Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP011378 Moraxella bovoculi strain 28389, complete genome 1 crisprs cas12a,cas4,cas2,cas14j,c2c9_V-U4,cas3,DEDDh 7 9 9 6

Results visualization

1. CP011378
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP011378_1 50580-51504 TypeI-A,TypeV-A NA
14 spacers
cas2,cas4,cas12a,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP011378_1 1.2|50680|27|CP011378|CRISPRCasFinder,CRT 50680-50706 27 CP011378.1 984872-984898 0 1.0
CP011378_1 1.3|50743|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 50743-50769 27 CP011378.1 1690964-1690990 0 1.0
CP011378_1 1.4|50806|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 50806-50832 27 CP011378.1 972640-972666 0 1.0
CP011378_1 1.5|50869|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 50869-50895 27 CP011378.1 1172541-1172567 0 1.0
CP011378_1 1.6|50932|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 50932-50958 27 CP011378.1 1836453-1836479 0 1.0
CP011378_1 1.11|51251|28|CP011378|CRISPRCasFinder,CRT,PILER-CR 51251-51278 28 CP011378.1 2019026-2019053 0 1.0
CP011378_1 1.9|51122|29|CP011378|CRISPRCasFinder,CRT,PILER-CR 51122-51150 29 CP011378.1 2042507-2042535 1 0.966

1. spacer 1.2|50680|27|CP011378|CRISPRCasFinder,CRT matches to position: 984872-984898, mismatch: 0, identity: 1.0

tcaaaaatggtagcatttgttaagaat	CRISPR spacer
tcaaaaatggtagcatttgttaagaat	Protospacer
***************************

2. spacer 1.3|50743|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to position: 1690964-1690990, mismatch: 0, identity: 1.0

attgatgtaaacatcgatggtgtggtt	CRISPR spacer
attgatgtaaacatcgatggtgtggtt	Protospacer
***************************

3. spacer 1.4|50806|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to position: 972640-972666, mismatch: 0, identity: 1.0

cccatcaaggcttcaatatcatcgtgc	CRISPR spacer
cccatcaaggcttcaatatcatcgtgc	Protospacer
***************************

4. spacer 1.5|50869|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to position: 1172541-1172567, mismatch: 0, identity: 1.0

atgaaatagagcaacagcagaacggta	CRISPR spacer
atgaaatagagcaacagcagaacggta	Protospacer
***************************

5. spacer 1.6|50932|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to position: 1836453-1836479, mismatch: 0, identity: 1.0

tgcaggtggtgaatcagcgacacattc	CRISPR spacer
tgcaggtggtgaatcagcgacacattc	Protospacer
***************************

6. spacer 1.11|51251|28|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to position: 2019026-2019053, mismatch: 0, identity: 1.0

ctaaatgccgtgtcgttttggttcttat	CRISPR spacer
ctaaatgccgtgtcgttttggttcttat	Protospacer
****************************

7. spacer 1.9|51122|29|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to position: 2042507-2042535, mismatch: 1, identity: 0.966

tgggaatattatagcagatttatttaatt	CRISPR spacer
tggggatattatagcagatttatttaatt	Protospacer
****.************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP011378_1 1.13|51377|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 51377-51403 27 NZ_CP011375 Moraxella bovoculi strain 58069 plasmid unnamed, complete sequence 14285-14311 0 1.0
CP011378_1 1.4|50806|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 50806-50832 27 HQ634196 Vibrio phage VBP32 genomic sequence 44072-44098 4 0.852
CP011378_1 1.4|50806|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 50806-50832 27 HQ634194 Vibrio phage VBP47 genomic sequence 39328-39354 4 0.852
CP011378_1 1.2|50680|27|CP011378|CRISPRCasFinder,CRT 50680-50706 27 MN657113 Psychrobacter sp. strain ANT_P52 plasmid pA52P5, complete sequence 12610-12636 5 0.815
CP011378_1 1.4|50806|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 50806-50832 27 KR093633 Moraxella phage Mcat9, complete genome 15897-15923 5 0.815
CP011378_1 1.6|50932|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 50932-50958 27 MN694744 Marine virus AFVG_250M730, complete genome 1823-1849 5 0.815
CP011378_1 1.9|51122|29|CP011378|CRISPRCasFinder,CRT,PILER-CR 51122-51150 29 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 318619-318647 5 0.828
CP011378_1 1.10|51187|28|CP011378|CRISPRCasFinder,CRT,PILER-CR 51187-51214 28 MN694658 Marine virus AFVG_250M284, complete genome 3542-3569 5 0.821
CP011378_1 1.12|51315|26|CP011378|CRISPRCasFinder,CRT,PILER-CR 51315-51340 26 KP280062 Vibrio phage phi 1, complete genome 57299-57324 5 0.808
CP011378_1 1.1|50616|28|CP011378|CRISPRCasFinder,CRT 50616-50643 28 NZ_CP041396 Bacteroides ovatus strain 3725 D1 iv plasmid unnamed1, complete sequence 89558-89585 6 0.786
CP011378_1 1.3|50743|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 50743-50769 27 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 16147-16173 6 0.778
CP011378_1 1.3|50743|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 50743-50769 27 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 16143-16169 6 0.778
CP011378_1 1.3|50743|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 50743-50769 27 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 16144-16170 6 0.778
CP011378_1 1.4|50806|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 50806-50832 27 MF417903 Uncultured Caudovirales phage clone 10F_3, partial genome 23236-23262 6 0.778
CP011378_1 1.4|50806|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 50806-50832 27 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 109302-109328 6 0.778
CP011378_1 1.13|51377|27|CP011378|CRISPRCasFinder,CRT,PILER-CR 51377-51403 27 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 301975-302001 6 0.778
CP011378_1 1.9|51122|29|CP011378|CRISPRCasFinder,CRT,PILER-CR 51122-51150 29 NC_014824 Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL01, complete sequence 149149-149177 7 0.759
CP011378_1 1.9|51122|29|CP011378|CRISPRCasFinder,CRT,PILER-CR 51122-51150 29 NC_014824 Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL01, complete sequence 323267-323295 7 0.759
CP011378_1 1.9|51122|29|CP011378|CRISPRCasFinder,CRT,PILER-CR 51122-51150 29 NC_014824 Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL01, complete sequence 84248-84276 7 0.759
CP011378_1 1.9|51122|29|CP011378|CRISPRCasFinder,CRT,PILER-CR 51122-51150 29 NC_049857 Lactococcus phage P1048, complete genome 60198-60226 7 0.759
CP011378_1 1.9|51122|29|CP011378|CRISPRCasFinder,CRT,PILER-CR 51122-51150 29 MK448940 Streptococcus phage Javan444, complete genome 885-913 7 0.759

1. spacer 1.13|51377|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011375 (Moraxella bovoculi strain 58069 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacctgttcgccgcttggatgttac	CRISPR spacer
ggaacctgttcgccgcttggatgttac	Protospacer
***************************

2. spacer 1.4|50806|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to HQ634196 (Vibrio phage VBP32 genomic sequence) position: , mismatch: 4, identity: 0.852

cccatcaaggcttcaatatcatcgtgc	CRISPR spacer
tccattaaggcttcaatatcatcttgg	Protospacer
.****.***************** ** 

3. spacer 1.4|50806|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to HQ634194 (Vibrio phage VBP47 genomic sequence) position: , mismatch: 4, identity: 0.852

cccatcaaggcttcaatatcatcgtgc	CRISPR spacer
tccattaaggcttcaatatcatcttgg	Protospacer
.****.***************** ** 

4. spacer 1.2|50680|27|CP011378|CRISPRCasFinder,CRT matches to MN657113 (Psychrobacter sp. strain ANT_P52 plasmid pA52P5, complete sequence) position: , mismatch: 5, identity: 0.815

tcaaaaatggtagcatttgttaagaat	CRISPR spacer
tccaaaatgttagcatttgttaacatg	Protospacer
** ****** ************* *  

5. spacer 1.4|50806|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to KR093633 (Moraxella phage Mcat9, complete genome) position: , mismatch: 5, identity: 0.815

cccatcaaggcttcaatatcatcgtgc	CRISPR spacer
cctgacaaggcttcaatatcatcttgg	Protospacer
**.. ****************** ** 

6. spacer 1.6|50932|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to MN694744 (Marine virus AFVG_250M730, complete genome) position: , mismatch: 5, identity: 0.815

tgcaggtggtgaatcagcgacacattc	CRISPR spacer
tgcccgtggtgaatcagcgacacttat	Protospacer
***  ****************** * .

7. spacer 1.9|51122|29|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 5, identity: 0.828

tgggaatattatagcagatttatttaatt	CRISPR spacer
tgctaatataatagaagatttatttaaat	Protospacer
**  ***** **** ************ *

8. spacer 1.10|51187|28|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to MN694658 (Marine virus AFVG_250M284, complete genome) position: , mismatch: 5, identity: 0.821

aagcggttcacaaaaaccactcattaag	CRISPR spacer
cagttggacacaaaaaccactcattaag	Protospacer
 **. *  ********************

9. spacer 1.12|51315|26|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to KP280062 (Vibrio phage phi 1, complete genome) position: , mismatch: 5, identity: 0.808

ctgtggctttcatgtcacacctctca	CRISPR spacer
ctgtagctttcatatcacacctcatc	Protospacer
****.********.********* . 

10. spacer 1.1|50616|28|CP011378|CRISPRCasFinder,CRT matches to NZ_CP041396 (Bacteroides ovatus strain 3725 D1 iv plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tttagaaatcacggatcattatatatgt	CRISPR spacer
tgaagaaatctctgatcattatatattc	Protospacer
*  ******* * ************* .

11. spacer 1.3|50743|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 6, identity: 0.778

attgatgtaaacatcgatggtgtggtt	CRISPR spacer
cttgatgtagacatcgatggtgacggg	Protospacer
 ********.************  *  

12. spacer 1.3|50743|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 6, identity: 0.778

attgatgtaaacatcgatggtgtggtt	CRISPR spacer
cttgatgtagacatcgatggtgacggg	Protospacer
 ********.************  *  

13. spacer 1.3|50743|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 6, identity: 0.778

attgatgtaaacatcgatggtgtggtt	CRISPR spacer
cttgatgtagacatcgatggtgacggg	Protospacer
 ********.************  *  

14. spacer 1.4|50806|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to MF417903 (Uncultured Caudovirales phage clone 10F_3, partial genome) position: , mismatch: 6, identity: 0.778

cccatcaaggcttcaatatcatcgtgc	CRISPR spacer
gacttcaaggcttcaatatcatcgaat	Protospacer
  * ******************** ..

15. spacer 1.4|50806|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

cccatcaaggcttcaatatcatcgtgc	CRISPR spacer
gtcatcaaggcttcaatataattgtta	Protospacer
 .***************** **.**  

16. spacer 1.13|51377|27|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 6, identity: 0.778

ggaacctgttcgccgcttggatgttac	CRISPR spacer
tcaacctgttcgccgcctggatggtgg	Protospacer
  **************.****** *. 

17. spacer 1.9|51122|29|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to NC_014824 (Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL01, complete sequence) position: , mismatch: 7, identity: 0.759

tgggaatattatagcagatttatttaatt	CRISPR spacer
catatatattatagcagatttatttaaga	Protospacer
.. . **********************  

18. spacer 1.9|51122|29|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to NC_014824 (Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL01, complete sequence) position: , mismatch: 7, identity: 0.759

tgggaatattatagcagatttatttaatt	CRISPR spacer
catatatattatagcagatttatttaaga	Protospacer
.. . **********************  

19. spacer 1.9|51122|29|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to NC_014824 (Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL01, complete sequence) position: , mismatch: 7, identity: 0.759

tgggaatattatagcagatttatttaatt	CRISPR spacer
tatatatattatagcagatttttttaaga	Protospacer
*. . **************** *****  

20. spacer 1.9|51122|29|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to NC_049857 (Lactococcus phage P1048, complete genome) position: , mismatch: 7, identity: 0.759

tgggaatattatagcagatttatttaatt	CRISPR spacer
atataatattatagcatatttatttaaaa	Protospacer
  . ************ **********  

21. spacer 1.9|51122|29|CP011378|CRISPRCasFinder,CRT,PILER-CR matches to MK448940 (Streptococcus phage Javan444, complete genome) position: , mismatch: 7, identity: 0.759

tgggaatattatagcagatttatttaatt	CRISPR spacer
atcaattattatagcagatatatttgatt	Protospacer
   .* ************* *****.***

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 253121 : 300661 56 Moraxella_phage(61.11%) tail,transposase,integrase,tRNA,head,terminase attL 252521:252540|attR 284718:284737
DBSCAN-SWA_2 675750 : 743916 60 Pseudomonas_virus(20.0%) tail,plate,capsid,transposase,tRNA,head,terminase,portal NA
DBSCAN-SWA_3 768818 : 775573 8 Lake_Baikal_phage(33.33%) NA NA
DBSCAN-SWA_4 826297 : 834796 11 Moraxella_phage(62.5%) transposase NA
DBSCAN-SWA_5 1011754 : 1046032 46 Burkholderia_virus(29.03%) tail,transposase,integrase,tRNA,terminase attL 1027186:1027202|attR 1052278:1052294
DBSCAN-SWA_6 1051017 : 1063676 16 Moraxella_phage(27.27%) tail,plate NA
DBSCAN-SWA_7 1091508 : 1104313 10 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_8 1315192 : 1324378 10 Acinetobacter_phage(42.86%) NA NA
DBSCAN-SWA_9 2007552 : 2117042 112 Moraxella_phage(71.64%) tail,transposase,integrase,head,terminase attL 2041831:2041846|attR 2123984:2123999
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP011378.1|AKG12143.1|1941779_1942739_+|hypothetical-protein 1941779_1942739_+ 319 aa aa AcrVA2 HTH_XRE NA No NA
CP011378.1|AKG12174.1|1997633_1997912_+|hypothetical-protein 1997633_1997912_+ 92 aa aa AcrVA5 NA NA No NA
CP011378.1|AKG12175.1|1997916_1998621_+|hypothetical-protein 1997916_1998621_+ 234 aa aa AcrVA4 NA NA No NA
CP011378.1|AKG12204.1|2033687_2034188_-|hypothetical-protein 2033687_2034188_- 166 aa aa NA HTH_OrfB_IS605 NA 2007552-2117042 yes
CP011378.1|AKG12220.1|2047223_2047685_+|hypothetical-protein 2047223_2047685_+ 153 aa aa NA HTH_OrfB_IS605 NA 2007552-2117042 yes
CP011378.1|AKG12221.1|2047824_2048217_+|hypothetical-protein 2047824_2048217_+ 130 aa aa NA HTH_OrfB_IS605 NA 2007552-2117042 yes