023|CRT matches to MN693903 (Marine virus AFVG_250M471, complete genome) position: , mismatch: 5, identity: 0.844

caacgacgccgccgtgtgttcatcgtcgcaag	CRISPR spacer
cagtggcggcgccgggtgttcatcgtcgcaag	Protospacer
**..*.** ***** *****************

2. spacer 1.1|12616|29|FNEC01000023|PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 6, identity: 0.793

agatggagcgctatgcggcgcgcttgaac	CRISPR spacer
agatggggcgctatgcggcccgcgccatc	Protospacer
******.************ *** . * *

3. spacer 1.5|12735|32|FNEC01000023|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

caacg-acgccgccgtgtgttcatcgtcgcaag	CRISPR spacer
-aacgcacgccgccatgtgttcatcgccggcgg	Protospacer
 **** ********.***********.**  .*

4. spacer 1.5|12735|32|FNEC01000023|CRT matches to NZ_CP023739 (Methylosinus trichosporium OB3b plasmid pOB3b2, complete sequence) position: , mismatch: 8, identity: 0.75

caacgacgccgccgtgtgttcatcgtcgcaag	CRISPR spacer
acaggacgccgccgtctattcatcgtcgcggc	Protospacer
  * *********** *.***********.. 

5. spacer 1.3|12615|32|FNEC01000023|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.719

agatggagcgctatgcggcgcgcttgaacaaa	CRISPR spacer
agatggggcgctatgcggcccgcgccatcctc	Protospacer
******.************ *** . * *   

6. spacer 1.5|12735|32|FNEC01000023|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

caacgacgccgccgtgtgttcatcgtcgcaag	CRISPR spacer
gagccccgcctccgtgtgctcatcgtcgcgcc	Protospacer
 *.*  **** *******.**********.  

7. spacer 1.5|12735|32|FNEC01000023|CRT matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 10, identity: 0.688

caacgacgccgccgtgtgttcatcgtcgcaag	CRISPR spacer
tgggaccggcgccgcgtgttcatcgtcgccaa	Protospacer
... . ** *****.************** *.

8. spacer 1.5|12735|32|FNEC01000023|CRT matches to NC_019202 (Pseudomonas aeruginosa plasmid pKLC102, complete sequence) position: , mismatch: 10, identity: 0.688

caacgacgccgccgtgtgttcatcgtcgcaag	CRISPR spacer
ttcccgtttcgccgcgtgttcatcgtcgccag	Protospacer
.  * .. .*****.************** **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. FNEC01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 33743 : 39996 9 Powai_lake_megavirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage