Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
JNWI01000105 Delftia sp. 670 Delftia_670_Contig00105, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000008 Delftia sp. 670 Delftia_670_Contig00008, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000139 Delftia sp. 670 Delftia_670_Contig00139, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000080 Delftia sp. 670 Delftia_670_Contig00080, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000050 Delftia sp. 670 Delftia_670_Contig00050, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000039 Delftia sp. 670 Delftia_670_Contig00039, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
JNWI01000065 Delftia sp. 670 Delftia_670_Contig00065, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000143 Delftia sp. 670 Delftia_670_Contig00143, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000051 Delftia sp. 670 Delftia_670_Contig00051, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000060 Delftia sp. 670 Delftia_670_Contig00060, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000121 Delftia sp. 670 Delftia_670_Contig00121, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000030 Delftia sp. 670 Delftia_670_Contig00030, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000125 Delftia sp. 670 Delftia_670_Contig00125, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000140 Delftia sp. 670 Delftia_670_Contig00140, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000071 Delftia sp. 670 Delftia_670_Contig00071, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000091 Delftia sp. 670 Delftia_670_Contig00091, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000094 Delftia sp. 670 Delftia_670_Contig00094, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
JNWI01000137 Delftia sp. 670 Delftia_670_Contig00137, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000022 Delftia sp. 670 Delftia_670_Contig00022, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000026 Delftia sp. 670 Delftia_670_Contig00026, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000090 Delftia sp. 670 Delftia_670_Contig00090, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000012 Delftia sp. 670 Delftia_670_Contig00012, whole genome shotgun sequence 0 crisprs WYL,csa3 0 0 0 0
JNWI01000088 Delftia sp. 670 Delftia_670_Contig00088, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000102 Delftia sp. 670 Delftia_670_Contig00102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000144 Delftia sp. 670 Delftia_670_Contig00144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000159 Delftia sp. 670 Delftia_670_Contig00159, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000128 Delftia sp. 670 Delftia_670_Contig00128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000042 Delftia sp. 670 Delftia_670_Contig00042, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000086 Delftia sp. 670 Delftia_670_Contig00086, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000089 Delftia sp. 670 Delftia_670_Contig00089, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000009 Delftia sp. 670 Delftia_670_Contig00009, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000122 Delftia sp. 670 Delftia_670_Contig00122, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000036 Delftia sp. 670 Delftia_670_Contig00036, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000130 Delftia sp. 670 Delftia_670_Contig00130, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000061 Delftia sp. 670 Delftia_670_Contig00061, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000028 Delftia sp. 670 Delftia_670_Contig00028, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000097 Delftia sp. 670 Delftia_670_Contig00097, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000123 Delftia sp. 670 Delftia_670_Contig00123, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000049 Delftia sp. 670 Delftia_670_Contig00049, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000112 Delftia sp. 670 Delftia_670_Contig00112, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000011 Delftia sp. 670 Delftia_670_Contig00011, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000007 Delftia sp. 670 Delftia_670_Contig00007, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000127 Delftia sp. 670 Delftia_670_Contig00127, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000072 Delftia sp. 670 Delftia_670_Contig00072, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000078 Delftia sp. 670 Delftia_670_Contig00078, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
JNWI01000158 Delftia sp. 670 Delftia_670_Contig00158, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000064 Delftia sp. 670 Delftia_670_Contig00064, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000126 Delftia sp. 670 Delftia_670_Contig00126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000044 Delftia sp. 670 Delftia_670_Contig00044, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000054 Delftia sp. 670 Delftia_670_Contig00054, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000108 Delftia sp. 670 Delftia_670_Contig00108, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
JNWI01000027 Delftia sp. 670 Delftia_670_Contig00027, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000063 Delftia sp. 670 Delftia_670_Contig00063, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
JNWI01000010 Delftia sp. 670 Delftia_670_Contig00010, whole genome shotgun sequence 0 crisprs PD-DExK 0 0 0 0
JNWI01000131 Delftia sp. 670 Delftia_670_Contig00131, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000003 Delftia sp. 670 Delftia_670_Contig00003, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000095 Delftia sp. 670 Delftia_670_Contig00095, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000021 Delftia sp. 670 Delftia_670_Contig00021, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000135 Delftia sp. 670 Delftia_670_Contig00135, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000069 Delftia sp. 670 Delftia_670_Contig00069, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000023 Delftia sp. 670 Delftia_670_Contig00023, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
JNWI01000082 Delftia sp. 670 Delftia_670_Contig00082, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000033 Delftia sp. 670 Delftia_670_Contig00033, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000053 Delftia sp. 670 Delftia_670_Contig00053, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000001 Delftia sp. 670 Delftia_670_Contig00001, whole genome shotgun sequence 0 crisprs PD-DExK 0 0 0 0
JNWI01000075 Delftia sp. 670 Delftia_670_Contig00075, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000092 Delftia sp. 670 Delftia_670_Contig00092, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000062 Delftia sp. 670 Delftia_670_Contig00062, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000032 Delftia sp. 670 Delftia_670_Contig00032, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000047 Delftia sp. 670 Delftia_670_Contig00047, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000153 Delftia sp. 670 Delftia_670_Contig00153, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000101 Delftia sp. 670 Delftia_670_Contig00101, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000068 Delftia sp. 670 Delftia_670_Contig00068, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000134 Delftia sp. 670 Delftia_670_Contig00134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000066 Delftia sp. 670 Delftia_670_Contig00066, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000156 Delftia sp. 670 Delftia_670_Contig00156, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000117 Delftia sp. 670 Delftia_670_Contig00117, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000038 Delftia sp. 670 Delftia_670_Contig00038, whole genome shotgun sequence 0 crisprs cas6f,cas7f,cas5f,cas8f 0 0 0 0
JNWI01000034 Delftia sp. 670 Delftia_670_Contig00034, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000120 Delftia sp. 670 Delftia_670_Contig00120, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000056 Delftia sp. 670 Delftia_670_Contig00056, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000100 Delftia sp. 670 Delftia_670_Contig00100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000079 Delftia sp. 670 Delftia_670_Contig00079, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000019 Delftia sp. 670 Delftia_670_Contig00019, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000048 Delftia sp. 670 Delftia_670_Contig00048, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000098 Delftia sp. 670 Delftia_670_Contig00098, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000151 Delftia sp. 670 Delftia_670_Contig00151, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000035 Delftia sp. 670 Delftia_670_Contig00035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000118 Delftia sp. 670 Delftia_670_Contig00118, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000006 Delftia sp. 670 Delftia_670_Contig00006, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000058 Delftia sp. 670 Delftia_670_Contig00058, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000004 Delftia sp. 670 Delftia_670_Contig00004, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000115 Delftia sp. 670 Delftia_670_Contig00115, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000024 Delftia sp. 670 Delftia_670_Contig00024, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000046 Delftia sp. 670 Delftia_670_Contig00046, whole genome shotgun sequence 1 crisprs NA 1 2 0 0
JNWI01000093 Delftia sp. 670 Delftia_670_Contig00093, whole genome shotgun sequence 0 crisprs cas2,cas1,cas4,cas7,cas5 0 0 0 0
JNWI01000037 Delftia sp. 670 Delftia_670_Contig00037, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000077 Delftia sp. 670 Delftia_670_Contig00077, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000087 Delftia sp. 670 Delftia_670_Contig00087, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000124 Delftia sp. 670 Delftia_670_Contig00124, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000157 Delftia sp. 670 Delftia_670_Contig00157, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000154 Delftia sp. 670 Delftia_670_Contig00154, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000070 Delftia sp. 670 Delftia_670_Contig00070, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000052 Delftia sp. 670 Delftia_670_Contig00052, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000119 Delftia sp. 670 Delftia_670_Contig00119, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000129 Delftia sp. 670 Delftia_670_Contig00129, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000152 Delftia sp. 670 Delftia_670_Contig00152, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000146 Delftia sp. 670 Delftia_670_Contig00146, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000031 Delftia sp. 670 Delftia_670_Contig00031, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000016 Delftia sp. 670 Delftia_670_Contig00016, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000096 Delftia sp. 670 Delftia_670_Contig00096, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000136 Delftia sp. 670 Delftia_670_Contig00136, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
JNWI01000015 Delftia sp. 670 Delftia_670_Contig00015, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000081 Delftia sp. 670 Delftia_670_Contig00081, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000076 Delftia sp. 670 Delftia_670_Contig00076, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000145 Delftia sp. 670 Delftia_670_Contig00145, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000104 Delftia sp. 670 Delftia_670_Contig00104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000029 Delftia sp. 670 Delftia_670_Contig00029, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000041 Delftia sp. 670 Delftia_670_Contig00041, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000040 Delftia sp. 670 Delftia_670_Contig00040, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000110 Delftia sp. 670 Delftia_670_Contig00110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000099 Delftia sp. 670 Delftia_670_Contig00099, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000074 Delftia sp. 670 Delftia_670_Contig00074, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000133 Delftia sp. 670 Delftia_670_Contig00133, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000002 Delftia sp. 670 Delftia_670_Contig00002, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
JNWI01000114 Delftia sp. 670 Delftia_670_Contig00114, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000073 Delftia sp. 670 Delftia_670_Contig00073, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000109 Delftia sp. 670 Delftia_670_Contig00109, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000013 Delftia sp. 670 Delftia_670_Contig00013, whole genome shotgun sequence 1 crisprs NA 0 0 0 1
JNWI01000113 Delftia sp. 670 Delftia_670_Contig00113, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000107 Delftia sp. 670 Delftia_670_Contig00107, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000149 Delftia sp. 670 Delftia_670_Contig00149, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000043 Delftia sp. 670 Delftia_670_Contig00043, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000132 Delftia sp. 670 Delftia_670_Contig00132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000018 Delftia sp. 670 Delftia_670_Contig00018, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000141 Delftia sp. 670 Delftia_670_Contig00141, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000155 Delftia sp. 670 Delftia_670_Contig00155, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000014 Delftia sp. 670 Delftia_670_Contig00014, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000083 Delftia sp. 670 Delftia_670_Contig00083, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000150 Delftia sp. 670 Delftia_670_Contig00150, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000103 Delftia sp. 670 Delftia_670_Contig00103, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000057 Delftia sp. 670 Delftia_670_Contig00057, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000142 Delftia sp. 670 Delftia_670_Contig00142, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000106 Delftia sp. 670 Delftia_670_Contig00106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000067 Delftia sp. 670 Delftia_670_Contig00067, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000138 Delftia sp. 670 Delftia_670_Contig00138, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
JNWI01000084 Delftia sp. 670 Delftia_670_Contig00084, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000045 Delftia sp. 670 Delftia_670_Contig00045, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000085 Delftia sp. 670 Delftia_670_Contig00085, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000147 Delftia sp. 670 Delftia_670_Contig00147, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000005 Delftia sp. 670 Delftia_670_Contig00005, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000020 Delftia sp. 670 Delftia_670_Contig00020, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000055 Delftia sp. 670 Delftia_670_Contig00055, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000017 Delftia sp. 670 Delftia_670_Contig00017, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000059 Delftia sp. 670 Delftia_670_Contig00059, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000116 Delftia sp. 670 Delftia_670_Contig00116, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000111 Delftia sp. 670 Delftia_670_Contig00111, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000148 Delftia sp. 670 Delftia_670_Contig00148, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
JNWI01000025 Delftia sp. 670 Delftia_670_Contig00025, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0

Results visualization

1. JNWI01000013
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
JNWI01000013_1 18074-18174 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
JNWI01000013.1|KEH13790.1|125950_126196_+|hypothetical-protein 125950_126196_+ 81 aa aa AcrIF8 NA NA No NA
2. JNWI01000023
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 91723 136 Pseudomonas_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. JNWI01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. JNWI01000094
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5122 : 13642 9 Ralstonia_phage(28.57%) tail,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. JNWI01000078
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
JNWI01000078_1 11-176 Orphan I-C
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. JNWI01000046
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
JNWI01000046_1 78-346 Orphan I-F
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
JNWI01000046_1 1.2|166|32|JNWI01000046|CRT,PILER-CR 166-197 32 JNWI01000015.1 4586-4617 1 0.969

1. spacer 1.2|166|32|JNWI01000046|CRT,PILER-CR matches to position: 4586-4617, mismatch: 1, identity: 0.969

ctggccaagctcgcaaatcatgtggccaaaga	CRISPR spacer
ctggccaagctcgccaatcatgtggccaaaga	Protospacer
************** *****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
JNWI01000046_1 1.1|106|32|JNWI01000046|CRT 106-137 32 NZ_CP027861 Ahniella affigens strain D13 plasmid unnamed, complete sequence 48830-48861 7 0.781
JNWI01000046_1 1.4|286|33|JNWI01000046|CRT,PILER-CR 286-318 33 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 99721-99753 7 0.788
JNWI01000046_1 1.4|286|33|JNWI01000046|CRT,PILER-CR 286-318 33 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 455080-455112 9 0.727
JNWI01000046_1 1.4|286|33|JNWI01000046|CRT,PILER-CR 286-318 33 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 641688-641720 9 0.727
JNWI01000046_1 1.4|286|33|JNWI01000046|CRT,PILER-CR 286-318 33 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 169310-169342 10 0.697

1. spacer 1.1|106|32|JNWI01000046|CRT matches to NZ_CP027861 (Ahniella affigens strain D13 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

tgtccaaagtctgctttggcgccggttgcgtc	CRISPR spacer
cgttgcatgtctgccttggcgcgggttgcgtc	Protospacer
.**.  * ******.******* *********

2. spacer 1.4|286|33|JNWI01000046|CRT,PILER-CR matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788

acggagccgcccggcgcgggggggggcgctcag---	CRISPR spacer
tcggagccgcccgccgcggcgggg---gctctgccc	Protospacer
 ************ ***** ****   **** *   

3. spacer 1.4|286|33|JNWI01000046|CRT,PILER-CR matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.727

acggagccgcccggcgcgggggggggcgctcag	CRISPR spacer
ccggtgccgcccggcgcggtgggggagctgcac	Protospacer
 *** ************** *****.  . ** 

4. spacer 1.4|286|33|JNWI01000046|CRT,PILER-CR matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.727

acggagccgcccggcgcgggggggggcgctcag	CRISPR spacer
ccggtgccgcccggcgcggtgggggagctgcac	Protospacer
 *** ************** *****.  . ** 

5. spacer 1.4|286|33|JNWI01000046|CRT,PILER-CR matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 10, identity: 0.697

acggagccgcccggcgcgggggggggcgctcag	CRISPR spacer
gcggggccgcccggcgcgggcggggtgaacagg	Protospacer
.***.*************** ****  . . .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. JNWI01000063
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
JNWI01000063_1 33132-33291 Orphan I-C
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. JNWI01000108
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 9242 9 Burkholderia_phage(62.5%) terminase,portal,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage