Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
MNAC01000058 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000036 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig36, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000001 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig1, whole genome shotgun sequence 0 crisprs NA 0 0 1 2
MNAC01000018 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000033 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig33, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000055 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig55, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000028 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig28, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000039 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig39, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000023 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig23, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
MNAC01000042 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000007 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig7, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
MNAC01000019 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000010 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig10, whole genome shotgun sequence 1 crisprs csm6,csn2,cas2,cas1,cas9 10 31 0 0
MNAC01000059 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig59, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000011 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig11, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
MNAC01000046 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000020 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig20, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000034 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig34, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000035 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig35, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000056 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig56, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000044 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig44, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000014 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig14, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000057 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig57, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
MNAC01000025 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000015 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig15, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000053 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig53, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000049 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig49, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000012 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig12, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
MNAC01000032 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig32, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000021 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig21, whole genome shotgun sequence 0 crisprs NA 0 0 2 1
MNAC01000050 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000060 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000027 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig27, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000038 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig38, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000004 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig4, whole genome shotgun sequence 0 crisprs cas3 0 0 1 0
MNAC01000017 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig17, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000051 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000048 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000002 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig2, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
MNAC01000054 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig54, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000009 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig9, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
MNAC01000005 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig5, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
MNAC01000030 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000013 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig13, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000031 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig31, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000008 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig8, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000040 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig40, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000043 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000006 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig6, whole genome shotgun sequence 1 crisprs cas2,cas1,cas4,cas7,cas8c,cas5,cas3 0 1 0 0
MNAC01000022 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig22, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000024 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000037 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig37, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000029 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig29, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000026 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000045 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig45, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000052 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig52, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000016 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
MNAC01000047 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig47, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
MNAC01000003 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig3, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
MNAC01000041 Streptococcus iniae strain UEL-Si1 Strp_iniae_contig41, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. MNAC01000031
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. MNAC01000046
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. MNAC01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 70340 84 Streptococcus_phage(73.81%) portal,holin,capsid,transposase,head,tail,terminase,integrase attL 43450:43465|attR 71035:71050
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
MNAC01000001.1|OHX28280.1|934_1435_-|hypothetical-protein 934_1435_- 166 aa aa NA HTH_21 NA 0-70340 yes
MNAC01000001.1|OHX28281.1|1630_1819_-|hypothetical-protein 1630_1819_- 62 aa aa NA HTH_21 NA 0-70340 yes
4. MNAC01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 43633 : 54418 16 Streptococcus_phage(87.5%) integrase attL 39565:39580|attR 55625:55640
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. MNAC01000006
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
MNAC01000006_1 76247-76871 TypeI I-C
9 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
MNAC01000006_1 1.4|76475|33|MNAC01000006|CRISPRCasFinder,CRT,PILER-CR 76475-76507 33 NZ_LT960613 Vibrio tapetis subsp. tapetis isolate Vibrio tapetis CECT4600 plasmid P, complete sequence 9939-9971 8 0.758
MNAC01000006_1 1.4|76475|33|MNAC01000006|CRISPRCasFinder,CRT,PILER-CR 76475-76507 33 NZ_CP044979 Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence 151510-151542 8 0.758
MNAC01000006_1 1.4|76475|33|MNAC01000006|CRISPRCasFinder,CRT,PILER-CR 76475-76507 33 NC_020394 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-233, complete sequence 5037-5069 9 0.727
MNAC01000006_1 1.4|76475|33|MNAC01000006|CRISPRCasFinder,CRT,PILER-CR 76475-76507 33 CP020755 Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence 234865-234897 9 0.727
MNAC01000006_1 1.4|76475|33|MNAC01000006|CRISPRCasFinder,CRT,PILER-CR 76475-76507 33 NZ_CP021062 Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence 450272-450304 9 0.727
MNAC01000006_1 1.4|76475|33|MNAC01000006|CRISPRCasFinder,CRT,PILER-CR 76475-76507 33 NC_028924 Polaribacter phage P12002L, complete genome 48449-48481 9 0.727

1. spacer 1.4|76475|33|MNAC01000006|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT960613 (Vibrio tapetis subsp. tapetis isolate Vibrio tapetis CECT4600 plasmid P, complete sequence) position: , mismatch: 8, identity: 0.758

tcaaaaacaaagatttcaccaaaacatgtgatt	CRISPR spacer
ccaaaatcaaagatttgaccaaaacggtggagt	Protospacer
.***** ********* ********.   ** *

2. spacer 1.4|76475|33|MNAC01000006|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044979 (Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence) position: , mismatch: 8, identity: 0.758

tcaaaaacaaagatttcaccaaaacatgtgatt-	CRISPR spacer
tgcaaaacaaagatttaaccgaaacat-taacag	Protospacer
*  ************* ***.****** *.*.  

3. spacer 1.4|76475|33|MNAC01000006|CRISPRCasFinder,CRT,PILER-CR matches to NC_020394 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-233, complete sequence) position: , mismatch: 9, identity: 0.727

tcaaaaacaaagatttcaccaaaacatgtgatt	CRISPR spacer
tgcaaaacaaagatttaaccgaaacattaaaag	Protospacer
*  ************* ***.******  .*  

4. spacer 1.4|76475|33|MNAC01000006|CRISPRCasFinder,CRT,PILER-CR matches to CP020755 (Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence) position: , mismatch: 9, identity: 0.727

tcaaaaacaaagatttcaccaaaacatgtgatt	CRISPR spacer
tgcaaaacaaagatttaaccgaaacattaaaag	Protospacer
*  ************* ***.******  .*  

5. spacer 1.4|76475|33|MNAC01000006|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021062 (Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence) position: , mismatch: 9, identity: 0.727

tcaaaaacaaagatttcaccaaaacatgtgatt	CRISPR spacer
tgcaaaacaaagatttaaccgaaacattaaaag	Protospacer
*  ************* ***.******  .*  

6. spacer 1.4|76475|33|MNAC01000006|CRISPRCasFinder,CRT,PILER-CR matches to NC_028924 (Polaribacter phage P12002L, complete genome) position: , mismatch: 9, identity: 0.727

tcaaaaacaaagatttcaccaaaacatgtgatt	CRISPR spacer
tgaaaaacaaagagatcaccaaaacaataaaga	Protospacer
* ***********  ***********   .*  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. MNAC01000007
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 35 : 80363 83 Streptococcus_phage(51.02%) holin,tail,capsid,terminase,integrase,head,transposase,protease,tRNA attL 46226:46243|attR 80366:80383
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. MNAC01000023
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1530 : 19578 27 Streptococcus_phage(88.0%) integrase attL 7505:7518|attR 26223:26236
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. MNAC01000009
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17499 : 31428 19 Streptococcus_phage(84.62%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. MNAC01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 26971 : 58228 44 Streptococcus_phage(92.5%) terminase,integrase,capsid,holin,portal,tail,head attL 29556:29581|attR 60399:60424
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. MNAC01000047
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3855 : 12037 7 Streptococcus_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. MNAC01000021
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 67 : 7898 12 Streptococcus_phage(91.67%) tail,capsid NA
DBSCAN-SWA_2 11889 : 23699 15 Streptococcus_phage(36.36%) holin NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
MNAC01000021.1|OHX26873.1|16288_16483_-|hypothetical-protein 16288_16483_- 64 aa aa AcrIIA20 NA NA 11889-23699 yes
12. MNAC01000010
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
MNAC01000010_1 37300-40042 TypeII II-A,II-B
41 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
MNAC01000010_1 1.12|38061|30|MNAC01000010|CRT,CRISPRCasFinder 38061-38090 30 MNAC01000031.1 23772-23801 0 1.0
MNAC01000010_1 1.13|38127|30|MNAC01000010|CRT,CRISPRCasFinder 38127-38156 30 MNAC01000046.1 9777-9806 0 1.0
MNAC01000010_1 1.19|38524|30|MNAC01000010|CRT,CRISPRCasFinder 38524-38553 30 MNAC01000023.1 8984-9013 0 1.0
MNAC01000010_1 1.20|38590|30|MNAC01000010|CRT,CRISPRCasFinder 38590-38619 30 MNAC01000023.1 8725-8754 0 1.0
MNAC01000010_1 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder 38656-38685 30 MNAC01000001.1 34997-35026 2 0.933
MNAC01000010_1 1.24|38854|30|MNAC01000010|CRT,CRISPRCasFinder 38854-38883 30 MNAC01000021.1 13086-13115 1 0.967
MNAC01000010_1 1.27|39053|30|MNAC01000010|CRT,CRISPRCasFinder 39053-39082 30 MNAC01000021.1 12850-12879 0 1.0
MNAC01000010_1 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder 39119-39148 30 MNAC01000023.1 18664-18693 0 1.0
MNAC01000010_1 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder 39185-39214 30 MNAC01000023.1 9214-9243 0 1.0
MNAC01000010_1 1.30|39251|30|MNAC01000010|CRT,CRISPRCasFinder 39251-39280 30 MNAC01000021.1 14136-14165 0 1.0

1. spacer 1.12|38061|30|MNAC01000010|CRT,CRISPRCasFinder matches to position: 23772-23801, mismatch: 0, identity: 1.0

aaaacaaagacaggaaattatacttatcaa	CRISPR spacer
aaaacaaagacaggaaattatacttatcaa	Protospacer
******************************

2. spacer 1.13|38127|30|MNAC01000010|CRT,CRISPRCasFinder matches to position: 9777-9806, mismatch: 0, identity: 1.0

aaattaagacgtattgcttcaaattcctta	CRISPR spacer
aaattaagacgtattgcttcaaattcctta	Protospacer
******************************

3. spacer 1.19|38524|30|MNAC01000010|CRT,CRISPRCasFinder matches to position: 8984-9013, mismatch: 0, identity: 1.0

taagttaccgtaagttaccgaacttttttg	CRISPR spacer
taagttaccgtaagttaccgaacttttttg	Protospacer
******************************

4. spacer 1.20|38590|30|MNAC01000010|CRT,CRISPRCasFinder matches to position: 8725-8754, mismatch: 0, identity: 1.0

cggtaacacggtaacttttgattttttaga	CRISPR spacer
cggtaacacggtaacttttgattttttaga	Protospacer
******************************

5. spacer 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder matches to position: 34997-35026, mismatch: 2, identity: 0.933

ttgaacaaattgcttatgataaagacatca	CRISPR spacer
ttgaacagattgcttataataaagacatca	Protospacer
*******.*********.************

6. spacer 1.24|38854|30|MNAC01000010|CRT,CRISPRCasFinder matches to position: 13086-13115, mismatch: 1, identity: 0.967

agattaagtaactcaccattaaagcttgat	CRISPR spacer
agattaagcaactcaccattaaagcttgat	Protospacer
********.*********************

7. spacer 1.27|39053|30|MNAC01000010|CRT,CRISPRCasFinder matches to position: 12850-12879, mismatch: 0, identity: 1.0

gttgatgtcagcattaatgtgattgattat	CRISPR spacer
gttgatgtcagcattaatgtgattgattat	Protospacer
******************************

8. spacer 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder matches to position: 18664-18693, mismatch: 0, identity: 1.0

ttgattagttaatttcccaaaagtcatatt	CRISPR spacer
ttgattagttaatttcccaaaagtcatatt	Protospacer
******************************

9. spacer 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder matches to position: 9214-9243, mismatch: 0, identity: 1.0

gctcaaaagcaacatcagtacactcaaaaa	CRISPR spacer
gctcaaaagcaacatcagtacactcaaaaa	Protospacer
******************************

10. spacer 1.30|39251|30|MNAC01000010|CRT,CRISPRCasFinder matches to position: 14136-14165, mismatch: 0, identity: 1.0

atgaagatattatgtcacttaattaaactc	CRISPR spacer
atgaagatattatgtcacttaattaaactc	Protospacer
******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
MNAC01000010_1 1.14|38193|30|MNAC01000010|CRT,CRISPRCasFinder 38193-38222 30 MK448924 Streptococcus phage Javan384, complete genome 17226-17255 0 1.0
MNAC01000010_1 1.14|38193|30|MNAC01000010|CRT,CRISPRCasFinder 38193-38222 30 MK448746 Streptococcus phage Javan383, complete genome 16678-16707 0 1.0
MNAC01000010_1 1.14|38193|30|MNAC01000010|CRT,CRISPRCasFinder 38193-38222 30 MK448753 Streptococcus phage Javan407, complete genome 17053-17082 0 1.0
MNAC01000010_1 1.35|39581|30|MNAC01000010|CRT,CRISPRCasFinder 39581-39610 30 MK448924 Streptococcus phage Javan384, complete genome 9959-9988 0 1.0
MNAC01000010_1 1.39|39845|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39845-39874 30 MK448750 Streptococcus phage Javan393, complete genome 7259-7288 0 1.0
MNAC01000010_1 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder 38259-38288 30 MK448685 Streptococcus phage Javan155, complete genome 5207-5236 1 0.967
MNAC01000010_1 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder 38259-38288 30 MK448849 Streptococcus phage Javan128, complete genome 4110-4139 1 0.967
MNAC01000010_1 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder 38259-38288 30 MK448958 Streptococcus phage Javan486, complete genome 6518-6547 1 0.967
MNAC01000010_1 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder 38259-38288 30 MK448853 Streptococcus phage Javan144, complete genome 5207-5236 1 0.967
MNAC01000010_1 1.26|38987|30|MNAC01000010|CRT,CRISPRCasFinder 38987-39016 30 MK448796 Streptococcus phage Javan53, complete genome 12010-12039 1 0.967
MNAC01000010_1 1.26|38987|30|MNAC01000010|CRT,CRISPRCasFinder 38987-39016 30 MK448796 Streptococcus phage Javan53, complete genome 22640-22669 1 0.967
MNAC01000010_1 1.26|38987|30|MNAC01000010|CRT,CRISPRCasFinder 38987-39016 30 MK448796 Streptococcus phage Javan53, complete genome 47562-47591 1 0.967
MNAC01000010_1 1.26|38987|30|MNAC01000010|CRT,CRISPRCasFinder 38987-39016 30 MK448526 Streptococcus satellite phage Javan54, complete genome 8097-8126 1 0.967
MNAC01000010_1 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder 39119-39148 30 MK448748 Streptococcus phage Javan389, complete genome 886-915 1 0.967
MNAC01000010_1 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder 39119-39148 30 MK448751 Streptococcus phage Javan399, complete genome 886-915 1 0.967
MNAC01000010_1 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder 39119-39148 30 MK448754 Streptococcus phage Javan411, complete genome 886-915 1 0.967
MNAC01000010_1 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder 39119-39148 30 MK448929 Streptococcus phage Javan400, complete genome 886-915 1 0.967
MNAC01000010_1 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder 39119-39148 30 MK448926 Streptococcus phage Javan392, complete genome 886-915 1 0.967
MNAC01000010_1 1.31|39317|30|MNAC01000010|CRT,CRISPRCasFinder 39317-39346 30 MK448753 Streptococcus phage Javan407, complete genome 20333-20362 1 0.967
MNAC01000010_1 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder 39449-39478 30 MK448753 Streptococcus phage Javan407, complete genome 20234-20263 1 0.967
MNAC01000010_1 1.35|39581|30|MNAC01000010|CRT,CRISPRCasFinder 39581-39610 30 MK448750 Streptococcus phage Javan393, complete genome 10211-10240 1 0.967
MNAC01000010_1 1.35|39581|30|MNAC01000010|CRT,CRISPRCasFinder 39581-39610 30 MK448753 Streptococcus phage Javan407, complete genome 9278-9307 1 0.967
MNAC01000010_1 1.41|39977|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39977-40006 30 MK448926 Streptococcus phage Javan392, complete genome 3814-3843 1 0.967
MNAC01000010_1 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder 38259-38288 30 MK449010 Streptococcus phage Javan90, complete genome 6794-6823 2 0.933
MNAC01000010_1 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder 38259-38288 30 MK448833 Streptococcus phage Javan87, complete genome 6794-6823 2 0.933
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NZ_KY579372 Enterococcus faecium strain F120805 substr. faecium plasmid unnamed, complete sequence 69152-69182 2 0.935
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NC_014475 Enterococcus faecalis plasmid pWZ1668, complete sequence 41116-41146 2 0.935
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NZ_CP030934 Enterococcus gilvus strain CR1 plasmid pCR1B, complete sequence 65604-65634 2 0.935
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NZ_MF580438 Enterococcus faecium strain E35048 plasmid pE35048-oc, complete sequence 24108-24138 2 0.935
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NZ_CP038866 Vagococcus sp. CF-49 plasmid punnamed1, complete sequence 4945-4975 2 0.935
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NZ_AP018541 Enterococcus faecalis strain KUB3006 plasmid pKUB3006-3, complete sequence 19334-19364 2 0.935
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NC_019284 Enterococcus faecalis plasmid pWZ7140, complete sequence 40028-40058 2 0.935
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NC_019213 Enterococcus faecalis plasmid pWZ909, complete sequence 35353-35383 2 0.935
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NC_013514 Enterococcus faecalis plasmid pAMbeta1, complete sequence 18119-18149 2 0.935
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NZ_CP033741 Enterococcus sp. FDAARGOS_553 plasmid unnamed2, complete sequence 51037-51067 2 0.935
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NZ_LN774770 Lactococcus piscium MKFS47 plasmid II, complete sequence 27940-27970 2 0.935
MNAC01000010_1 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder 38656-38685 30 MK448724 Streptococcus phage Javan273, complete genome 35315-35344 2 0.933
MNAC01000010_1 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder 39119-39148 30 MK448723 Streptococcus phage Javan271, complete genome 886-915 2 0.933
MNAC01000010_1 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder 39119-39148 30 MK448747 Streptococcus phage Javan385, complete genome 886-915 2 0.933
MNAC01000010_1 1.31|39317|30|MNAC01000010|CRT,CRISPRCasFinder 39317-39346 30 MK448924 Streptococcus phage Javan384, complete genome 20492-20521 2 0.933
MNAC01000010_1 1.36|39647|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39647-39676 30 KX160209 Lactococcus phage 58502, complete genome 16797-16826 2 0.933
MNAC01000010_1 1.36|39647|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39647-39676 30 MN552144 Lactococcus phage P1045, complete genome 17706-17735 2 0.933
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NC_008445 Enterococcus faecalis RE25 plasmid pRE25, complete sequence 24695-24725 3 0.903
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NZ_CP032740 Enterococcus casseliflavus strain EC-369 plasmid pEC369, complete sequence 19187-19217 3 0.903
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 MH830362 Enterococcus faecalis plasmid p4, complete sequence 46186-46216 3 0.903
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 MH830362 Enterococcus faecalis plasmid p4, complete sequence 90364-90394 3 0.903
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NZ_CP049777 Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence 21966-21996 3 0.903
MNAC01000010_1 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder 38656-38685 30 NC_009018 Streptococcus phage phi3396, complete genome 34666-34695 3 0.9
MNAC01000010_1 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder 38656-38685 30 MK448859 Streptococcus phage Javan170, complete genome 38906-38935 3 0.9
MNAC01000010_1 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder 38656-38685 30 MK448854 Streptococcus phage Javan146, complete genome 39248-39277 3 0.9
MNAC01000010_1 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder 38656-38685 30 MK448680 Streptococcus phage Javan139, complete genome 33941-33970 3 0.9
MNAC01000010_1 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder 38656-38685 30 MK448856 Streptococcus phage Javan158, complete genome 11904-11933 3 0.9
MNAC01000010_1 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder 38656-38685 30 MK448688 Streptococcus phage Javan161, complete genome 38864-38893 3 0.9
MNAC01000010_1 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder 38656-38685 30 MK448673 Streptococcus phage Javan119, complete genome 42532-42561 3 0.9
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 KC465899 Pelagibacter phage HTVC008M, complete genome 4838-4867 5 0.833
MNAC01000010_1 1.41|39977|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39977-40006 30 MK448747 Streptococcus phage Javan385, complete genome 4760-4789 5 0.833
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 MN871463 UNVERIFIED: Pseudomonas phage Pa-L, complete genome 39561-39589 6 0.793
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 MN871469 UNVERIFIED: Pseudomonas phage Pa-S, complete genome 1823-1851 6 0.793
MNAC01000010_1 1.6|37665|30|MNAC01000010|CRT,CRISPRCasFinder 37665-37694 30 NC_011798 Lactobacillus farciminis KCTC 3681 plasmid pLF24, complete sequence 639-668 6 0.8
MNAC01000010_1 1.7|37731|30|MNAC01000010|CRT,CRISPRCasFinder 37731-37760 30 NZ_CP042835 Enterococcus faecium strain FA3 plasmid unnamed2 35624-35653 6 0.8
MNAC01000010_1 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder 37797-37826 30 MN693684 Marine virus AFVG_250M122, complete genome 25216-25245 6 0.8
MNAC01000010_1 1.12|38061|30|MNAC01000010|CRT,CRISPRCasFinder 38061-38090 30 MH598801 Pelagibacter phage HTVC200P, complete genome 39425-39454 6 0.8
MNAC01000010_1 1.13|38127|30|MNAC01000010|CRT,CRISPRCasFinder 38127-38156 30 MH576968 Streptomyces phage Wofford, complete genome 57692-57721 6 0.8
MNAC01000010_1 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder 38656-38685 30 NZ_CP036456 Streptomonospora sp. M2 plasmid phiM2, complete sequence 77226-77255 6 0.8
MNAC01000010_1 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder 38656-38685 30 NZ_CP031220 Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence 44457-44486 6 0.8
MNAC01000010_1 1.27|39053|30|MNAC01000010|CRT,CRISPRCasFinder 39053-39082 30 HF937074 Staphylococcus phage PSa3 complete sequence 4925-4954 6 0.8
MNAC01000010_1 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder 39119-39148 30 NC_014749 Calditerrivibrio nitroreducens DSM 19672 plasmid pCALNI01, complete sequence 16934-16963 6 0.8
MNAC01000010_1 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder 39185-39214 30 AP013499 Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S39-C84 4805-4834 6 0.8
MNAC01000010_1 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder 39185-39214 30 AP013497 Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S35-C79 22237-22266 6 0.8
MNAC01000010_1 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder 39185-39214 30 AP013498 Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S38-C76 6578-6607 6 0.8
MNAC01000010_1 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder 39185-39214 30 AP013776 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C68A-MedDCM-OCT-S36-C73, *** SEQUENCING IN PROGRESS *** 4513-4542 6 0.8
MNAC01000010_1 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder 39185-39214 30 AP013496 Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S28-C61 9839-9868 6 0.8
MNAC01000010_1 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder 39185-39214 30 AP013775 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C68A-MedDCM-OCT-S26-C73, *** SEQUENCING IN PROGRESS *** 26862-26891 6 0.8
MNAC01000010_1 1.35|39581|30|MNAC01000010|CRT,CRISPRCasFinder 39581-39610 30 MH673673 Thermus phage phiLo, complete genome 6434-6463 6 0.8
MNAC01000010_1 1.37|39713|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39713-39742 30 AP014307 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S29-C31, *** SEQUENCING IN PROGRESS *** 4186-4215 6 0.8
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP047444 Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-7 66277-66305 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP047444 Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-7 71826-71854 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP039213 Piscirickettsia salmonis strain Psal-103 plasmid unnamed4, complete sequence 4210-4238 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP048070 Piscirickettsia salmonis strain Ps-8079A plasmid Ps8079A-p4, complete sequence 8259-8287 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP038897 Piscirickettsia salmonis strain Psal-006a plasmid unnamed4, complete sequence 4207-4235 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP039200 Piscirickettsia salmonis strain Psal-161 plasmid unnamed5, complete sequence 3056-3084 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP013771 Piscirickettsia salmonis strain PM23019A plasmid p3PS3, complete sequence 6327-6355 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP013767 Piscirickettsia salmonis strain PM21567A plasmid p5PS2, complete sequence 31259-31287 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP013775 Piscirickettsia salmonis strain PM37984A plasmid p2PS4, complete sequence 19618-19646 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP013780 Piscirickettsia salmonis strain PM51819A plasmid p2PS5, complete sequence 25006-25034 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP050943 Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p5, complete sequence 10357-10385 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP050946 Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p8, complete sequence 1761-1789 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP050946 Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p8, complete sequence 35043-35071 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP050947 Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p9, complete sequence 10619-10647 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP039206 Piscirickettsia salmonis strain Psal-182 plasmid unnamed2, complete sequence 2990-3018 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP012417 Piscirickettsia salmonis strain PM15972A1 plasmid pPSA1-4, complete sequence 15889-15917 7 0.759
MNAC01000010_1 1.1|37336|29|MNAC01000010|CRT 37336-37364 29 NZ_CP038912 Piscirickettsia salmonis strain Psal-009 plasmid unnamed4, complete sequence 4074-4102 7 0.759
MNAC01000010_1 1.2|37401|30|MNAC01000010|CRT,CRISPRCasFinder 37401-37430 30 NZ_CP011513 Paenibacillus peoriae strain HS311 plasmid unnamed, complete sequence 172336-172365 7 0.767
MNAC01000010_1 1.2|37401|30|MNAC01000010|CRT,CRISPRCasFinder 37401-37430 30 CAJDJZ010000002 Enterococcus phage vB_EfaH_149 genome assembly, contig: phage149-genome, whole genome shotgun sequence 3976-4005 7 0.767
MNAC01000010_1 1.2|37401|30|MNAC01000010|CRT,CRISPRCasFinder 37401-37430 30 CAJDJY010000002 Enterococcus phage 156 genome assembly, contig: phage156-genome, whole genome shotgun sequence 3910-3939 7 0.767
MNAC01000010_1 1.2|37401|30|MNAC01000010|CRT,CRISPRCasFinder 37401-37430 30 LR031359 Enterococcus phage 156, complete genome 3910-3939 7 0.767
MNAC01000010_1 1.7|37731|30|MNAC01000010|CRT,CRISPRCasFinder 37731-37760 30 NZ_CP040096 Pantoea sp. SO10 plasmid unnamed1, complete sequence 581686-581715 7 0.767
MNAC01000010_1 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder 37797-37826 30 KM236247 Bacillus phage Pascal, complete genome 31600-31629 7 0.767
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NZ_CP044103 Streptococcus dysgalactiae strain FDAARGOS_654 plasmid unnamed1 13290-13320 7 0.774
MNAC01000010_1 1.20|38590|30|MNAC01000010|CRT,CRISPRCasFinder 38590-38619 30 NC_021808 Vibrio harveyi strain ORM4 plasmid pVCR1, complete sequence 2577-2606 7 0.767
MNAC01000010_1 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder 38656-38685 30 AP018319 Nostoc sp. HK-01 plasmid plasmid1 DNA, complete genome 3306-3335 7 0.767
MNAC01000010_1 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder 39185-39214 30 NZ_CP020750 Bacillus mycoides strain Gnyt1 plasmid unnamed7, complete sequence 49928-49957 7 0.767
MNAC01000010_1 1.32|39383|30|MNAC01000010|CRT,CRISPRCasFinder 39383-39412 30 MH319754 Marine virus AG-345-L05 Ga0172272_11 genomic sequence 34654-34683 7 0.767
MNAC01000010_1 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder 39449-39478 30 NC_031006 Bacillus phage DIGNKC, complete genome 60384-60413 7 0.767
MNAC01000010_1 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder 39449-39478 30 MT584805 Bacillus phage Tomato, complete genome 63218-63247 7 0.767
MNAC01000010_1 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder 39449-39478 30 MF288919 Bacillus phage AaronPhadgers, complete genome 60262-60291 7 0.767
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP016726 Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08A, complete sequence 32238-32267 7 0.767
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 MK250021 Prevotella phage Lak-B2, complete genome 47805-47834 7 0.767
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 KF669662 Bacillus phage Spock, complete genome 89093-89122 7 0.767
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 MK250023 Prevotella phage Lak-B4, complete genome 47701-47730 7 0.767
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 MK250027 Prevotella phage Lak-B8, complete genome 47837-47866 7 0.767
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 MK250026 Prevotella phage Lak-B7, complete genome 47837-47866 7 0.767
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 KY888882 Bacillus phage Flapjack, complete genome 89359-89388 7 0.767
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 MN783745 Escherichia coli plasmid pFII-FIB, complete sequence 17924-17953 7 0.767
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_KP342511 Enterococcus faecium isolate N12-493 plasmid pEfm12493, complete sequence 92810-92839 7 0.767
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP051739 Escherichia coli strain SCU-105 plasmid pSCU-105-1, complete sequence 23751-23780 7 0.767
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 AJ972879 Yersinia phage phiR1-37 complete genome 111146-111175 7 0.767
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NC_016163 Yersinia phage phiR1-37, complete genome 111146-111175 7 0.767
MNAC01000010_1 1.41|39977|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39977-40006 30 MK448754 Streptococcus phage Javan411, complete genome 3067-3096 7 0.767
MNAC01000010_1 1.41|39977|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39977-40006 30 MK448929 Streptococcus phage Javan400, complete genome 3067-3096 7 0.767
MNAC01000010_1 1.41|39977|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39977-40006 30 CAJDJX010000002 Enterococcus phage Q69 genome assembly, contig: phageQ69-genome, whole genome shotgun sequence 39216-39245 7 0.767
MNAC01000010_1 1.41|39977|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39977-40006 30 MK721187 Enterococcus phage vB_EfaS_Ef6.1, complete genome 28585-28614 7 0.767
MNAC01000010_1 1.7|37731|30|MNAC01000010|CRT,CRISPRCasFinder 37731-37760 30 MK249871 Vibrio phage LP.2, complete genome 10730-10759 8 0.733
MNAC01000010_1 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder 37797-37826 30 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 180689-180718 8 0.733
MNAC01000010_1 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder 37797-37826 30 MT001829 Salmonella phage SE_PL, complete genome 214376-214405 8 0.733
MNAC01000010_1 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder 37797-37826 30 MK773491 Salmonella phage 7t3, complete genome 134360-134389 8 0.733
MNAC01000010_1 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder 37797-37826 30 NC_022770 Bacillus phage Pony, complete genome 32426-32455 8 0.733
MNAC01000010_1 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder 37797-37826 30 KM236248 Bacillus phage Pookie, complete genome 32650-32679 8 0.733
MNAC01000010_1 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder 37797-37826 30 MK268344 Salmonella phage Munch, complete genome 71675-71704 8 0.733
MNAC01000010_1 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder 37797-37826 30 KF669655 Bacillus phage Page, complete genome 32375-32404 8 0.733
MNAC01000010_1 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder 37797-37826 30 KF669657 Bacillus phage poppyseed, complete genome 32375-32404 8 0.733
MNAC01000010_1 1.10|37929|30|MNAC01000010|CRT,CRISPRCasFinder 37929-37958 30 KT151959 Brevibacillus phage Sundance, complete genome 83929-83958 8 0.733
MNAC01000010_1 1.14|38193|30|MNAC01000010|CRT,CRISPRCasFinder 38193-38222 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1590842-1590871 8 0.733
MNAC01000010_1 1.14|38193|30|MNAC01000010|CRT,CRISPRCasFinder 38193-38222 30 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 741409-741438 8 0.733
MNAC01000010_1 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder 38457-38487 31 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 302278-302308 8 0.742
MNAC01000010_1 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder 38656-38685 30 NZ_CP022047 Staphylococcus sciuri strain FDAARGOS_285 plasmid unnamed1, complete sequence 18272-18301 8 0.733
MNAC01000010_1 1.24|38854|30|MNAC01000010|CRT,CRISPRCasFinder 38854-38883 30 MF459646 Erwinia phage vB_EamM_RisingSun, complete genome 115761-115790 8 0.733
MNAC01000010_1 1.25|38920|31|MNAC01000010|CRT,CRISPRCasFinder 38920-38950 31 MN694475 Marine virus AFVG_250M72, complete genome 15067-15097 8 0.742
MNAC01000010_1 1.25|38920|31|MNAC01000010|CRT,CRISPRCasFinder 38920-38950 31 NZ_CP007649 Lactobacillus salivarius strain JCM1046 plasmid pLMP1046, complete sequence 96857-96887 8 0.742
MNAC01000010_1 1.25|38920|31|MNAC01000010|CRT,CRISPRCasFinder 38920-38950 31 NZ_CP014289 Bacillus thuringiensis strain Bt185 plasmid pBT1850046, complete sequence 42588-42618 8 0.742
MNAC01000010_1 1.25|38920|31|MNAC01000010|CRT,CRISPRCasFinder 38920-38950 31 NZ_CP047429 Spiroplasma citri strain BLH-13 plasmid pSciBLH13-1, complete sequence 56225-56255 8 0.742
MNAC01000010_1 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder 39185-39214 30 NC_010945 Streptococcus phage PH15, complete genome 11596-11625 8 0.733
MNAC01000010_1 1.31|39317|30|MNAC01000010|CRT,CRISPRCasFinder 39317-39346 30 MT774388 CrAssphage cr112_1, complete genome 14152-14181 8 0.733
MNAC01000010_1 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder 39449-39478 30 AP013753 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C63A-MedDCM-OCT-S44-C48, *** SEQUENCING IN PROGRESS *** 15584-15613 8 0.733
MNAC01000010_1 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder 39449-39478 30 NC_002703 Lactococcus phage Tuc2009, complete genome 21070-21099 8 0.733
MNAC01000010_1 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder 39449-39478 30 AP013471 Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C63A-MedDCM-OCT-S41-C57 10305-10334 8 0.733
MNAC01000010_1 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder 39449-39478 30 AF109874 Bacteriophage Tuc2009, complete genome 21070-21099 8 0.733
MNAC01000010_1 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder 39449-39478 30 AP013752 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C63A-MedDCM-OCT-S30-C46, *** SEQUENCING IN PROGRESS *** 598-627 8 0.733
MNAC01000010_1 1.37|39713|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39713-39742 30 NC_017296 Clostridium acetobutylicum EA 2018 plasmid pEA2018, complete sequence 41620-41649 8 0.733
MNAC01000010_1 1.37|39713|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39713-39742 30 NC_015686 Clostridium acetobutylicum DSM 1731 plasmid pSMBa, complete sequence 41620-41649 8 0.733
MNAC01000010_1 1.37|39713|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39713-39742 30 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 277038-277067 8 0.733
MNAC01000010_1 1.37|39713|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39713-39742 30 NC_001988 Clostridium acetobutylicum ATCC 824 plasmid pSOL1, complete sequence 41620-41649 8 0.733
MNAC01000010_1 1.38|39779|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39779-39808 30 MT188223 Acinetobacter phage vB_AbaM_D22, complete genome 39611-39640 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_KU525621 Bacillus anthracis strain P.NO2 plasmid pXO2, complete sequence 21474-21503 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NC_014332 Bacillus cereus biovar anthracis str. CI plasmid pCI-XO2, complete sequence 22719-22748 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NC_012577 Bacillus anthracis str. CDC 684 plasmid pX02, complete sequence 20127-20156 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP028161 Lactococcus lactis subsp. lactis strain 14B4 plasmid p14B4, complete sequence 12760-12789 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP015778 Bacillus anthracis strain Tangail-1 plasmid pXO2, complete sequence 21691-21720 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP018905 Bacillus anthracis strain Tyrol 4675 plasmid pXO2, complete sequence 21526-21555 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP023003 Bacillus anthracis strain 14RA5914 plasmid pX02, complete sequence 51899-51928 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_AP019733 Bacillus anthracis strain PCr plasmid PCr-pXO2 57681-57710 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_AP018445 Bacillus anthracis strain CZC5 plasmid pXO2, complete sequence 21691-21720 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP029325 Bacillus anthracis strain 17OD930 plasmid pXO2, complete sequence 9966-9995 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NC_012655 Bacillus anthracis str. A0248 plasmid pXO2, complete sequence 22734-22763 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NC_007323 Bacillus anthracis str. 'Ames Ancestor' plasmid pXO2, complete sequence 21691-21720 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP010854 Bacillus anthracis strain A1144 plasmid pXO2, complete sequence 21858-21887 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP007617 Bacillus anthracis strain 2000031021 plasmid pXO2, complete sequence 91960-91989 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP008848 Bacillus anthracis strain HYU01 plasmid pX02, complete sequence 21616-21645 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP006744 Bacillus anthracis str. SVA11 plasmid pXO2, complete sequence 21623-21652 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_AP014835 Bacillus anthracis strain Shikan-NIID plasmid pXO2 21687-21716 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP029807 Bacillus anthracis strain London_499 plasmid pX02, complete sequence 21692-21721 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NC_002146 Bacillus anthracis plasmid pXO2, complete sequence 22183-22212 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NC_017727 Bacillus anthracis str. H9401 plasmid BAP2, complete sequence 21691-21720 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP009314 Bacillus anthracis str. Turkey32 strain 35 plasmid unnamed, complete sequence 28539-28568 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP014178 Bacillus anthracis strain Stendal plasmid pXO2, complete sequence 21691-21720 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP009475 Bacillus anthracis strain Pasteur plasmid pXO2, complete sequence 44205-44234 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP009900 Bacillus anthracis strain 2002013094 plasmid pXO2, complete sequence 6664-6693 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP009339 Bacillus anthracis strain Ohio ACB plasmid 2, complete sequence 40982-41011 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP009695 Bacillus anthracis strain RA3 plasmid pXO2, complete sequence 82109-82138 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP009462 Bacillus anthracis strain SK-102 plasmid pXO2, complete sequence 49291-49320 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP009698 Bacillus anthracis strain BA1035 plasmid pXO2, complete sequence 18869-18898 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP009542 Bacillus anthracis strain BA1015 plasmid pXO2, complete sequence 12839-12868 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP010320 Bacillus anthracis strain Canadian Bison isolate A0369 plasmid 2, complete sequence 78830-78859 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP009329 Bacillus anthracis strain K3 plasmid 2, complete sequence 55967-55996 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP009326 Bacillus anthracis strain Vollum 1B plasmid 2, complete sequence 12724-12753 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP009979 Bacillus anthracis strain Ames isolate BACI008 plasmid unnamed2, complete sequence 51790-51819 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP001972 Bacillus anthracis str. A16 plasmid pXO2, complete sequence 21690-21719 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP047133 Bacillus anthracis str. BF1 plasmid pXO2, complete sequence 21616-21645 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP013227 Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_1, complete sequence 18759-18788 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NZ_CP015111 Acinetobacter sp. TGL-Y2 plasmid unnamed1, complete sequence 40698-40727 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NC_022877 Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence 13474-13503 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 JN797796 Bacillus phage B5S, complete genome 102399-102428 8 0.733
MNAC01000010_1 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39911-39940 30 NC_018863 Bacillus phage B4, complete genome 102343-102372 8 0.733
MNAC01000010_1 1.41|39977|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39977-40006 30 NZ_CP051543 Paracoccus sanguinis strain OM2164 plasmid pPspOM122, complete sequence 75075-75104 8 0.733
MNAC01000010_1 1.2|37401|30|MNAC01000010|CRT,CRISPRCasFinder 37401-37430 30 MN694333 Marine virus AFVG_250M426, complete genome 13446-13475 9 0.7
MNAC01000010_1 1.10|37929|30|MNAC01000010|CRT,CRISPRCasFinder 37929-37958 30 NZ_CP053900 Proteus mirabilis strain YPM35 plasmid pJPM35-2, complete sequence 28471-28500 9 0.7
MNAC01000010_1 1.11|37995|30|MNAC01000010|CRT,CRISPRCasFinder 37995-38024 30 MN694543 Marine virus AFVG_250M1151, complete genome 13453-13482 9 0.7
MNAC01000010_1 1.11|37995|30|MNAC01000010|CRT,CRISPRCasFinder 37995-38024 30 MN694407 Marine virus AFVG_250M1153, complete genome 13721-13750 9 0.7
MNAC01000010_1 1.11|37995|30|MNAC01000010|CRT,CRISPRCasFinder 37995-38024 30 MN694457 Marine virus AFVG_250M832, complete genome 25679-25708 9 0.7
MNAC01000010_1 1.11|37995|30|MNAC01000010|CRT,CRISPRCasFinder 37995-38024 30 MN694516 Marine virus AFVG_250M1152, complete genome 13441-13470 9 0.7
MNAC01000010_1 1.11|37995|30|MNAC01000010|CRT,CRISPRCasFinder 37995-38024 30 MN693808 Marine virus AFVG_250M831, complete genome 25669-25698 9 0.7
MNAC01000010_1 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder 38259-38288 30 MW149095 Microvirus sp. isolate gila33, complete genome 1711-1740 9 0.7
MNAC01000010_1 1.25|38920|31|MNAC01000010|CRT,CRISPRCasFinder 38920-38950 31 NC_025153 Arcobacter butzleri strain AC1119 plasmid AB-1119-LD, complete sequence 23885-23915 9 0.71
MNAC01000010_1 1.27|39053|30|MNAC01000010|CRT,CRISPRCasFinder 39053-39082 30 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 132992-133021 9 0.7
MNAC01000010_1 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder 39185-39214 30 NC_031944 Synechococcus phage S-WAM1 isolate 0810PA09, complete genome 75263-75292 9 0.7
MNAC01000010_1 1.30|39251|30|MNAC01000010|CRT,CRISPRCasFinder 39251-39280 30 KF114877 Leptospira phage LnoZ_CZ214, complete genome 28563-28592 9 0.7
MNAC01000010_1 1.31|39317|30|MNAC01000010|CRT,CRISPRCasFinder 39317-39346 30 MN693684 Marine virus AFVG_250M122, complete genome 28680-28709 9 0.7
MNAC01000010_1 1.31|39317|30|MNAC01000010|CRT,CRISPRCasFinder 39317-39346 30 NZ_CP032413 Paenibacillus lautus strain E7593-69 plasmid pAZOPL1, complete sequence 193255-193284 9 0.7
MNAC01000010_1 1.31|39317|30|MNAC01000010|CRT,CRISPRCasFinder 39317-39346 30 NZ_CP020864 Paenibacillus sp. Cedars plasmid unnamed1, complete sequence 16565-16594 9 0.7
MNAC01000010_1 1.31|39317|30|MNAC01000010|CRT,CRISPRCasFinder 39317-39346 30 MN694540 Marine virus AFVG_250M802, complete genome 27990-28019 9 0.7
MNAC01000010_1 1.39|39845|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR 39845-39874 30 MK415409 Phage YS1-2_2434, complete genome 17841-17870 9 0.7
MNAC01000010_1 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder 38259-38288 30 MN032614 Aeromonas phage PS1, complete genome 176737-176766 10 0.667
MNAC01000010_1 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder 38259-38288 30 MK813940 Aeromonas phage 4_L372X, complete genome 17860-17889 10 0.667
MNAC01000010_1 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder 38656-38685 30 NZ_CP046706 Nostoc sp. ATCC 53789 plasmid pNsp_c, complete sequence 6327-6356 10 0.667

1. spacer 1.14|38193|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448924 (Streptococcus phage Javan384, complete genome) position: , mismatch: 0, identity: 1.0

tactatacgcgcatcagtcccagaacaccg	CRISPR spacer
tactatacgcgcatcagtcccagaacaccg	Protospacer
******************************

2. spacer 1.14|38193|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448746 (Streptococcus phage Javan383, complete genome) position: , mismatch: 0, identity: 1.0

tactatacgcgcatcagtcccagaacaccg	CRISPR spacer
tactatacgcgcatcagtcccagaacaccg	Protospacer
******************************

3. spacer 1.14|38193|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448753 (Streptococcus phage Javan407, complete genome) position: , mismatch: 0, identity: 1.0

tactatacgcgcatcagtcccagaacaccg	CRISPR spacer
tactatacgcgcatcagtcccagaacaccg	Protospacer
******************************

4. spacer 1.35|39581|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448924 (Streptococcus phage Javan384, complete genome) position: , mismatch: 0, identity: 1.0

tataagctcgtttacaaacctgatgaactt	CRISPR spacer
tataagctcgtttacaaacctgatgaactt	Protospacer
******************************

5. spacer 1.39|39845|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to MK448750 (Streptococcus phage Javan393, complete genome) position: , mismatch: 0, identity: 1.0

gcttcgtagtcaagcatttcagataacatt	CRISPR spacer
gcttcgtagtcaagcatttcagataacatt	Protospacer
******************************

6. spacer 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448685 (Streptococcus phage Javan155, complete genome) position: , mismatch: 1, identity: 0.967

cttgttaatatcttcaatctcaaacgggga	CRISPR spacer
cttgttaatgtcttcaatctcaaacgggga	Protospacer
*********.********************

7. spacer 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448849 (Streptococcus phage Javan128, complete genome) position: , mismatch: 1, identity: 0.967

cttgttaatatcttcaatctcaaacgggga	CRISPR spacer
cttgttaatgtcttcaatctcaaacgggga	Protospacer
*********.********************

8. spacer 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448958 (Streptococcus phage Javan486, complete genome) position: , mismatch: 1, identity: 0.967

cttgttaatatcttcaatctcaaacgggga	CRISPR spacer
cttgttaatatcctcaatctcaaacgggga	Protospacer
************.*****************

9. spacer 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448853 (Streptococcus phage Javan144, complete genome) position: , mismatch: 1, identity: 0.967

cttgttaatatcttcaatctcaaacgggga	CRISPR spacer
cttgttaatgtcttcaatctcaaacgggga	Protospacer
*********.********************

10. spacer 1.26|38987|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 1, identity: 0.967

tgaaggaacacttctatttcattccgacca	CRISPR spacer
tgaaggaacacttctctttcattccgacca	Protospacer
*************** **************

11. spacer 1.26|38987|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 1, identity: 0.967

tgaaggaacacttctatttcattccgacca	CRISPR spacer
tgaaggaacacttctctttcattccgacca	Protospacer
*************** **************

12. spacer 1.26|38987|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 1, identity: 0.967

tgaaggaacacttctatttcattccgacca	CRISPR spacer
tgaaggaacacttctctttcattccgacca	Protospacer
*************** **************

13. spacer 1.26|38987|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448526 (Streptococcus satellite phage Javan54, complete genome) position: , mismatch: 1, identity: 0.967

tgaaggaacacttctatttcattccgacca	CRISPR spacer
tgaaggaacacttctctttcattccgacca	Protospacer
*************** **************

14. spacer 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448748 (Streptococcus phage Javan389, complete genome) position: , mismatch: 1, identity: 0.967

ttgattagttaatttcccaaaagtcatatt	CRISPR spacer
ttgattagttaattttccaaaagtcatatt	Protospacer
***************.**************

15. spacer 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448751 (Streptococcus phage Javan399, complete genome) position: , mismatch: 1, identity: 0.967

ttgattagttaatttcccaaaagtcatatt	CRISPR spacer
ttgattagttaattttccaaaagtcatatt	Protospacer
***************.**************

16. spacer 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448754 (Streptococcus phage Javan411, complete genome) position: , mismatch: 1, identity: 0.967

ttgattagttaatttcccaaaagtcatatt	CRISPR spacer
ttgattagttaattttccaaaagtcatatt	Protospacer
***************.**************

17. spacer 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448929 (Streptococcus phage Javan400, complete genome) position: , mismatch: 1, identity: 0.967

ttgattagttaatttcccaaaagtcatatt	CRISPR spacer
ttgattagttaattttccaaaagtcatatt	Protospacer
***************.**************

18. spacer 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448926 (Streptococcus phage Javan392, complete genome) position: , mismatch: 1, identity: 0.967

ttgattagttaatttcccaaaagtcatatt	CRISPR spacer
ttgattagttaattttccaaaagtcatatt	Protospacer
***************.**************

19. spacer 1.31|39317|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448753 (Streptococcus phage Javan407, complete genome) position: , mismatch: 1, identity: 0.967

aacattagtgcatgaaatacttcatggttg	CRISPR spacer
aacattagtgcatgaaatactccatggttg	Protospacer
*********************.********

20. spacer 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448753 (Streptococcus phage Javan407, complete genome) position: , mismatch: 1, identity: 0.967

attacatcatcttttatagctaagtcatta	CRISPR spacer
attgcatcatcttttatagctaagtcatta	Protospacer
***.**************************

21. spacer 1.35|39581|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448750 (Streptococcus phage Javan393, complete genome) position: , mismatch: 1, identity: 0.967

tataagctcgtttacaaacctgatgaactt	CRISPR spacer
tataagctcgtttacaaacttgatgaactt	Protospacer
*******************.**********

22. spacer 1.35|39581|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448753 (Streptococcus phage Javan407, complete genome) position: , mismatch: 1, identity: 0.967

tataagctcgtttacaaacctgatgaactt	CRISPR spacer
tataagctcgtttacaaacctgatgaattt	Protospacer
***************************.**

23. spacer 1.41|39977|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to MK448926 (Streptococcus phage Javan392, complete genome) position: , mismatch: 1, identity: 0.967

aagttgttagttccatgttgttttctcctt	CRISPR spacer
aagttgttagttccatgtttttttctcctt	Protospacer
******************* **********

24. spacer 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK449010 (Streptococcus phage Javan90, complete genome) position: , mismatch: 2, identity: 0.933

cttgttaatatcttcaatctcaaacgggga	CRISPR spacer
cttgttaatatcttcaatctcaaatggtga	Protospacer
************************.** **

25. spacer 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448833 (Streptococcus phage Javan87, complete genome) position: , mismatch: 2, identity: 0.933

cttgttaatatcttcaatctcaaacgggga	CRISPR spacer
cttgttaatatcttcaatctcaaatggtga	Protospacer
************************.** **

26. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_KY579372 (Enterococcus faecium strain F120805 substr. faecium plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.935

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaagaacacttttgtaaagctattcccaata	Protospacer
****** ***********************.

27. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NC_014475 (Enterococcus faecalis plasmid pWZ1668, complete sequence) position: , mismatch: 2, identity: 0.935

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaagaacacttttgtaaagctattcccaata	Protospacer
****** ***********************.

28. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP030934 (Enterococcus gilvus strain CR1 plasmid pCR1B, complete sequence) position: , mismatch: 2, identity: 0.935

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaagaacacttttgtaaagctattcccaata	Protospacer
****** ***********************.

29. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_MF580438 (Enterococcus faecium strain E35048 plasmid pE35048-oc, complete sequence) position: , mismatch: 2, identity: 0.935

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaagaacacttttgtaaagctattcccaata	Protospacer
****** ***********************.

30. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP038866 (Vagococcus sp. CF-49 plasmid punnamed1, complete sequence) position: , mismatch: 2, identity: 0.935

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaagaatacttttgtaaagctattcccaata	Protospacer
****** ***********************.

31. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_AP018541 (Enterococcus faecalis strain KUB3006 plasmid pKUB3006-3, complete sequence) position: , mismatch: 2, identity: 0.935

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaagaacacttttgtaaagctattcccaata	Protospacer
****** ***********************.

32. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NC_019284 (Enterococcus faecalis plasmid pWZ7140, complete sequence) position: , mismatch: 2, identity: 0.935

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaagaacacttttgtaaagctattcccaata	Protospacer
****** ***********************.

33. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NC_019213 (Enterococcus faecalis plasmid pWZ909, complete sequence) position: , mismatch: 2, identity: 0.935

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaagaacacttttgtaaagctattcccaata	Protospacer
****** ***********************.

34. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NC_013514 (Enterococcus faecalis plasmid pAMbeta1, complete sequence) position: , mismatch: 2, identity: 0.935

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaagaatacttttgtaaagctattcccaata	Protospacer
****** ***********************.

35. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP033741 (Enterococcus sp. FDAARGOS_553 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.935

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaagaacacttttgtaaagctattcccaata	Protospacer
****** ***********************.

36. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_LN774770 (Lactococcus piscium MKFS47 plasmid II, complete sequence) position: , mismatch: 2, identity: 0.935

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaagaaaacttttgtaaagctattaccaatg	Protospacer
******.***************** ******

37. spacer 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448724 (Streptococcus phage Javan273, complete genome) position: , mismatch: 2, identity: 0.933

ttgaacaaattgcttatgataaagacatca	CRISPR spacer
ttgaacagattgcttataataaagacatca	Protospacer
*******.*********.************

38. spacer 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448723 (Streptococcus phage Javan271, complete genome) position: , mismatch: 2, identity: 0.933

ttgattagttaatttcccaaaagtcatatt	CRISPR spacer
ttgtttagttaattttccaaaagtcatatt	Protospacer
*** ***********.**************

39. spacer 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448747 (Streptococcus phage Javan385, complete genome) position: , mismatch: 2, identity: 0.933

ttgattagttaatttcccaaaagtcatatt	CRISPR spacer
ttgtttagttaattttccaaaagtcatatt	Protospacer
*** ***********.**************

40. spacer 1.31|39317|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448924 (Streptococcus phage Javan384, complete genome) position: , mismatch: 2, identity: 0.933

aacattagtgcatgaaatacttcatggttg	CRISPR spacer
aacactagtgcatgaaatactccatggttg	Protospacer
****.****************.********

41. spacer 1.36|39647|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to KX160209 (Lactococcus phage 58502, complete genome) position: , mismatch: 2, identity: 0.933

ttgcgaagttgattaatgaagcttctatga	CRISPR spacer
ttgcgaagttgaccaatgaagcttctatga	Protospacer
************..****************

42. spacer 1.36|39647|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to MN552144 (Lactococcus phage P1045, complete genome) position: , mismatch: 2, identity: 0.933

ttgcgaagttgattaatgaagcttctatga	CRISPR spacer
ttgcgaagttgaccaatgaagcttctatga	Protospacer
************..****************

43. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NC_008445 (Enterococcus faecalis RE25 plasmid pRE25, complete sequence) position: , mismatch: 3, identity: 0.903

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
gaagaatacttttgtaaagctattcccaata	Protospacer
.***** ***********************.

44. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP032740 (Enterococcus casseliflavus strain EC-369 plasmid pEC369, complete sequence) position: , mismatch: 3, identity: 0.903

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaagaatacttttgtaaagctgttcccaata	Protospacer
****** **************.********.

45. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to MH830362 (Enterococcus faecalis plasmid p4, complete sequence) position: , mismatch: 3, identity: 0.903

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaaaaacacttttgtaaagctattcccaata	Protospacer
***.** ***********************.

46. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to MH830362 (Enterococcus faecalis plasmid p4, complete sequence) position: , mismatch: 3, identity: 0.903

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaaaaacacttttgtaaagctattcccaata	Protospacer
***.** ***********************.

47. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP049777 (Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.903

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
aaaaaacacttttgtaaagctattcccaata	Protospacer
***.** ***********************.

48. spacer 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder matches to NC_009018 (Streptococcus phage phi3396, complete genome) position: , mismatch: 3, identity: 0.9

ttgaacaaattgcttatgataaagacatca	CRISPR spacer
tcgaacaaatcgcttatgacaaagacatca	Protospacer
*.********.********.**********

49. spacer 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448859 (Streptococcus phage Javan170, complete genome) position: , mismatch: 3, identity: 0.9

ttgaacaaattgcttatgataaagacatca	CRISPR spacer
tcgaacaaatcgcttatgacaaagacatca	Protospacer
*.********.********.**********

50. spacer 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448854 (Streptococcus phage Javan146, complete genome) position: , mismatch: 3, identity: 0.9

ttgaacaaattgcttatgataaagacatca	CRISPR spacer
tcgaacaaatcgcttatgacaaagacatca	Protospacer
*.********.********.**********

51. spacer 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448680 (Streptococcus phage Javan139, complete genome) position: , mismatch: 3, identity: 0.9

ttgaacaaattgcttatgataaagacatca	CRISPR spacer
tcgaacaaatcgcttatgacaaagacatca	Protospacer
*.********.********.**********

52. spacer 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448856 (Streptococcus phage Javan158, complete genome) position: , mismatch: 3, identity: 0.9

ttgaacaaattgcttatgataaagacatca	CRISPR spacer
ttgagcagattgcttatgataaagacatta	Protospacer
****.**.********************.*

53. spacer 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448688 (Streptococcus phage Javan161, complete genome) position: , mismatch: 3, identity: 0.9

ttgaacaaattgcttatgataaagacatca	CRISPR spacer
tcgaacaaatcgcttatgacaaagacatca	Protospacer
*.********.********.**********

54. spacer 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 3, identity: 0.9

ttgaacaaattgcttatgataaagacatca	CRISPR spacer
tcgaacaaatcgcttatgacaaagacatca	Protospacer
*.********.********.**********

55. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to KC465899 (Pelagibacter phage HTVC008M, complete genome) position: , mismatch: 5, identity: 0.833

taaatctcatcatttcttttacttttttaa	CRISPR spacer
gaaatctcatcattgcttttgctttttgta	Protospacer
 ************* *****.******  *

56. spacer 1.41|39977|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to MK448747 (Streptococcus phage Javan385, complete genome) position: , mismatch: 5, identity: 0.833

aagttgttagttccatgttgttttctcctt	CRISPR spacer
aagttgttaattccatgttgtttccttttc	Protospacer
*********.*************.**..*.

57. spacer 1.1|37336|29|MNAC01000010|CRT matches to MN871463 (UNVERIFIED: Pseudomonas phage Pa-L, complete genome) position: , mismatch: 6, identity: 0.793

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
tcctgttcatcagcaataacctggacacc	Protospacer
*.**.****************** * *  

58. spacer 1.1|37336|29|MNAC01000010|CRT matches to MN871469 (UNVERIFIED: Pseudomonas phage Pa-S, complete genome) position: , mismatch: 6, identity: 0.793

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
tcctgttcatcagcaataacctggacacc	Protospacer
*.**.****************** * *  

59. spacer 1.6|37665|30|MNAC01000010|CRT,CRISPRCasFinder matches to NC_011798 (Lactobacillus farciminis KCTC 3681 plasmid pLF24, complete sequence) position: , mismatch: 6, identity: 0.8

caggtagtggtgttaaaagtgctactaagg	CRISPR spacer
gagttttaggtgttaaaagtgttactaagg	Protospacer
 ** *   *************.********

60. spacer 1.7|37731|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP042835 (Enterococcus faecium strain FA3 plasmid unnamed2) position: , mismatch: 6, identity: 0.8

aggcgtaattacgctctcccattttttggt	CRISPR spacer
aagaaaaattacgctctcctattttttagt	Protospacer
*.* . *************.*******.**

61. spacer 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder matches to MN693684 (Marine virus AFVG_250M122, complete genome) position: , mismatch: 6, identity: 0.8

--ggcttacttgttgtaggttcttctgtaaca	CRISPR spacer
ctggc--acttgttgtaggtgcttctgcaatt	Protospacer
  ***  ************* ******.**. 

62. spacer 1.12|38061|30|MNAC01000010|CRT,CRISPRCasFinder matches to MH598801 (Pelagibacter phage HTVC200P, complete genome) position: , mismatch: 6, identity: 0.8

aaaacaaagacaggaaattat--acttatcaa	CRISPR spacer
aaaacgaagacaggaaattatgaaagtacc--	Protospacer
*****.***************  *  **.*  

63. spacer 1.13|38127|30|MNAC01000010|CRT,CRISPRCasFinder matches to MH576968 (Streptomyces phage Wofford, complete genome) position: , mismatch: 6, identity: 0.8

aaattaagacgtattgcttcaaattcctta	CRISPR spacer
agaatgaaacgcattgcttcaaattccttt	Protospacer
*.* *.*.***.***************** 

64. spacer 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP036456 (Streptomonospora sp. M2 plasmid phiM2, complete sequence) position: , mismatch: 6, identity: 0.8

ttgaaca-aattgcttatgataaagacatca	CRISPR spacer
-aaatcataattgattatgataaagatatca	Protospacer
  .* ** ***** ************.****

65. spacer 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP031220 (Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence) position: , mismatch: 6, identity: 0.8

ttgaacaaattgcttatgataaagacatca	CRISPR spacer
tagaacactttgcttatgataaagaaaata	Protospacer
* *****  **************** * .*

66. spacer 1.27|39053|30|MNAC01000010|CRT,CRISPRCasFinder matches to HF937074 (Staphylococcus phage PSa3 complete sequence) position: , mismatch: 6, identity: 0.8

gttgatgtcagcattaatgtgattgattat-	CRISPR spacer
gttgatgtcatcagtaatgtga-tagtcata	Protospacer
********** ** ******** *..*.** 

67. spacer 1.28|39119|30|MNAC01000010|CRT,CRISPRCasFinder matches to NC_014749 (Calditerrivibrio nitroreducens DSM 19672 plasmid pCALNI01, complete sequence) position: , mismatch: 6, identity: 0.8

ttgattagttaatttcccaaaagtcatatt	CRISPR spacer
ttgatttgttcatttcccaaaagccctgct	Protospacer
****** *** ************.* *..*

68. spacer 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder matches to AP013499 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S39-C84) position: , mismatch: 6, identity: 0.8

gctcaaaagcaacatcagtacactcaaaaa	CRISPR spacer
tataaaaagcaacatcagtacagtcaacga	Protospacer
  * ****************** **** .*

69. spacer 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder matches to AP013497 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S35-C79) position: , mismatch: 6, identity: 0.8

gctcaaaagcaacatcagtacactcaaaaa	CRISPR spacer
tataaaaagcaacatcagtacagtcaacga	Protospacer
  * ****************** **** .*

70. spacer 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder matches to AP013498 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S38-C76) position: , mismatch: 6, identity: 0.8

gctcaaaagcaacatcagtacactcaaaaa	CRISPR spacer
tataaaaagcaacatcagtacagtcaacga	Protospacer
  * ****************** **** .*

71. spacer 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder matches to AP013776 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C68A-MedDCM-OCT-S36-C73, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

gctcaaaagcaacatcagtacactcaaaaa	CRISPR spacer
tataaaaagcaacatcagtacagtcaacga	Protospacer
  * ****************** **** .*

72. spacer 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder matches to AP013496 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S28-C61) position: , mismatch: 6, identity: 0.8

gctcaaaagcaacatcagtacactcaaaaa	CRISPR spacer
tataaaaagcaacatcagtacagtcaacga	Protospacer
  * ****************** **** .*

73. spacer 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder matches to AP013775 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C68A-MedDCM-OCT-S26-C73, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

gctcaaaagcaacatcagtacactcaaaaa	CRISPR spacer
tataaaaagcaacatcagtacagtcaacga	Protospacer
  * ****************** **** .*

74. spacer 1.35|39581|30|MNAC01000010|CRT,CRISPRCasFinder matches to MH673673 (Thermus phage phiLo, complete genome) position: , mismatch: 6, identity: 0.8

tataagctcgtttacaaacctgatgaactt	CRISPR spacer
tggcaactcgtttagaaccctgatgaactt	Protospacer
*.  *.******** ** ************

75. spacer 1.37|39713|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to AP014307 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S29-C31, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

ttgcccatctcaagaatattaatatcaata	CRISPR spacer
tctcccttctcaagaatatcaatatcatca	Protospacer
*. *** ************.******* .*

76. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP047444 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-7) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
gcatattcattagcaataacctttaaatt	Protospacer
 . *******.*********** ****  

77. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP047444 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-7) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
gcatattcattagcaataacctttaaatt	Protospacer
 . *******.*********** ****  

78. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP039213 (Piscirickettsia salmonis strain Psal-103 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
atacgatcatcagcaatcacctgtaaacg	Protospacer
 * .. *********** ********* *

79. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP048070 (Piscirickettsia salmonis strain Ps-8079A plasmid Ps8079A-p4, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
atacgatcatcagcaatcacctgtaaacg	Protospacer
 * .. *********** ********* *

80. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP038897 (Piscirickettsia salmonis strain Psal-006a plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
atacgatcatcagcaatcacctgtaaacg	Protospacer
 * .. *********** ********* *

81. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP039200 (Piscirickettsia salmonis strain Psal-161 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
atacgatcatcagcaatcacctgtaaacg	Protospacer
 * .. *********** ********* *

82. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP013771 (Piscirickettsia salmonis strain PM23019A plasmid p3PS3, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
atacgatcatcagcaatcacctgtaaacg	Protospacer
 * .. *********** ********* *

83. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP013767 (Piscirickettsia salmonis strain PM21567A plasmid p5PS2, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
atacgatcatcagcaatcacctgtaaacg	Protospacer
 * .. *********** ********* *

84. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP013775 (Piscirickettsia salmonis strain PM37984A plasmid p2PS4, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
atacgatcatcagcaatcacctgtaaacg	Protospacer
 * .. *********** ********* *

85. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP013780 (Piscirickettsia salmonis strain PM51819A plasmid p2PS5, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
atacgatcatcagcaatcacctgtaaacg	Protospacer
 * .. *********** ********* *

86. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP050943 (Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p5, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
atacgatcatcagcaatcacctgtaaacg	Protospacer
 * .. *********** ********* *

87. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP050946 (Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p8, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
ctacgatcatcagcaatcacctgtaaacg	Protospacer
.* .. *********** ********* *

88. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP050946 (Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p8, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
atacgatcatcagcaatcacctgtaaacg	Protospacer
 * .. *********** ********* *

89. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP050947 (Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p9, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
atacgatcatcagcaatcacctgtaaacg	Protospacer
 * .. *********** ********* *

90. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP039206 (Piscirickettsia salmonis strain Psal-182 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
atacgatcatcagcaatcacctgtaaacg	Protospacer
 * .. *********** ********* *

91. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP012417 (Piscirickettsia salmonis strain PM15972A1 plasmid pPSA1-4, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
atacgatcatcagcaatcacctgtaaacg	Protospacer
 * .. *********** ********* *

92. spacer 1.1|37336|29|MNAC01000010|CRT matches to NZ_CP038912 (Piscirickettsia salmonis strain Psal-009 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.759

ttctattcatcagcaataacctgtaaaag	CRISPR spacer
atacgatcatcagcaatcacctgtaaacg	Protospacer
 * .. *********** ********* *

93. spacer 1.2|37401|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP011513 (Paenibacillus peoriae strain HS311 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

tgaaatagcatcttcaaaccctttttgtaa	CRISPR spacer
ataaccagcatcttcaaaccatttttttac	Protospacer
  ** .************** ***** ** 

94. spacer 1.2|37401|30|MNAC01000010|CRT,CRISPRCasFinder matches to CAJDJZ010000002 (Enterococcus phage vB_EfaH_149 genome assembly, contig: phage149-genome, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.767

-----tgaaatagcatcttcaaaccctttttgtaa	CRISPR spacer
gttctttaa-----atcttcataccctttttgtaa	Protospacer
     * **     ******* *************

95. spacer 1.2|37401|30|MNAC01000010|CRT,CRISPRCasFinder matches to CAJDJY010000002 (Enterococcus phage 156 genome assembly, contig: phage156-genome, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.767

-----tgaaatagcatcttcaaaccctttttgtaa	CRISPR spacer
gttctttaa-----atcttcataccctttttgtaa	Protospacer
     * **     ******* *************

96. spacer 1.2|37401|30|MNAC01000010|CRT,CRISPRCasFinder matches to LR031359 (Enterococcus phage 156, complete genome) position: , mismatch: 7, identity: 0.767

-----tgaaatagcatcttcaaaccctttttgtaa	CRISPR spacer
gttctttaa-----atcttcataccctttttgtaa	Protospacer
     * **     ******* *************

97. spacer 1.7|37731|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

aggcgtaattacgctctcccattttttggt	CRISPR spacer
accggtaattacgctgtcccattttgagat	Protospacer
*   *********** *********  *.*

98. spacer 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder matches to KM236247 (Bacillus phage Pascal, complete genome) position: , mismatch: 7, identity: 0.767

ggcttacttgttgtaggttcttctgtaaca	CRISPR spacer
gcaccacttgttttaggttcttctggaata	Protospacer
*  ..******* ************ **.*

99. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP044103 (Streptococcus dysgalactiae strain FDAARGOS_654 plasmid unnamed1) position: , mismatch: 7, identity: 0.774

aaagaagacttttgtaaagctattc-ccaatg	CRISPR spacer
gcagaagatttttgtaaacctattcagtaat-	Protospacer
. ******.********* ******  .*** 

100. spacer 1.20|38590|30|MNAC01000010|CRT,CRISPRCasFinder matches to NC_021808 (Vibrio harveyi strain ORM4 plasmid pVCR1, complete sequence) position: , mismatch: 7, identity: 0.767

cggtaacacggtaacttttgattttttaga	CRISPR spacer
gttaaagacggtaacttttgatttttaaca	Protospacer
    ** ******************* * *

101. spacer 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder matches to AP018319 (Nostoc sp. HK-01 plasmid plasmid1 DNA, complete genome) position: , mismatch: 7, identity: 0.767

ttgaacaaattgcttatgataaagacatca	CRISPR spacer
ttgaacaaaatgcttatgagaaattaggca	Protospacer
********* ********* ***   . **

102. spacer 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP020750 (Bacillus mycoides strain Gnyt1 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.767

gctcaaaagcaacatcagtacactcaaaaa	CRISPR spacer
cagcaaaagcaacaacagtacaatcaaatg	Protospacer
   *********** ******* ***** .

103. spacer 1.32|39383|30|MNAC01000010|CRT,CRISPRCasFinder matches to MH319754 (Marine virus AG-345-L05 Ga0172272_11 genomic sequence) position: , mismatch: 7, identity: 0.767

----cagcgcctttcaaagtctttgtaaaccctg	CRISPR spacer
atataagca----tcaaagtctttgtaaacactg	Protospacer
     ***.    ***************** ***

104. spacer 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder matches to NC_031006 (Bacillus phage DIGNKC, complete genome) position: , mismatch: 7, identity: 0.767

attacatcatcttttatagctaagtcatta	CRISPR spacer
gctaactcatcttttgtagctaagtcagtc	Protospacer
..**  *********.*********** * 

105. spacer 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder matches to MT584805 (Bacillus phage Tomato, complete genome) position: , mismatch: 7, identity: 0.767

attacatcatcttttatagctaagtcatta	CRISPR spacer
gctaactcatcttttgtagctaagtcagtc	Protospacer
..**  *********.*********** * 

106. spacer 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder matches to MF288919 (Bacillus phage AaronPhadgers, complete genome) position: , mismatch: 7, identity: 0.767

attacatcatcttttatagctaagtcatta	CRISPR spacer
gctaactcatcttttgtagctaagtcagtc	Protospacer
..**  *********.*********** * 

107. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016726 (Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08A, complete sequence) position: , mismatch: 7, identity: 0.767

taaatctcatcatttcttttacttttttaa	CRISPR spacer
tttttctcatcattttttttacttttaaac	Protospacer
*   ***********.**********  * 

108. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to MK250021 (Prevotella phage Lak-B2, complete genome) position: , mismatch: 7, identity: 0.767

taaatctcatcatttcttttacttttttaa	CRISPR spacer
taattctcataatttcttttacttgctctt	Protospacer
*** ****** ************* .*.  

109. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to KF669662 (Bacillus phage Spock, complete genome) position: , mismatch: 7, identity: 0.767

taaatctcatcatttcttttacttttttaa	CRISPR spacer
gagcttccatcatctcttttacttttttat	Protospacer
 *. *..******.*************** 

110. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 7, identity: 0.767

taaatctcatcatttcttttacttttttaa	CRISPR spacer
taattctcataatttcttttacttgctctt	Protospacer
*** ****** ************* .*.  

111. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 7, identity: 0.767

taaatctcatcatttcttttacttttttaa	CRISPR spacer
taattctcataatttcttttacttgctctt	Protospacer
*** ****** ************* .*.  

112. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 7, identity: 0.767

taaatctcatcatttcttttacttttttaa	CRISPR spacer
taattctcataatttcttttacttgctctt	Protospacer
*** ****** ************* .*.  

113. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to KY888882 (Bacillus phage Flapjack, complete genome) position: , mismatch: 7, identity: 0.767

taaatctcatcatttcttttacttttttaa	CRISPR spacer
gagcttccatcatctcttttacttttttat	Protospacer
 *. *..******.*************** 

114. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to MN783745 (Escherichia coli plasmid pFII-FIB, complete sequence) position: , mismatch: 7, identity: 0.767

taaatctcatcatttcttttacttttttaa	CRISPR spacer
taaatgtcatcatttctttttctagctttt	Protospacer
***** ************** **  .**  

115. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KP342511 (Enterococcus faecium isolate N12-493 plasmid pEfm12493, complete sequence) position: , mismatch: 7, identity: 0.767

taaatctcatcatttcttttacttttttaa	CRISPR spacer
tccttctcttcattgcttttactttttcta	Protospacer
*   **** ***** ************. *

116. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP051739 (Escherichia coli strain SCU-105 plasmid pSCU-105-1, complete sequence) position: , mismatch: 7, identity: 0.767

taaatctcatcatttcttttacttttttaa	CRISPR spacer
taaatgtcatcatttctttttctagctttt	Protospacer
***** ************** **  .**  

117. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to AJ972879 (Yersinia phage phiR1-37 complete genome) position: , mismatch: 7, identity: 0.767

taaatctcatcatttcttttacttttttaa	CRISPR spacer
tttttctcatcattgcttttactttagtag	Protospacer
*   ********** **********  **.

118. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NC_016163 (Yersinia phage phiR1-37, complete genome) position: , mismatch: 7, identity: 0.767

taaatctcatcatttcttttacttttttaa	CRISPR spacer
tttttctcatcattgcttttactttagtag	Protospacer
*   ********** **********  **.

119. spacer 1.41|39977|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to MK448754 (Streptococcus phage Javan411, complete genome) position: , mismatch: 7, identity: 0.767

aagttgttagttccatgttgttttctcctt	CRISPR spacer
cgattgttagttccatgttgtttcctttct	Protospacer
 ..********************.**...*

120. spacer 1.41|39977|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to MK448929 (Streptococcus phage Javan400, complete genome) position: , mismatch: 7, identity: 0.767

aagttgttagttccatgttgttttctcctt	CRISPR spacer
cgattgttagttccatgttgtttcctttct	Protospacer
 ..********************.**...*

121. spacer 1.41|39977|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to CAJDJX010000002 (Enterococcus phage Q69 genome assembly, contig: phageQ69-genome, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.767

aagttgttagttccatgttgttttctcctt	CRISPR spacer
aaccaaatagtgccatgttgtttcctcctt	Protospacer
** . . **** ***********.******

122. spacer 1.41|39977|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to MK721187 (Enterococcus phage vB_EfaS_Ef6.1, complete genome) position: , mismatch: 7, identity: 0.767

aagttgttagttccatgttgttttctcctt	CRISPR spacer
gtcttaatagttccattttgtttcctcctt	Protospacer
.  **. ********* ******.******

123. spacer 1.7|37731|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK249871 (Vibrio phage LP.2, complete genome) position: , mismatch: 8, identity: 0.733

aggcgtaattacgctctcccattttttggt	CRISPR spacer
ttttcttgttacgctctgccattttttggt	Protospacer
   . * .********* ************

124. spacer 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 8, identity: 0.733

ggcttacttgttgtaggttcttctgtaaca	CRISPR spacer
ttaatacttggtgtaagttcttctgtatta	Protospacer
    ****** ****.*********** .*

125. spacer 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder matches to MT001829 (Salmonella phage SE_PL, complete genome) position: , mismatch: 8, identity: 0.733

ggcttacttgttgtaggttcttctgtaaca	CRISPR spacer
actgttattgttgtaggttcttctgataca	Protospacer
. . *  ******************  ***

126. spacer 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK773491 (Salmonella phage 7t3, complete genome) position: , mismatch: 8, identity: 0.733

ggcttacttgttgtaggttcttctgtaaca	CRISPR spacer
actgttattgttgtaggttcttctgataca	Protospacer
. . *  ******************  ***

127. spacer 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder matches to NC_022770 (Bacillus phage Pony, complete genome) position: , mismatch: 8, identity: 0.733

ggcttacttgttgtaggttcttctgtaaca	CRISPR spacer
gcaccacttgttttaggttcttctggaatg	Protospacer
*  ..******* ************ **..

128. spacer 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder matches to KM236248 (Bacillus phage Pookie, complete genome) position: , mismatch: 8, identity: 0.733

ggcttacttgttgtaggttcttctgtaaca	CRISPR spacer
gcaccacttgttttaggttcttctggaatg	Protospacer
*  ..******* ************ **..

129. spacer 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK268344 (Salmonella phage Munch, complete genome) position: , mismatch: 8, identity: 0.733

ggcttacttgttgtaggttcttctgtaaca	CRISPR spacer
actgttattgttgtaggttcttctgataca	Protospacer
. . *  ******************  ***

130. spacer 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder matches to KF669655 (Bacillus phage Page, complete genome) position: , mismatch: 8, identity: 0.733

ggcttacttgttgtaggttcttctgtaaca	CRISPR spacer
gcaccacttgttttaggttcttctggaatg	Protospacer
*  ..******* ************ **..

131. spacer 1.8|37797|30|MNAC01000010|CRT,CRISPRCasFinder matches to KF669657 (Bacillus phage poppyseed, complete genome) position: , mismatch: 8, identity: 0.733

ggcttacttgttgtaggttcttctgtaaca	CRISPR spacer
gcaccacttgttttaggttcttctggaatg	Protospacer
*  ..******* ************ **..

132. spacer 1.10|37929|30|MNAC01000010|CRT,CRISPRCasFinder matches to KT151959 (Brevibacillus phage Sundance, complete genome) position: , mismatch: 8, identity: 0.733

agtttatcaagaagtaaagccaaataaatt	CRISPR spacer
ttactaataagtagtaaagccaaataaata	Protospacer
   .** .*** ***************** 

133. spacer 1.14|38193|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.733

tactatacgcgcatcagtcccagaacaccg	CRISPR spacer
agcagggcgcccatcaatcccagaacaccg	Protospacer
 .* . .*** *****.*************

134. spacer 1.14|38193|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

tactatacgcgcatcagtcccagaacaccg	CRISPR spacer
agcagggcgcccatcaatcccagaacaccg	Protospacer
 .* . .*** *****.*************

135. spacer 1.18|38457|31|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 8, identity: 0.742

aaagaagacttttgtaaagctattcccaatg	CRISPR spacer
ggcgcattcttttgtaaagctatttccattg	Protospacer
.. * *  ****************.*** **

136. spacer 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP022047 (Staphylococcus sciuri strain FDAARGOS_285 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttgaacaaattgcttatgataaagacatca	CRISPR spacer
ttgaacaaattccatatgataaacatgaag	Protospacer
*********** * ********* *..  .

137. spacer 1.24|38854|30|MNAC01000010|CRT,CRISPRCasFinder matches to MF459646 (Erwinia phage vB_EamM_RisingSun, complete genome) position: , mismatch: 8, identity: 0.733

agattaagtaactcaccattaaagcttgat	CRISPR spacer
tgattaagtcgctcaccattaaagtgttgg	Protospacer
 ******** .*************. * . 

138. spacer 1.25|38920|31|MNAC01000010|CRT,CRISPRCasFinder matches to MN694475 (Marine virus AFVG_250M72, complete genome) position: , mismatch: 8, identity: 0.742

agatactgttaatcaaattaaagagtcttcg	CRISPR spacer
tgcaactgttaatcaaattaatgagttatta	Protospacer
 *  ***************** ****. *..

139. spacer 1.25|38920|31|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP007649 (Lactobacillus salivarius strain JCM1046 plasmid pLMP1046, complete sequence) position: , mismatch: 8, identity: 0.742

agatactgttaatcaaattaaagagtcttcg	CRISPR spacer
tgataatgttaagcaaattaaagatattttt	Protospacer
 **** ****** ***********  .**. 

140. spacer 1.25|38920|31|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP014289 (Bacillus thuringiensis strain Bt185 plasmid pBT1850046, complete sequence) position: , mismatch: 8, identity: 0.742

agatactgttaatcaaattaaagagtcttcg	CRISPR spacer
tgatatttttaatcaaattaaagatcattta	Protospacer
 ****.* **************** . **..

141. spacer 1.25|38920|31|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP047429 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-1, complete sequence) position: , mismatch: 8, identity: 0.742

agatactgttaatcaaattaaagagtcttcg----	CRISPR spacer
agatacaattaatcaaattaaag----ttaacaaa	Protospacer
****** .***************    ** .    

142. spacer 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder matches to NC_010945 (Streptococcus phage PH15, complete genome) position: , mismatch: 8, identity: 0.733

gctcaaaagcaacatcagtacactcaaaaa	CRISPR spacer
attcaacagcaacatcagtacacgagtaag	Protospacer
..**** ****************  . **.

143. spacer 1.31|39317|30|MNAC01000010|CRT,CRISPRCasFinder matches to MT774388 (CrAssphage cr112_1, complete genome) position: , mismatch: 8, identity: 0.733

aacattagtgcatgaaatacttcatggttg	CRISPR spacer
tggaatactgcatgaaatgcttcatggtat	Protospacer
 . * ** **********.*********  

144. spacer 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder matches to AP013753 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C63A-MedDCM-OCT-S44-C48, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733

attacatcatcttttatagctaagtcatta	CRISPR spacer
tgcaaatcatctttcatagctaattcatgc	Protospacer
  .* *********.******** ****  

145. spacer 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder matches to NC_002703 (Lactococcus phage Tuc2009, complete genome) position: , mismatch: 8, identity: 0.733

attacatcatcttttatagctaagtcatta	CRISPR spacer
tcgccatcaacttttatagcaaagtcaaaa	Protospacer
 .  ***** ********** ******  *

146. spacer 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder matches to AP013471 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C63A-MedDCM-OCT-S41-C57) position: , mismatch: 8, identity: 0.733

attacatcatcttttatagctaagtcatta	CRISPR spacer
tgcaaatcatctttcatagctaattcatgc	Protospacer
  .* *********.******** ****  

147. spacer 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder matches to AF109874 (Bacteriophage Tuc2009, complete genome) position: , mismatch: 8, identity: 0.733

attacatcatcttttatagctaagtcatta	CRISPR spacer
tcgccatcaacttttatagcaaagtcaaaa	Protospacer
 .  ***** ********** ******  *

148. spacer 1.33|39449|30|MNAC01000010|CRT,CRISPRCasFinder matches to AP013752 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C63A-MedDCM-OCT-S30-C46, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733

attacatcatcttttatagctaagtcatta	CRISPR spacer
tgcaaatcatctttcatagctaattcatgc	Protospacer
  .* *********.******** ****  

149. spacer 1.37|39713|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NC_017296 (Clostridium acetobutylicum EA 2018 plasmid pEA2018, complete sequence) position: , mismatch: 8, identity: 0.733

ttgcccatctcaagaatattaatatcaata	CRISPR spacer
tatttcatctcaagaatactaatattaaat	Protospacer
*  ..*************.******.**  

150. spacer 1.37|39713|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NC_015686 (Clostridium acetobutylicum DSM 1731 plasmid pSMBa, complete sequence) position: , mismatch: 8, identity: 0.733

ttgcccatctcaagaatattaatatcaata	CRISPR spacer
tatttcatctcaagaatactaatattaaat	Protospacer
*  ..*************.******.**  

151. spacer 1.37|39713|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttgcccatctcaagaatattaatatcaata	CRISPR spacer
acaccggtctcaagaattttaatatcaacc	Protospacer
 ..** .********** **********. 

152. spacer 1.37|39713|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NC_001988 (Clostridium acetobutylicum ATCC 824 plasmid pSOL1, complete sequence) position: , mismatch: 8, identity: 0.733

ttgcccatctcaagaatattaatatcaata	CRISPR spacer
tatttcatctcaagaatactaatattaaat	Protospacer
*  ..*************.******.**  

153. spacer 1.38|39779|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to MT188223 (Acinetobacter phage vB_AbaM_D22, complete genome) position: , mismatch: 8, identity: 0.733

tgatgctttgtgtcaatgtcattaatttct	CRISPR spacer
aaccaccttgtgtcaatttcatttatttct	Protospacer
 . ..*.********** ***** ******

154. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KU525621 (Bacillus anthracis strain P.NO2 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

155. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NC_014332 (Bacillus cereus biovar anthracis str. CI plasmid pCI-XO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

156. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NC_012577 (Bacillus anthracis str. CDC 684 plasmid pX02, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

157. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP028161 (Lactococcus lactis subsp. lactis strain 14B4 plasmid p14B4, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
tttcatccatcatttcttttacatttttac	Protospacer
*    ..*************** ****** 

158. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP015778 (Bacillus anthracis strain Tangail-1 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

159. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018905 (Bacillus anthracis strain Tyrol 4675 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

160. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP023003 (Bacillus anthracis strain 14RA5914 plasmid pX02, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

161. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP019733 (Bacillus anthracis strain PCr plasmid PCr-pXO2) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

162. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP018445 (Bacillus anthracis strain CZC5 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

163. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029325 (Bacillus anthracis strain 17OD930 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

164. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NC_012655 (Bacillus anthracis str. A0248 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

165. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NC_007323 (Bacillus anthracis str. 'Ames Ancestor' plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

166. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP010854 (Bacillus anthracis strain A1144 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

167. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP007617 (Bacillus anthracis strain 2000031021 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

168. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP008848 (Bacillus anthracis strain HYU01 plasmid pX02, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

169. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP006744 (Bacillus anthracis str. SVA11 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

170. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP014835 (Bacillus anthracis strain Shikan-NIID plasmid pXO2) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

171. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029807 (Bacillus anthracis strain London_499 plasmid pX02, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

172. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NC_002146 (Bacillus anthracis plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

173. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NC_017727 (Bacillus anthracis str. H9401 plasmid BAP2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

174. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009314 (Bacillus anthracis str. Turkey32 strain 35 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

175. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP014178 (Bacillus anthracis strain Stendal plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

176. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009475 (Bacillus anthracis strain Pasteur plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

177. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009900 (Bacillus anthracis strain 2002013094 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

178. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009339 (Bacillus anthracis strain Ohio ACB plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

179. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009695 (Bacillus anthracis strain RA3 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

180. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009462 (Bacillus anthracis strain SK-102 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

181. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009698 (Bacillus anthracis strain BA1035 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

182. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009542 (Bacillus anthracis strain BA1015 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

183. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP010320 (Bacillus anthracis strain Canadian Bison isolate A0369 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

184. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009329 (Bacillus anthracis strain K3 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

185. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009326 (Bacillus anthracis strain Vollum 1B plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

186. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009979 (Bacillus anthracis strain Ames isolate BACI008 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

187. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP001972 (Bacillus anthracis str. A16 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

188. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP047133 (Bacillus anthracis str. BF1 plasmid pXO2, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ctgacttcataatttcttttactttttttc	Protospacer
. .*..**** *****************  

189. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP013227 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_1, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
cttttgtcatcattgcttttgcttttttag	Protospacer
.   * ******** *****.********.

190. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP015111 (Acinetobacter sp. TGL-Y2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
gggttgtcagcatttcttttgcttttttat	Protospacer
 .. * *** **********.******** 

191. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NC_022877 (Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
ttttctccatctgttcttttacttttttaa	Protospacer
*   ...****  *****************

192. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to JN797796 (Bacillus phage B5S, complete genome) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
gagcttcaatcatctcttttacttttttat	Protospacer
 *. *.. *****.*************** 

193. spacer 1.40|39911|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NC_018863 (Bacillus phage B4, complete genome) position: , mismatch: 8, identity: 0.733

taaatctcatcatttcttttacttttttaa	CRISPR spacer
gagcttcaatcatctcttttacttttttat	Protospacer
 *. *.. *****.*************** 

194. spacer 1.41|39977|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP051543 (Paracoccus sanguinis strain OM2164 plasmid pPspOM122, complete sequence) position: , mismatch: 8, identity: 0.733

aagttgttagttccatgttgttttctcctt	CRISPR spacer
agactcccagttccatgttgtttcctcctg	Protospacer
*...* ..***************.***** 

195. spacer 1.2|37401|30|MNAC01000010|CRT,CRISPRCasFinder matches to MN694333 (Marine virus AFVG_250M426, complete genome) position: , mismatch: 9, identity: 0.7

tgaaatagcatcttcaaaccctttttgtaa	CRISPR spacer
gcttatagaatcttcaaacgctttttgggc	Protospacer
    **** ********** ******* . 

196. spacer 1.10|37929|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP053900 (Proteus mirabilis strain YPM35 plasmid pJPM35-2, complete sequence) position: , mismatch: 9, identity: 0.7

agtttatcaagaagtaaagccaaataaatt	CRISPR spacer
ttaacaacaagaagtaaagccgaataaaaa	Protospacer
    .* **************.******  

197. spacer 1.11|37995|30|MNAC01000010|CRT,CRISPRCasFinder matches to MN694543 (Marine virus AFVG_250M1151, complete genome) position: , mismatch: 9, identity: 0.7

agcccttttgccatccattcatttaccttg	CRISPR spacer
tcgcggcttgccatccattcatttatctca	Protospacer
   *  .******************.**..

198. spacer 1.11|37995|30|MNAC01000010|CRT,CRISPRCasFinder matches to MN694407 (Marine virus AFVG_250M1153, complete genome) position: , mismatch: 9, identity: 0.7

agcccttttgccatccattcatttaccttg	CRISPR spacer
tcgcggcttgccatccattcatttatctca	Protospacer
   *  .******************.**..

199. spacer 1.11|37995|30|MNAC01000010|CRT,CRISPRCasFinder matches to MN694457 (Marine virus AFVG_250M832, complete genome) position: , mismatch: 9, identity: 0.7

agcccttttgccatccattcatttaccttg	CRISPR spacer
tcgcggcttgccatccattcatttatctca	Protospacer
   *  .******************.**..

200. spacer 1.11|37995|30|MNAC01000010|CRT,CRISPRCasFinder matches to MN694516 (Marine virus AFVG_250M1152, complete genome) position: , mismatch: 9, identity: 0.7

agcccttttgccatccattcatttaccttg	CRISPR spacer
tcgcggcttgccatccattcatttatctca	Protospacer
   *  .******************.**..

201. spacer 1.11|37995|30|MNAC01000010|CRT,CRISPRCasFinder matches to MN693808 (Marine virus AFVG_250M831, complete genome) position: , mismatch: 9, identity: 0.7

agcccttttgccatccattcatttaccttg	CRISPR spacer
tcgcggcttgccatccattcatttatctca	Protospacer
   *  .******************.**..

202. spacer 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder matches to MW149095 (Microvirus sp. isolate gila33, complete genome) position: , mismatch: 9, identity: 0.7

cttgttaatatcttcaatctcaaacgggga	CRISPR spacer
attattaatatcttcaatctgaaaaatatc	Protospacer
 **.**************** *** . .  

203. spacer 1.25|38920|31|MNAC01000010|CRT,CRISPRCasFinder matches to NC_025153 (Arcobacter butzleri strain AC1119 plasmid AB-1119-LD, complete sequence) position: , mismatch: 9, identity: 0.71

agatactgttaatcaaattaaagagtcttcg	CRISPR spacer
gctaacttttaatcaaattaaagagttaggg	Protospacer
.   *** ******************.   *

204. spacer 1.27|39053|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 9, identity: 0.7

gttgatgtcagcattaatgtgattgattat	CRISPR spacer
agaattgtcataattaatgtgattgattta	Protospacer
.  . *****  ****************  

205. spacer 1.29|39185|30|MNAC01000010|CRT,CRISPRCasFinder matches to NC_031944 (Synechococcus phage S-WAM1 isolate 0810PA09, complete genome) position: , mismatch: 9, identity: 0.7

gctcaaaagcaacatcagtacactcaaaaa	CRISPR spacer
ttgcagaagcaacatcaggacactcacttc	Protospacer
 . **.************ *******    

206. spacer 1.30|39251|30|MNAC01000010|CRT,CRISPRCasFinder matches to KF114877 (Leptospira phage LnoZ_CZ214, complete genome) position: , mismatch: 9, identity: 0.7

atgaagatattatgtcacttaattaaactc	CRISPR spacer
ttttctatattatgtcactttattaaataa	Protospacer
 *    ************** ******.  

207. spacer 1.31|39317|30|MNAC01000010|CRT,CRISPRCasFinder matches to MN693684 (Marine virus AFVG_250M122, complete genome) position: , mismatch: 9, identity: 0.7

aacattagtgcatgaaatacttcatggttg	CRISPR spacer
gctattagtgcatcaaatacttcattacct	Protospacer
. .********** *********** ... 

208. spacer 1.31|39317|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP032413 (Paenibacillus lautus strain E7593-69 plasmid pAZOPL1, complete sequence) position: , mismatch: 9, identity: 0.7

aacattagtgcatgaaatacttcatggttg	CRISPR spacer
gcaggttgtgcattaaatacttcatggtga	Protospacer
.  . * ****** ************** .

209. spacer 1.31|39317|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP020864 (Paenibacillus sp. Cedars plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

aacattagtgcatgaaatacttcatggttg	CRISPR spacer
gcaggttgtgcattaaatacttcatggtga	Protospacer
.  . * ****** ************** .

210. spacer 1.31|39317|30|MNAC01000010|CRT,CRISPRCasFinder matches to MN694540 (Marine virus AFVG_250M802, complete genome) position: , mismatch: 9, identity: 0.7

aacattagtgcatgaaatacttcatggttg	CRISPR spacer
gccattagtgcatccaatacttcattacct	Protospacer
. ***********  ********** ... 

211. spacer 1.39|39845|30|MNAC01000010|CRT,CRISPRCasFinder,PILER-CR matches to MK415409 (Phage YS1-2_2434, complete genome) position: , mismatch: 9, identity: 0.7

gcttcgtagtcaagcatttcagataacatt	CRISPR spacer
agttcgttgtcaaacatttcagatactcca	Protospacer
. ***** *****.*********** . . 

212. spacer 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder matches to MN032614 (Aeromonas phage PS1, complete genome) position: , mismatch: 10, identity: 0.667

cttgttaatatcttcaatctcaaacgggga	CRISPR spacer
gaagttattatcttcaatctcaaagcacct	Protospacer
   **** ****************  .   

213. spacer 1.15|38259|30|MNAC01000010|CRT,CRISPRCasFinder matches to MK813940 (Aeromonas phage 4_L372X, complete genome) position: , mismatch: 10, identity: 0.667

cttgttaatatcttcaatctcaaacgggga	CRISPR spacer
aaaattaatatcttcaaactcaaactcatt	Protospacer
   .************* *******  .  

214. spacer 1.21|38656|30|MNAC01000010|CRT,CRISPRCasFinder matches to NZ_CP046706 (Nostoc sp. ATCC 53789 plasmid pNsp_c, complete sequence) position: , mismatch: 10, identity: 0.667

ttgaacaaattgcttatgataaagacatca	CRISPR spacer
aaattcaaattgctaatgataaagactatt	Protospacer
  .  ********* ***********  . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage