Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
AYQC01000016 Rhodobacter capsulatus R121 seq0016, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000017 Rhodobacter capsulatus R121 seq0017, whole genome shotgun sequence 0 crisprs csa3,WYL 0 0 1 0
AYQC01000004 Rhodobacter capsulatus R121 seq0004, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000025 Rhodobacter capsulatus R121 seq0025, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000027 Rhodobacter capsulatus R121 seq0027, whole genome shotgun sequence 0 crisprs RT 0 0 1 0
AYQC01000008 Rhodobacter capsulatus R121 seq0008, whole genome shotgun sequence 0 crisprs csa3 0 0 1 1
AYQC01000013 Rhodobacter capsulatus R121 seq0013, whole genome shotgun sequence 5 crisprs cas10,csm3gr7,cas2,WYL,cas3,cas5,cas8c,cas7,cas4,cas1,DEDDh 7 29 0 0
AYQC01000001 Rhodobacter capsulatus R121 seq0001, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000003 Rhodobacter capsulatus R121 seq0003, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000022 Rhodobacter capsulatus R121 seq0022, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000023 Rhodobacter capsulatus R121 seq0023, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
AYQC01000007 Rhodobacter capsulatus R121 seq0007, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000033 Rhodobacter capsulatus R121 seq0033, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000010 Rhodobacter capsulatus R121 seq0010, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
AYQC01000006 Rhodobacter capsulatus R121 seq0006, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000005 Rhodobacter capsulatus R121 seq0005, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000021 Rhodobacter capsulatus R121 seq0021, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000014 Rhodobacter capsulatus R121 seq0014, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000029 Rhodobacter capsulatus R121 seq0029, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000012 Rhodobacter capsulatus R121 seq0012, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
AYQC01000002 Rhodobacter capsulatus R121 seq0002, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000020 Rhodobacter capsulatus R121 seq0020, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000031 Rhodobacter capsulatus R121 seq0031, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000019 Rhodobacter capsulatus R121 seq0019, whole genome shotgun sequence 1 crisprs cas13a 0 5 1 0
AYQC01000026 Rhodobacter capsulatus R121 seq0026, whole genome shotgun sequence 1 crisprs NA 2 0 1 0
AYQC01000036 Rhodobacter capsulatus R121 seq0036, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000028 Rhodobacter capsulatus R121 seq0028, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
AYQC01000024 Rhodobacter capsulatus R121 seq0024, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000009 Rhodobacter capsulatus R121 seq0009, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000032 Rhodobacter capsulatus R121 seq0032, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000018 Rhodobacter capsulatus R121 seq0018, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
AYQC01000035 Rhodobacter capsulatus R121 seq0035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000034 Rhodobacter capsulatus R121 seq0034, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000011 Rhodobacter capsulatus R121 seq0011, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000015 Rhodobacter capsulatus R121 seq0015, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
AYQC01000030 Rhodobacter capsulatus R121 seq0030, whole genome shotgun sequence 0 crisprs NA 0 0 1 1

Results visualization

1. AYQC01000017
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 494 : 11800 15 Emiliania_huxleyi_virus(44.44%) capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. AYQC01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2170 : 28373 26 Paracoccus_phage(23.53%) portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. AYQC01000019
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AYQC01000019_1 321133-321443 TypeVI-A NA
4 spacers
cas13a

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AYQC01000019_1 1.6|321237|33|AYQC01000019|CRT,PILER-CR 321237-321269 33 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 80925-80957 6 0.818
AYQC01000019_1 1.6|321237|33|AYQC01000019|CRT,PILER-CR 321237-321269 33 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 79004-79036 6 0.818
AYQC01000019_1 1.6|321237|33|AYQC01000019|CRT,PILER-CR 321237-321269 33 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 80925-80957 6 0.818
AYQC01000019_1 1.6|321237|33|AYQC01000019|CRT,PILER-CR 321237-321269 33 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 79004-79036 6 0.818
AYQC01000019_1 1.2|321234|36|AYQC01000019|CRISPRCasFinder 321234-321269 36 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 80925-80960 7 0.806
AYQC01000019_1 1.2|321234|36|AYQC01000019|CRISPRCasFinder 321234-321269 36 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 79004-79039 7 0.806
AYQC01000019_1 1.2|321234|36|AYQC01000019|CRISPRCasFinder 321234-321269 36 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 80925-80960 7 0.806
AYQC01000019_1 1.2|321234|36|AYQC01000019|CRISPRCasFinder 321234-321269 36 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 79004-79039 7 0.806
AYQC01000019_1 1.6|321237|33|AYQC01000019|CRT,PILER-CR 321237-321269 33 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 238917-238949 7 0.788
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP021084 Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence 165165-165195 7 0.774
AYQC01000019_1 1.2|321234|36|AYQC01000019|CRISPRCasFinder 321234-321269 36 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 238917-238952 8 0.778
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP025949 Escherichia coli strain SCEC020023 plasmid pCTXM55_020023, complete sequence 11307-11337 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KX928752 Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence 18106-18136 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP025626 Escherichia coli strain SCEC020007 plasmid pNDM5_020007, complete sequence 88971-89001 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP028541 Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence 16597-16627 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KT282968 Escherichia coli strain EC012 plasmid pEC012, complete sequence 32451-32481 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KT879914 Escherichia coli strain HNEC55 plasmid pHNEC55, complete sequence 12006-12036 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KP893385 Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence 83745-83775 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KT185451 Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence 16688-16718 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KT725788 Klebsiella pneumoniae strain ST147 plasmid pCC1410-1, complete sequence 81739-81769 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KT725789 Klebsiella pneumoniae strain ST147 plasmid pCC1409-1, complete sequence 76479-76509 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KR653209 Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence 112536-112566 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KR259134 Enterobacter cloacae strain ECL3786 plasmid pECL3786, complete sequence 967-997 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KT002541 Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence 4927-4957 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KR259130 Escherichia coli strain EC3157 plasmid pEC3157, complete sequence 2583-2613 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KR078259 Escherichia coli strain YD472 plasmid pYHCC, complete sequence 15781-15811 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KR259131 Escherichia coli strain EC3587 plasmid pEC3587, complete sequence 2830-2860 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP048368 Escherichia coli strain 163 plasmid pC-F-164_A-OXA140, complete sequence 28520-28550 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_AP023191 Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence 149396-149426 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP040124 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence 50937-50967 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NC_020278 Escherichia coli strain 3A11 plasmid pHN3A11, complete sequence 12811-12841 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP042601 Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence 47157-47187 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP026131 Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence 139028-139058 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP045264 Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence 16597-16627 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP049351 Escherichia coli strain 3R plasmid p3R-3, complete sequence 32480-32510 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 KY130431 Klebsiella pneumoniae plasmid pABC143C-NDM, complete sequence 6931-6961 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MK878892 Escherichia coli strain J53 plasmid pMG333, complete sequence 119032-119062 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NC_025106 Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence 85668-85698 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP033962 Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence 49169-49199 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP041930 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence 39196-39226 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP020510 Escherichia coli strain 165 plasmid unnamed1, complete sequence 21953-21983 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KJ020575 Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence 35207-35237 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP033956 Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence 14502-14532 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP025470 Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence 86455-86485 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 142610-142640 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MN007141 Escherichia coli strain 91 plasmid p91_NDM5, complete sequence 30871-30901 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP027038 Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence 130339-130369 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP036301 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence 20076-20106 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MT066418 Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence 51668-51698 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP054942 Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence 74711-74741 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP025952 Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence 120458-120488 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP020515 Escherichia coli strain 219 plasmid unnamed, complete sequence 141419-141449 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP019260 Escherichia coli strain 13C1065T plasmid p13C1065T-1, complete sequence 150364-150394 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP036372 Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence 16597-16627 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MK312244 Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence 16312-16342 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MK312245 Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence 16563-16593 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 16708-16738 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 16805-16835 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MK312248 Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence 16689-16719 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MK312249 Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence 16582-16612 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MN061455 Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence 43367-43397 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP027055 Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2 130343-130373 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MN641485 Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence 38081-38111 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MK312241 Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence 16792-16822 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MK312242 Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence 16548-16578 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 CP052444 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence 38735-38765 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP028796 Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence 14502-14532 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP041375 Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence 14502-14532 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP034324 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence 131890-131920 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP040547 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence 87695-87725 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP032242 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence 11459-11489 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP039820 Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence 16597-16627 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP034254 Escherichia coli strain IVRI Kol CP4 plasmid p1ESCUMpO83_CORR 68842-68872 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 KY463220 Escherichia coli plasmid pNDM5-IBAC, complete sequence 80208-80238 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP044259 Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence 16597-16627 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP024836 Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_2, complete sequence 55946-55976 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP026201 Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence 45015-45045 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP039810 Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence 18915-18945 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP031802 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence 44536-44566 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP034761 Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence 54625-54655 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 CP038003 Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence 73757-73787 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP028996 Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence 12488-12518 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP033404 Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence 19248-19278 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP040034 Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence 43114-43144 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP027043 Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence 181500-181530 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_AP018147 Escherichia coli strain M217 isolate M217 plasmid pM217_FII, complete sequence 15203-15233 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP033159 Escherichia coli strain CM IVRI KOL-1 plasmid p1ESCUMpO83_CORR 38022-38052 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP048372 Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence 88293-88323 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP041182 Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food plasmid p13520, complete sequence 216545-216575 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NC_019095 Escherichia coli plasmid pXZ, complete sequence 16328-16358 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP040807 Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence 7215-7245 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP046117 Enterobacter cloacae strain CBG15936 plasmid pTEM-CBG, complete sequence 13941-13971 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP017086 Proteus mirabilis strain T18 plasmid pT18, complete sequence 50563-50593 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP036180 Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence 49581-49611 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP036306 Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence 73758-73788 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP041180 Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence 222973-223003 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 CP028790 Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence 16597-16627 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP024840 Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_2, complete sequence 76645-76675 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP022157 Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence 20384-20414 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP047194 Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence 114560-114590 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP032166 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence 18612-18642 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP023895 Escherichia coli strain FDAARGOS_433 plasmid unnamed2, complete sequence 43758-43788 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP025458 Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence 71463-71493 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP034417 Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence 16597-16627 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MF918372 Klebsiella pneumoniae plasmid p1512-KPC, complete sequence 15062-15092 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP050367 Klebsiella pneumoniae strain 47733 plasmid p47733_NDM_5, complete sequence 56608-56638 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NC_019073 Escherichia coli plasmid pHN7A8, complete sequence 16437-16467 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP029381 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence 14502-14532 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP017084 Proteus mirabilis strain T21 plasmid pT212, complete sequence 164449-164479 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP026141 Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence 40067-40097 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP040029 Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence 40244-40274 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP031122 Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence 21716-21746 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP047407 Escherichia coli strain MS6193 plasmid pMS6193B, complete sequence 74711-74741 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP040541 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence 16597-16627 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP026584 Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence 19248-19278 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP047161 Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence 33177-33207 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 170662-170692 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MN822125 Escherichia coli strain 14E509 plasmid p14E509-2FII, complete sequence 741-771 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MN865122 Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence 69709-69739 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MN842292 Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence 1101-1131 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 105114-105144 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MN842295 Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence 85648-85678 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MN823988 Escherichia coli strain 14406 plasmid p14406-FII, complete sequence 125088-125118 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 32943-32973 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP043383 Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence 21373-21403 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MF353156 Escherichia coli plasmid pLZ135-NDM, complete sequence 11141-11171 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP012197 Escherichia coli strain ECwhn14 plasmid pECwhn14, complete sequence 80956-80986 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 AP023220 Escherichia coli M505 plasmid pM505-NDM5 DNA, complete genome 42745-42775 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 AP023236 Escherichia coli YJ6 plasmid pYJ6-NDM5 DNA, complete genome 16472-16502 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP027067 Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence 16597-16627 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP026579 Escherichia coli strain WCHEC005237 plasmid pRmtB1_005237, complete sequence 4541-4571 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP034125 Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence 9658-9688 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MN419308 Klebsiella pneumoniae strain 12478 plasmid p12478-rmtB, complete sequence 17157-17187 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_AP023198 Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence 149396-149426 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP050735 Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-1, complete sequence 39703-39733 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP054782 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence 14502-14532 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NC_016839 Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence 30763-30793 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP054764 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence 14502-14532 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP038455 Escherichia coli strain EC-129 plasmid pEC129_2, complete sequence 11414-11444 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 CP028547 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid pKPC2_020143, complete sequence 10978-11008 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP043936 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-4, complete sequence 41793-41823 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_AP018833 Escherichia coli strain M309 plasmid pM309-NDM5, complete sequence 34558-34588 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP054728 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence 14502-14532 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NC_010558 Escherichia coli plasmid pIP1206, complete sequence 116467-116497 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP050770 Salmonella enterica subsp. enterica serovar Indiana strain SI108 plasmid pSI108-1, complete sequence 58142-58172 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP054722 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence 14502-14532 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_AP018137 Escherichia coli strain M105 isolate M105 plasmid pM105_mF, complete sequence 14036-14066 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_AP018136 Escherichia coli strain M105 isolate M105 plasmid pM105_FII, complete sequence 16195-16225 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_AP018138 Escherichia coli strain M107 isolate M107 plasmid pM107_FII, complete sequence 16218-16248 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_AP018144 Escherichia coli strain M214 isolate M214 plasmid pM214_FII, complete sequence 16218-16248 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_AP018139 Escherichia coli strain M109 isolate M109 plasmid pM109_FII, complete sequence 25160-25190 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP023942 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2 144655-144685 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP026589 Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence 17157-17187 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP027695 Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence 83535-83565 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP041439 Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence 102075-102105 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MK878893 Escherichia coli strain J53 plasmid pMG335, complete sequence 58471-58501 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MK433206 Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence 64320-64350 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MN702385 Escherichia coli strain LWY24J plasmid pLWY24J-3, complete sequence 6661-6691 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP045839 Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence 30915-30945 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MN262643 Escherichia coli strain EC009 plasmid pEC009.2, complete sequence 18759-18789 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP053082 Escherichia coli strain HB37 plasmid pHB37-2, complete sequence 9487-9517 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MH316135 Salmonella enterica subsp. enterica serovar Indiana strain GDD25-16 plasmid pGDD25-16, complete sequence 17170-17200 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MH316136 Salmonella enterica subsp. enterica serovar Indiana strain GDD25-21 plasmid pGDD25-21, complete sequence 17170-17200 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MH255829 Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-CTX-TEM, complete sequence 36849-36879 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MH316133 Salmonella enterica subsp. enterica serovar Indiana strain GDD25-3 plasmid pGDD25-3, complete sequence 15449-15479 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MH316134 Salmonella enterica subsp. enterica serovar Indiana strain GDD25-5 plasmid pGDD25-5, complete sequence 12084-12114 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MH213345 Escherichia coli strain EC1188 plasmid pEC1188-NDM16, complete sequence 10999-11029 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MH917284 Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence 47744-47774 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KY748189 Escherichia coli strain EC007 plasmid pEC007, complete sequence 11152-11182 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KY865323 Escherichia coli strain SY286M plasmid pECM13, complete sequence 16100-16130 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MH329656 Escherichia coli strain 92944 plasmid p92944-CTXM, complete sequence 8066-8096 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MH263653 Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence 15062-15092 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MK079574 Escherichia coli strain TS62CTX plasmid pHNTS62, complete sequence 49605-49635 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MH161192 Klebsiella pneumoniae strain SCKLB138 plasmid pSCKLB138-1, complete sequence 90123-90153 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MK036888 Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence 17157-17187 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MK036886 Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence 25404-25434 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MN197360 Escherichia coli strain 5P plasmid pVSI_NDM_5, complete sequence 115968-115998 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MN218686 Escherichia coli strain 5M plasmid pISV_IncFII_NDM-5, complete sequence 142958-142988 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MF133495 Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence 15371-15401 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MF168403 Klebsiella pneumoniae strain 12139 plasmid p12139-KPC, complete sequence 17157-17187 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MG197488 Escherichia coli strain 04NHB3 plasmid pHN04NHB3, complete sequence 43255-43285 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MF168404 Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence 20688-20718 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MF156713 Escherichia coli strain 06028078 plasmid p28078-NDM, complete sequence 94753-94783 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MG197497 Escherichia coli strain HNC02 plasmid pHNHNC02, complete sequence 16437-16467 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MF168402 Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence 17155-17185 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MG197496 Escherichia coli strain AHC33 plasmid pHNAH33, complete sequence 10027-10057 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MG197498 Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence 78223-78253 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MG197503 Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence 81125-81155 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MG197495 Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence 81125-81155 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MG197499 Escherichia coli strain HZMPC32 plasmid pHNMPC32, complete sequence 14342-14372 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MF156695 Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence 120251-120281 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MF168405 Klebsiella pneumoniae strain 64917 plasmid p64917-KPC, complete sequence 17156-17186 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MG014720 Escherichia coli strain A74 plasmid pA74T, complete sequence 170236-170266 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MF168406 Klebsiella pneumoniae strain 283747 plasmid p283747-KPC, complete sequence 16975-17005 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MG825381 Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence 68319-68349 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 15375-15405 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KY748188 Escherichia coli strain EC006 plasmid pEC006, complete sequence 11152-11182 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MG764548 Escherichia coli strain 11011 plasmid p11011-fosA, complete sequence 37058-37088 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_KY748190 Escherichia coli strain EC008 plasmid pEC008, complete sequence 28290-28320 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MG197490 Escherichia coli strain FKD271 plasmid pHNFKD271, complete sequence 43255-43285 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MG197502 Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence 81125-81155 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MF344574 Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence 21716-21746 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MG515250 Escherichia coli strain 16-50 plasmid pNDM-EC16-50, complete sequence 92824-92854 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MG591701 Escherichia coli strain EC36 plasmid pEC36-2, complete sequence 71535-71565 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 LN897474 Klebsiella pneumoniae p397Kp plasmid, complete sequence 16437-16467 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 LN897475 Klebsiella pneumoniae p477Kp plasmid, complete sequence 14342-14372 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP018455 Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence 157162-157192 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP030132 Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence 50118-50148 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MN823991 Escherichia coli strain 140801063 plasmid p801063-FII, complete sequence 28986-29016 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MT109193 Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence 64021-64051 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP015725 Salmonella enterica strain C629 plasmid pC629, complete sequence 166945-166975 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_LC506716 Klebsiella pneumoniae strain JUNP053 plasmid pJUNP53, complete sequence 9464-9494 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_LC506719 Klebsiella pneumoniae strain JUNP254 plasmid pJUNP254, complete sequence 6562-6592 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_LC506717 Klebsiella pneumoniae strain JUNP054 plasmid pJUNP054, complete sequence 19853-19883 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_LC506718 Klebsiella pneumoniae strain JUNP055 plasmid pJUNP055, complete sequence 19853-19883 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_LC506720 Klebsiella pneumoniae strain JUNP268 plasmid pJUNP268, complete sequence 19853-19883 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 98419-98449 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_MF150118 Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence 1210-1240 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MF554641 uncultured bacterium clone AA-104 plasmid pFEMG, complete sequence 98066-98096 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP025463 Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence 109965-109995 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP027200 Escherichia coli strain WCHEC025943 plasmid p2_025943, complete sequence 12016-12046 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP031720 Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence 80133-80163 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MT090958 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence 16597-16627 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MT108205 Klebsiella pneumoniae strain 71221 plasmid p71221-KPC, complete sequence 35560-35590 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MT108206 Klebsiella pneumoniae strain A1743 plasmid pA1743-KPC, complete sequence 9375-9405 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 MT108208 Klebsiella pneumoniae strain BJ20 plasmid pBJ20-KPC, complete sequence 61422-61452 8 0.742
AYQC01000019_1 1.7|321307|31|AYQC01000019|CRT 321307-321337 31 NZ_CP040535 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence 83724-83754 8 0.742
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP041930 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence 39193-39226 10 0.706
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP027038 Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence 130336-130369 10 0.706
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP027055 Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2 130340-130373 10 0.706
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP031802 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence 44536-44569 10 0.706
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP027043 Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence 181500-181533 10 0.706
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP043383 Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence 21370-21403 10 0.706
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP041930 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence 39193-39226 10 0.706
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP027038 Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence 130336-130369 10 0.706
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP027055 Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2 130340-130373 10 0.706
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP031802 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence 44536-44569 10 0.706
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP027043 Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence 181500-181533 10 0.706
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP043383 Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence 21370-21403 10 0.706
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP025949 Escherichia coli strain SCEC020023 plasmid pCTXM55_020023, complete sequence 11304-11337 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KX928752 Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence 18106-18139 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP025626 Escherichia coli strain SCEC020007 plasmid pNDM5_020007, complete sequence 88968-89001 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP028541 Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KT282968 Escherichia coli strain EC012 plasmid pEC012, complete sequence 32448-32481 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KT879914 Escherichia coli strain HNEC55 plasmid pHNEC55, complete sequence 12003-12036 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KP893385 Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence 83742-83775 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KT185451 Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence 16688-16721 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KT725788 Klebsiella pneumoniae strain ST147 plasmid pCC1410-1, complete sequence 81736-81769 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KT725789 Klebsiella pneumoniae strain ST147 plasmid pCC1409-1, complete sequence 76476-76509 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KR653209 Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence 112533-112566 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KR259134 Enterobacter cloacae strain ECL3786 plasmid pECL3786, complete sequence 964-997 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KT002541 Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence 4924-4957 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KR259130 Escherichia coli strain EC3157 plasmid pEC3157, complete sequence 2580-2613 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KR078259 Escherichia coli strain YD472 plasmid pYHCC, complete sequence 15778-15811 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KR259131 Escherichia coli strain EC3587 plasmid pEC3587, complete sequence 2827-2860 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP048368 Escherichia coli strain 163 plasmid pC-F-164_A-OXA140, complete sequence 28520-28553 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_AP023191 Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence 149393-149426 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP040124 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence 50934-50967 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NC_020278 Escherichia coli strain 3A11 plasmid pHN3A11, complete sequence 12811-12844 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP042601 Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence 47154-47187 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP026131 Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence 139028-139061 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP045264 Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP049351 Escherichia coli strain 3R plasmid p3R-3, complete sequence 32480-32513 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 KY130431 Klebsiella pneumoniae plasmid pABC143C-NDM, complete sequence 6928-6961 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MK878892 Escherichia coli strain J53 plasmid pMG333, complete sequence 119032-119065 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NC_025106 Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence 85665-85698 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP033962 Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence 49169-49202 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP020510 Escherichia coli strain 165 plasmid unnamed1, complete sequence 21950-21983 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KJ020575 Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence 35204-35237 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP033956 Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP025470 Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence 86452-86485 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 142607-142640 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MN007141 Escherichia coli strain 91 plasmid p91_NDM5, complete sequence 30868-30901 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP036301 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence 20073-20106 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MT066418 Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence 51668-51701 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP054942 Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence 74708-74741 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP025952 Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence 120455-120488 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP020515 Escherichia coli strain 219 plasmid unnamed, complete sequence 141419-141452 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP019260 Escherichia coli strain 13C1065T plasmid p13C1065T-1, complete sequence 150364-150397 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP036372 Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MK312244 Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence 16309-16342 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MK312245 Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence 16560-16593 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 16705-16738 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 16802-16835 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MK312248 Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence 16686-16719 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MK312249 Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence 16579-16612 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MN061455 Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence 43367-43400 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MN641485 Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence 38081-38114 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MK312241 Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence 16789-16822 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MK312242 Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence 16545-16578 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 CP052444 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence 38732-38765 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP028796 Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP041375 Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP034324 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence 131890-131923 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP040547 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence 87695-87728 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP032242 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence 11456-11489 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP039820 Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP034254 Escherichia coli strain IVRI Kol CP4 plasmid p1ESCUMpO83_CORR 68839-68872 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 KY463220 Escherichia coli plasmid pNDM5-IBAC, complete sequence 80205-80238 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP044259 Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP024836 Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_2, complete sequence 55946-55979 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP026201 Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence 45012-45045 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP039810 Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence 18912-18945 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP034761 Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence 54622-54655 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 CP038003 Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence 73757-73790 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP028996 Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence 12485-12518 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP033404 Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence 19245-19278 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP040034 Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence 43114-43147 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_AP018147 Escherichia coli strain M217 isolate M217 plasmid pM217_FII, complete sequence 15200-15233 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP033159 Escherichia coli strain CM IVRI KOL-1 plasmid p1ESCUMpO83_CORR 38019-38052 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP048372 Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence 88290-88323 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP041182 Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food plasmid p13520, complete sequence 216545-216578 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NC_019095 Escherichia coli plasmid pXZ, complete sequence 16325-16358 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP040807 Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence 7212-7245 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP046117 Enterobacter cloacae strain CBG15936 plasmid pTEM-CBG, complete sequence 13938-13971 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP017086 Proteus mirabilis strain T18 plasmid pT18, complete sequence 50563-50596 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP036180 Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence 49578-49611 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP036306 Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence 73758-73791 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP041180 Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence 222973-223006 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 CP028790 Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP024840 Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_2, complete sequence 76645-76678 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP022157 Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence 20384-20417 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP047194 Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence 114560-114593 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP032166 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence 18612-18645 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP023895 Escherichia coli strain FDAARGOS_433 plasmid unnamed2, complete sequence 43755-43788 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP025458 Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence 71460-71493 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP034417 Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MF918372 Klebsiella pneumoniae plasmid p1512-KPC, complete sequence 15059-15092 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP050367 Klebsiella pneumoniae strain 47733 plasmid p47733_NDM_5, complete sequence 56608-56641 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NC_019073 Escherichia coli plasmid pHN7A8, complete sequence 16434-16467 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP029381 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP017084 Proteus mirabilis strain T21 plasmid pT212, complete sequence 164446-164479 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP026141 Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence 40067-40100 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP040029 Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence 40241-40274 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP031122 Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence 21713-21746 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP047407 Escherichia coli strain MS6193 plasmid pMS6193B, complete sequence 74708-74741 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP040541 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP026584 Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence 19245-19278 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP047161 Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence 33177-33210 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 170662-170695 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MN822125 Escherichia coli strain 14E509 plasmid p14E509-2FII, complete sequence 741-774 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MN865122 Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence 69706-69739 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MN842292 Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence 1101-1134 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 105114-105147 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MN842295 Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence 85645-85678 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MN823988 Escherichia coli strain 14406 plasmid p14406-FII, complete sequence 125088-125121 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 32943-32976 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MF353156 Escherichia coli plasmid pLZ135-NDM, complete sequence 11138-11171 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP012197 Escherichia coli strain ECwhn14 plasmid pECwhn14, complete sequence 80956-80989 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 AP023220 Escherichia coli M505 plasmid pM505-NDM5 DNA, complete genome 42745-42778 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 AP023236 Escherichia coli YJ6 plasmid pYJ6-NDM5 DNA, complete genome 16469-16502 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP027067 Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP026579 Escherichia coli strain WCHEC005237 plasmid pRmtB1_005237, complete sequence 4538-4571 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP034125 Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence 9655-9688 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MN419308 Klebsiella pneumoniae strain 12478 plasmid p12478-rmtB, complete sequence 17154-17187 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_AP023198 Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence 149393-149426 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP050735 Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-1, complete sequence 39703-39736 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP054782 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NC_016839 Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence 30760-30793 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP054764 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP038455 Escherichia coli strain EC-129 plasmid pEC129_2, complete sequence 11414-11447 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 CP028547 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid pKPC2_020143, complete sequence 10975-11008 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP043936 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-4, complete sequence 41790-41823 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_AP018833 Escherichia coli strain M309 plasmid pM309-NDM5, complete sequence 34558-34591 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP054728 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NC_010558 Escherichia coli plasmid pIP1206, complete sequence 116464-116497 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP050770 Salmonella enterica subsp. enterica serovar Indiana strain SI108 plasmid pSI108-1, complete sequence 58142-58175 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP054722 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_AP018137 Escherichia coli strain M105 isolate M105 plasmid pM105_mF, complete sequence 14033-14066 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_AP018136 Escherichia coli strain M105 isolate M105 plasmid pM105_FII, complete sequence 16192-16225 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_AP018138 Escherichia coli strain M107 isolate M107 plasmid pM107_FII, complete sequence 16215-16248 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_AP018144 Escherichia coli strain M214 isolate M214 plasmid pM214_FII, complete sequence 16215-16248 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_AP018139 Escherichia coli strain M109 isolate M109 plasmid pM109_FII, complete sequence 25157-25190 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP023942 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2 144655-144688 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP026589 Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence 17154-17187 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP027695 Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence 83532-83565 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP041439 Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence 102072-102105 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MK878893 Escherichia coli strain J53 plasmid pMG335, complete sequence 58471-58504 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MK433206 Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence 64317-64350 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MN702385 Escherichia coli strain LWY24J plasmid pLWY24J-3, complete sequence 6658-6691 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP045839 Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence 30915-30948 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MN262643 Escherichia coli strain EC009 plasmid pEC009.2, complete sequence 18756-18789 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP053082 Escherichia coli strain HB37 plasmid pHB37-2, complete sequence 9484-9517 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MH316135 Salmonella enterica subsp. enterica serovar Indiana strain GDD25-16 plasmid pGDD25-16, complete sequence 17170-17203 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MH316136 Salmonella enterica subsp. enterica serovar Indiana strain GDD25-21 plasmid pGDD25-21, complete sequence 17170-17203 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MH255829 Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-CTX-TEM, complete sequence 36846-36879 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MH316133 Salmonella enterica subsp. enterica serovar Indiana strain GDD25-3 plasmid pGDD25-3, complete sequence 15449-15482 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MH316134 Salmonella enterica subsp. enterica serovar Indiana strain GDD25-5 plasmid pGDD25-5, complete sequence 12084-12117 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MH213345 Escherichia coli strain EC1188 plasmid pEC1188-NDM16, complete sequence 10996-11029 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MH917284 Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence 47741-47774 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KY748189 Escherichia coli strain EC007 plasmid pEC007, complete sequence 11149-11182 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KY865323 Escherichia coli strain SY286M plasmid pECM13, complete sequence 16097-16130 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MH329656 Escherichia coli strain 92944 plasmid p92944-CTXM, complete sequence 8063-8096 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MH263653 Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence 15059-15092 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MK079574 Escherichia coli strain TS62CTX plasmid pHNTS62, complete sequence 49602-49635 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MH161192 Klebsiella pneumoniae strain SCKLB138 plasmid pSCKLB138-1, complete sequence 90123-90156 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MK036888 Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence 17154-17187 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MK036886 Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence 25404-25437 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MN197360 Escherichia coli strain 5P plasmid pVSI_NDM_5, complete sequence 115968-116001 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MN218686 Escherichia coli strain 5M plasmid pISV_IncFII_NDM-5, complete sequence 142955-142988 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MF133495 Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence 15368-15401 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MF168403 Klebsiella pneumoniae strain 12139 plasmid p12139-KPC, complete sequence 17154-17187 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MG197488 Escherichia coli strain 04NHB3 plasmid pHN04NHB3, complete sequence 43252-43285 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MF168404 Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence 20685-20718 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MF156713 Escherichia coli strain 06028078 plasmid p28078-NDM, complete sequence 94753-94786 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MG197497 Escherichia coli strain HNC02 plasmid pHNHNC02, complete sequence 16434-16467 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MF168402 Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence 17152-17185 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MG197496 Escherichia coli strain AHC33 plasmid pHNAH33, complete sequence 10024-10057 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MG197498 Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence 78220-78253 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MG197503 Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence 81122-81155 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MG197495 Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence 81122-81155 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MG197499 Escherichia coli strain HZMPC32 plasmid pHNMPC32, complete sequence 14339-14372 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MF156695 Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence 120248-120281 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MF168405 Klebsiella pneumoniae strain 64917 plasmid p64917-KPC, complete sequence 17153-17186 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MG014720 Escherichia coli strain A74 plasmid pA74T, complete sequence 170236-170269 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MF168406 Klebsiella pneumoniae strain 283747 plasmid p283747-KPC, complete sequence 16972-17005 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MG825381 Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence 68319-68352 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 15372-15405 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KY748188 Escherichia coli strain EC006 plasmid pEC006, complete sequence 11149-11182 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MG764548 Escherichia coli strain 11011 plasmid p11011-fosA, complete sequence 37055-37088 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_KY748190 Escherichia coli strain EC008 plasmid pEC008, complete sequence 28287-28320 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MG197490 Escherichia coli strain FKD271 plasmid pHNFKD271, complete sequence 43252-43285 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MG197502 Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence 81122-81155 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MF344574 Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence 21713-21746 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MG515250 Escherichia coli strain 16-50 plasmid pNDM-EC16-50, complete sequence 92821-92854 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MG591701 Escherichia coli strain EC36 plasmid pEC36-2, complete sequence 71535-71568 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 LN897474 Klebsiella pneumoniae p397Kp plasmid, complete sequence 16434-16467 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 LN897475 Klebsiella pneumoniae p477Kp plasmid, complete sequence 14339-14372 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP018455 Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence 157162-157195 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP030132 Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence 50118-50151 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MN823991 Escherichia coli strain 140801063 plasmid p801063-FII, complete sequence 28983-29016 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MT109193 Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence 64021-64054 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP015725 Salmonella enterica strain C629 plasmid pC629, complete sequence 166942-166975 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_LC506716 Klebsiella pneumoniae strain JUNP053 plasmid pJUNP53, complete sequence 9461-9494 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_LC506719 Klebsiella pneumoniae strain JUNP254 plasmid pJUNP254, complete sequence 6559-6592 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_LC506717 Klebsiella pneumoniae strain JUNP054 plasmid pJUNP054, complete sequence 19850-19883 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_LC506718 Klebsiella pneumoniae strain JUNP055 plasmid pJUNP055, complete sequence 19850-19883 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_LC506720 Klebsiella pneumoniae strain JUNP268 plasmid pJUNP268, complete sequence 19850-19883 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 98416-98449 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_MF150118 Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence 1207-1240 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MF554641 uncultured bacterium clone AA-104 plasmid pFEMG, complete sequence 98063-98096 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP025463 Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence 109965-109998 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP027200 Escherichia coli strain WCHEC025943 plasmid p2_025943, complete sequence 12016-12049 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP031720 Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence 80133-80166 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MT090958 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MT108205 Klebsiella pneumoniae strain 71221 plasmid p71221-KPC, complete sequence 35557-35590 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MT108206 Klebsiella pneumoniae strain A1743 plasmid pA1743-KPC, complete sequence 9375-9408 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 MT108208 Klebsiella pneumoniae strain BJ20 plasmid pBJ20-KPC, complete sequence 61419-61452 11 0.676
AYQC01000019_1 1.3|321304|34|AYQC01000019|CRISPRCasFinder 321304-321337 34 NZ_CP040535 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence 83721-83754 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP025949 Escherichia coli strain SCEC020023 plasmid pCTXM55_020023, complete sequence 11304-11337 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KX928752 Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence 18106-18139 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP025626 Escherichia coli strain SCEC020007 plasmid pNDM5_020007, complete sequence 88968-89001 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP028541 Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KT282968 Escherichia coli strain EC012 plasmid pEC012, complete sequence 32448-32481 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KT879914 Escherichia coli strain HNEC55 plasmid pHNEC55, complete sequence 12003-12036 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KP893385 Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence 83742-83775 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KT185451 Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence 16688-16721 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KT725788 Klebsiella pneumoniae strain ST147 plasmid pCC1410-1, complete sequence 81736-81769 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KT725789 Klebsiella pneumoniae strain ST147 plasmid pCC1409-1, complete sequence 76476-76509 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KR653209 Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence 112533-112566 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KR259134 Enterobacter cloacae strain ECL3786 plasmid pECL3786, complete sequence 964-997 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KT002541 Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence 4924-4957 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KR259130 Escherichia coli strain EC3157 plasmid pEC3157, complete sequence 2580-2613 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KR078259 Escherichia coli strain YD472 plasmid pYHCC, complete sequence 15778-15811 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KR259131 Escherichia coli strain EC3587 plasmid pEC3587, complete sequence 2827-2860 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP048368 Escherichia coli strain 163 plasmid pC-F-164_A-OXA140, complete sequence 28520-28553 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_AP023191 Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence 149393-149426 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP040124 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence 50934-50967 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NC_020278 Escherichia coli strain 3A11 plasmid pHN3A11, complete sequence 12811-12844 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP042601 Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence 47154-47187 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP026131 Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence 139028-139061 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP045264 Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP049351 Escherichia coli strain 3R plasmid p3R-3, complete sequence 32480-32513 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 KY130431 Klebsiella pneumoniae plasmid pABC143C-NDM, complete sequence 6928-6961 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MK878892 Escherichia coli strain J53 plasmid pMG333, complete sequence 119032-119065 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NC_025106 Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence 85665-85698 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP033962 Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence 49169-49202 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP020510 Escherichia coli strain 165 plasmid unnamed1, complete sequence 21950-21983 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KJ020575 Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence 35204-35237 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP033956 Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP025470 Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence 86452-86485 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 142607-142640 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MN007141 Escherichia coli strain 91 plasmid p91_NDM5, complete sequence 30868-30901 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP036301 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence 20073-20106 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MT066418 Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence 51668-51701 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP054942 Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence 74708-74741 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP025952 Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence 120455-120488 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP020515 Escherichia coli strain 219 plasmid unnamed, complete sequence 141419-141452 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP019260 Escherichia coli strain 13C1065T plasmid p13C1065T-1, complete sequence 150364-150397 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP036372 Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MK312244 Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence 16309-16342 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MK312245 Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence 16560-16593 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 16705-16738 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 16802-16835 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MK312248 Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence 16686-16719 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MK312249 Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence 16579-16612 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MN061455 Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence 43367-43400 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MN641485 Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence 38081-38114 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MK312241 Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence 16789-16822 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MK312242 Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence 16545-16578 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 CP052444 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence 38732-38765 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP028796 Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP041375 Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP034324 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence 131890-131923 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP040547 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence 87695-87728 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP032242 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence 11456-11489 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP039820 Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP034254 Escherichia coli strain IVRI Kol CP4 plasmid p1ESCUMpO83_CORR 68839-68872 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 KY463220 Escherichia coli plasmid pNDM5-IBAC, complete sequence 80205-80238 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP044259 Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP024836 Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_2, complete sequence 55946-55979 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP026201 Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence 45012-45045 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP039810 Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence 18912-18945 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP034761 Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence 54622-54655 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 CP038003 Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence 73757-73790 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP028996 Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence 12485-12518 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP033404 Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence 19245-19278 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP040034 Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence 43114-43147 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_AP018147 Escherichia coli strain M217 isolate M217 plasmid pM217_FII, complete sequence 15200-15233 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP033159 Escherichia coli strain CM IVRI KOL-1 plasmid p1ESCUMpO83_CORR 38019-38052 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP048372 Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence 88290-88323 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP041182 Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food plasmid p13520, complete sequence 216545-216578 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NC_019095 Escherichia coli plasmid pXZ, complete sequence 16325-16358 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP040807 Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence 7212-7245 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP046117 Enterobacter cloacae strain CBG15936 plasmid pTEM-CBG, complete sequence 13938-13971 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP017086 Proteus mirabilis strain T18 plasmid pT18, complete sequence 50563-50596 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP036180 Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence 49578-49611 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP036306 Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence 73758-73791 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP041180 Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence 222973-223006 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 CP028790 Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP024840 Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_2, complete sequence 76645-76678 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP022157 Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence 20384-20417 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP047194 Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence 114560-114593 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP032166 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence 18612-18645 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP023895 Escherichia coli strain FDAARGOS_433 plasmid unnamed2, complete sequence 43755-43788 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP025458 Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence 71460-71493 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP034417 Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MF918372 Klebsiella pneumoniae plasmid p1512-KPC, complete sequence 15059-15092 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP050367 Klebsiella pneumoniae strain 47733 plasmid p47733_NDM_5, complete sequence 56608-56641 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NC_019073 Escherichia coli plasmid pHN7A8, complete sequence 16434-16467 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP029381 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP017084 Proteus mirabilis strain T21 plasmid pT212, complete sequence 164446-164479 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP026141 Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence 40067-40100 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP040029 Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence 40241-40274 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP031122 Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence 21713-21746 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP047407 Escherichia coli strain MS6193 plasmid pMS6193B, complete sequence 74708-74741 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP040541 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP026584 Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence 19245-19278 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP047161 Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence 33177-33210 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 170662-170695 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MN822125 Escherichia coli strain 14E509 plasmid p14E509-2FII, complete sequence 741-774 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MN865122 Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence 69706-69739 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MN842292 Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence 1101-1134 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 105114-105147 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MN842295 Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence 85645-85678 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MN823988 Escherichia coli strain 14406 plasmid p14406-FII, complete sequence 125088-125121 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 32943-32976 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MF353156 Escherichia coli plasmid pLZ135-NDM, complete sequence 11138-11171 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP012197 Escherichia coli strain ECwhn14 plasmid pECwhn14, complete sequence 80956-80989 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 AP023220 Escherichia coli M505 plasmid pM505-NDM5 DNA, complete genome 42745-42778 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 AP023236 Escherichia coli YJ6 plasmid pYJ6-NDM5 DNA, complete genome 16469-16502 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP027067 Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP026579 Escherichia coli strain WCHEC005237 plasmid pRmtB1_005237, complete sequence 4538-4571 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP034125 Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence 9655-9688 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MN419308 Klebsiella pneumoniae strain 12478 plasmid p12478-rmtB, complete sequence 17154-17187 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_AP023198 Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence 149393-149426 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP050735 Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-1, complete sequence 39703-39736 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP054782 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NC_016839 Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence 30760-30793 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP054764 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP038455 Escherichia coli strain EC-129 plasmid pEC129_2, complete sequence 11414-11447 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 CP028547 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid pKPC2_020143, complete sequence 10975-11008 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP043936 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-4, complete sequence 41790-41823 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_AP018833 Escherichia coli strain M309 plasmid pM309-NDM5, complete sequence 34558-34591 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP054728 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NC_010558 Escherichia coli plasmid pIP1206, complete sequence 116464-116497 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP050770 Salmonella enterica subsp. enterica serovar Indiana strain SI108 plasmid pSI108-1, complete sequence 58142-58175 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP054722 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence 14499-14532 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_AP018137 Escherichia coli strain M105 isolate M105 plasmid pM105_mF, complete sequence 14033-14066 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_AP018136 Escherichia coli strain M105 isolate M105 plasmid pM105_FII, complete sequence 16192-16225 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_AP018138 Escherichia coli strain M107 isolate M107 plasmid pM107_FII, complete sequence 16215-16248 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_AP018144 Escherichia coli strain M214 isolate M214 plasmid pM214_FII, complete sequence 16215-16248 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_AP018139 Escherichia coli strain M109 isolate M109 plasmid pM109_FII, complete sequence 25157-25190 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP023942 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2 144655-144688 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP026589 Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence 17154-17187 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP027695 Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence 83532-83565 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP041439 Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence 102072-102105 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MK878893 Escherichia coli strain J53 plasmid pMG335, complete sequence 58471-58504 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MK433206 Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence 64317-64350 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MN702385 Escherichia coli strain LWY24J plasmid pLWY24J-3, complete sequence 6658-6691 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP045839 Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence 30915-30948 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MN262643 Escherichia coli strain EC009 plasmid pEC009.2, complete sequence 18756-18789 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP053082 Escherichia coli strain HB37 plasmid pHB37-2, complete sequence 9484-9517 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MH316135 Salmonella enterica subsp. enterica serovar Indiana strain GDD25-16 plasmid pGDD25-16, complete sequence 17170-17203 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MH316136 Salmonella enterica subsp. enterica serovar Indiana strain GDD25-21 plasmid pGDD25-21, complete sequence 17170-17203 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MH255829 Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-CTX-TEM, complete sequence 36846-36879 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MH316133 Salmonella enterica subsp. enterica serovar Indiana strain GDD25-3 plasmid pGDD25-3, complete sequence 15449-15482 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MH316134 Salmonella enterica subsp. enterica serovar Indiana strain GDD25-5 plasmid pGDD25-5, complete sequence 12084-12117 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MH213345 Escherichia coli strain EC1188 plasmid pEC1188-NDM16, complete sequence 10996-11029 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MH917284 Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence 47741-47774 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KY748189 Escherichia coli strain EC007 plasmid pEC007, complete sequence 11149-11182 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KY865323 Escherichia coli strain SY286M plasmid pECM13, complete sequence 16097-16130 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MH329656 Escherichia coli strain 92944 plasmid p92944-CTXM, complete sequence 8063-8096 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MH263653 Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence 15059-15092 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MK079574 Escherichia coli strain TS62CTX plasmid pHNTS62, complete sequence 49602-49635 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MH161192 Klebsiella pneumoniae strain SCKLB138 plasmid pSCKLB138-1, complete sequence 90123-90156 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MK036888 Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence 17154-17187 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MK036886 Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence 25404-25437 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MN197360 Escherichia coli strain 5P plasmid pVSI_NDM_5, complete sequence 115968-116001 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MN218686 Escherichia coli strain 5M plasmid pISV_IncFII_NDM-5, complete sequence 142955-142988 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MF133495 Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence 15368-15401 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MF168403 Klebsiella pneumoniae strain 12139 plasmid p12139-KPC, complete sequence 17154-17187 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MG197488 Escherichia coli strain 04NHB3 plasmid pHN04NHB3, complete sequence 43252-43285 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MF168404 Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence 20685-20718 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MF156713 Escherichia coli strain 06028078 plasmid p28078-NDM, complete sequence 94753-94786 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MG197497 Escherichia coli strain HNC02 plasmid pHNHNC02, complete sequence 16434-16467 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MF168402 Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence 17152-17185 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MG197496 Escherichia coli strain AHC33 plasmid pHNAH33, complete sequence 10024-10057 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MG197498 Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence 78220-78253 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MG197503 Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence 81122-81155 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MG197495 Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence 81122-81155 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MG197499 Escherichia coli strain HZMPC32 plasmid pHNMPC32, complete sequence 14339-14372 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MF156695 Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence 120248-120281 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MF168405 Klebsiella pneumoniae strain 64917 plasmid p64917-KPC, complete sequence 17153-17186 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MG014720 Escherichia coli strain A74 plasmid pA74T, complete sequence 170236-170269 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MF168406 Klebsiella pneumoniae strain 283747 plasmid p283747-KPC, complete sequence 16972-17005 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MG825381 Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence 68319-68352 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 15372-15405 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KY748188 Escherichia coli strain EC006 plasmid pEC006, complete sequence 11149-11182 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MG764548 Escherichia coli strain 11011 plasmid p11011-fosA, complete sequence 37055-37088 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_KY748190 Escherichia coli strain EC008 plasmid pEC008, complete sequence 28287-28320 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MG197490 Escherichia coli strain FKD271 plasmid pHNFKD271, complete sequence 43252-43285 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MG197502 Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence 81122-81155 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MF344574 Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence 21713-21746 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MG515250 Escherichia coli strain 16-50 plasmid pNDM-EC16-50, complete sequence 92821-92854 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MG591701 Escherichia coli strain EC36 plasmid pEC36-2, complete sequence 71535-71568 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 LN897474 Klebsiella pneumoniae p397Kp plasmid, complete sequence 16434-16467 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 LN897475 Klebsiella pneumoniae p477Kp plasmid, complete sequence 14339-14372 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP018455 Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence 157162-157195 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP030132 Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence 50118-50151 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MN823991 Escherichia coli strain 140801063 plasmid p801063-FII, complete sequence 28983-29016 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MT109193 Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence 64021-64054 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP015725 Salmonella enterica strain C629 plasmid pC629, complete sequence 166942-166975 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_LC506716 Klebsiella pneumoniae strain JUNP053 plasmid pJUNP53, complete sequence 9461-9494 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_LC506719 Klebsiella pneumoniae strain JUNP254 plasmid pJUNP254, complete sequence 6559-6592 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_LC506717 Klebsiella pneumoniae strain JUNP054 plasmid pJUNP054, complete sequence 19850-19883 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_LC506718 Klebsiella pneumoniae strain JUNP055 plasmid pJUNP055, complete sequence 19850-19883 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_LC506720 Klebsiella pneumoniae strain JUNP268 plasmid pJUNP268, complete sequence 19850-19883 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 98416-98449 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_MF150118 Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence 1207-1240 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MF554641 uncultured bacterium clone AA-104 plasmid pFEMG, complete sequence 98063-98096 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP025463 Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence 109965-109998 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP027200 Escherichia coli strain WCHEC025943 plasmid p2_025943, complete sequence 12016-12049 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP031720 Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence 80133-80166 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MT090958 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence 16594-16627 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MT108205 Klebsiella pneumoniae strain 71221 plasmid p71221-KPC, complete sequence 35557-35590 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MT108206 Klebsiella pneumoniae strain A1743 plasmid pA1743-KPC, complete sequence 9375-9408 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 MT108208 Klebsiella pneumoniae strain BJ20 plasmid pBJ20-KPC, complete sequence 61419-61452 11 0.676
AYQC01000019_1 1.9|321307|34|AYQC01000019|PILER-CR 321307-321340 34 NZ_CP040535 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence 83721-83754 11 0.676

1. spacer 1.6|321237|33|AYQC01000019|CRT,PILER-CR matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 6, identity: 0.818

tctcccagcataccaaaccgctggcgaccatca	CRISPR spacer
cgtcccagcaaaccaacccgctggcgaccaacg	Protospacer
. ******** ***** ************* *.

2. spacer 1.6|321237|33|AYQC01000019|CRT,PILER-CR matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 6, identity: 0.818

tctcccagcataccaaaccgctggcgaccatca	CRISPR spacer
cgtcccagcaaaccaacccgctggcgaccaacg	Protospacer
. ******** ***** ************* *.

3. spacer 1.6|321237|33|AYQC01000019|CRT,PILER-CR matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 6, identity: 0.818

tctcccagcataccaaaccgctggcgaccatca	CRISPR spacer
cgtcccagcaaaccaacccgctggcgaccaacg	Protospacer
. ******** ***** ************* *.

4. spacer 1.6|321237|33|AYQC01000019|CRT,PILER-CR matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 6, identity: 0.818

tctcccagcataccaaaccgctggcgaccatca	CRISPR spacer
cgtcccagcaaaccaacccgctggcgaccaacg	Protospacer
. ******** ***** ************* *.

5. spacer 1.2|321234|36|AYQC01000019|CRISPRCasFinder matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 7, identity: 0.806

ggctctcccagcataccaaaccgctggcgaccatca	CRISPR spacer
ggacgtcccagcaaaccaacccgctggcgaccaacg	Protospacer
** . ******** ***** ************* *.

6. spacer 1.2|321234|36|AYQC01000019|CRISPRCasFinder matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 7, identity: 0.806

ggctctcccagcataccaaaccgctggcgaccatca	CRISPR spacer
ggacgtcccagcaaaccaacccgctggcgaccaacg	Protospacer
** . ******** ***** ************* *.

7. spacer 1.2|321234|36|AYQC01000019|CRISPRCasFinder matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 7, identity: 0.806

ggctctcccagcataccaaaccgctggcgaccatca	CRISPR spacer
ggacgtcccagcaaaccaacccgctggcgaccaacg	Protospacer
** . ******** ***** ************* *.

8. spacer 1.2|321234|36|AYQC01000019|CRISPRCasFinder matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 7, identity: 0.806

ggctctcccagcataccaaaccgctggcgaccatca	CRISPR spacer
ggacgtcccagcaaaccaacccgctggcgaccaacg	Protospacer
** . ******** ***** ************* *.

9. spacer 1.6|321237|33|AYQC01000019|CRT,PILER-CR matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 7, identity: 0.788

tctcccagcataccaaaccgctggcgaccatca	CRISPR spacer
cgtcccagcaaaccaacccgctggcgaccaatg	Protospacer
. ******** ***** ************* ..

10. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP021084 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence) position: , mismatch: 7, identity: 0.774

acaggagagaccgatgaaaatcaacggcttc----	CRISPR spacer
ccaggagagaccgatgaaaaaca----cctcgtgg	Protospacer
 ******************* **    *.**    

11. spacer 1.2|321234|36|AYQC01000019|CRISPRCasFinder matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.778

ggctctcccagcataccaaaccgctggcgaccatca	CRISPR spacer
ggacgtcccagcaaaccaacccgctggcgaccaatg	Protospacer
** . ******** ***** ************* ..

12. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP025949 (Escherichia coli strain SCEC020023 plasmid pCTXM55_020023, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

13. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KX928752 (Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

14. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP025626 (Escherichia coli strain SCEC020007 plasmid pNDM5_020007, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

15. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

16. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KT282968 (Escherichia coli strain EC012 plasmid pEC012, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

17. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KT879914 (Escherichia coli strain HNEC55 plasmid pHNEC55, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

18. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

19. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

20. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KT725788 (Klebsiella pneumoniae strain ST147 plasmid pCC1410-1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

21. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KT725789 (Klebsiella pneumoniae strain ST147 plasmid pCC1409-1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

22. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

23. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KR259134 (Enterobacter cloacae strain ECL3786 plasmid pECL3786, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

24. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

25. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KR259130 (Escherichia coli strain EC3157 plasmid pEC3157, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

26. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KR078259 (Escherichia coli strain YD472 plasmid pYHCC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

27. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KR259131 (Escherichia coli strain EC3587 plasmid pEC3587, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

28. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP048368 (Escherichia coli strain 163 plasmid pC-F-164_A-OXA140, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

29. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

30. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP040124 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

31. spacer 1.7|321307|31|AYQC01000019|CRT matches to NC_020278 (Escherichia coli strain 3A11 plasmid pHN3A11, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

32. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP042601 (Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

33. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

34. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

35. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP049351 (Escherichia coli strain 3R plasmid p3R-3, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

36. spacer 1.7|321307|31|AYQC01000019|CRT matches to KY130431 (Klebsiella pneumoniae plasmid pABC143C-NDM, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

37. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

38. spacer 1.7|321307|31|AYQC01000019|CRT matches to NC_025106 (Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

39. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

40. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

41. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP020510 (Escherichia coli strain 165 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

42. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KJ020575 (Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

43. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

44. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP025470 (Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

45. spacer 1.7|321307|31|AYQC01000019|CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

46. spacer 1.7|321307|31|AYQC01000019|CRT matches to MN007141 (Escherichia coli strain 91 plasmid p91_NDM5, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

47. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP027038 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

48. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

49. spacer 1.7|321307|31|AYQC01000019|CRT matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

50. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP054942 (Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

51. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

52. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP020515 (Escherichia coli strain 219 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

53. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP019260 (Escherichia coli strain 13C1065T plasmid p13C1065T-1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

54. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

55. spacer 1.7|321307|31|AYQC01000019|CRT matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

56. spacer 1.7|321307|31|AYQC01000019|CRT matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

57. spacer 1.7|321307|31|AYQC01000019|CRT matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

58. spacer 1.7|321307|31|AYQC01000019|CRT matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

59. spacer 1.7|321307|31|AYQC01000019|CRT matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

60. spacer 1.7|321307|31|AYQC01000019|CRT matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

61. spacer 1.7|321307|31|AYQC01000019|CRT matches to MN061455 (Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

62. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP027055 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

63. spacer 1.7|321307|31|AYQC01000019|CRT matches to MN641485 (Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

64. spacer 1.7|321307|31|AYQC01000019|CRT matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

65. spacer 1.7|321307|31|AYQC01000019|CRT matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

66. spacer 1.7|321307|31|AYQC01000019|CRT matches to CP052444 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

67. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

68. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

69. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

70. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

71. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

72. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

73. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP034254 (Escherichia coli strain IVRI Kol CP4 plasmid p1ESCUMpO83_CORR) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

74. spacer 1.7|321307|31|AYQC01000019|CRT matches to KY463220 (Escherichia coli plasmid pNDM5-IBAC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

75. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

76. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP024836 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

77. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP026201 (Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

78. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

79. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP031802 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

80. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

81. spacer 1.7|321307|31|AYQC01000019|CRT matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

82. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP028996 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

83. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

84. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP040034 (Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

85. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP027043 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

86. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_AP018147 (Escherichia coli strain M217 isolate M217 plasmid pM217_FII, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

87. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP033159 (Escherichia coli strain CM IVRI KOL-1 plasmid p1ESCUMpO83_CORR) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

88. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP048372 (Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

89. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP041182 (Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food plasmid p13520, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

90. spacer 1.7|321307|31|AYQC01000019|CRT matches to NC_019095 (Escherichia coli plasmid pXZ, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

91. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP040807 (Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

92. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP046117 (Enterobacter cloacae strain CBG15936 plasmid pTEM-CBG, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

93. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP017086 (Proteus mirabilis strain T18 plasmid pT18, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

94. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP036180 (Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

95. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP036306 (Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

96. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP041180 (Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

97. spacer 1.7|321307|31|AYQC01000019|CRT matches to CP028790 (Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

98. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP024840 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

99. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP022157 (Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

100. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

101. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

102. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP023895 (Escherichia coli strain FDAARGOS_433 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

103. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

104. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

105. spacer 1.7|321307|31|AYQC01000019|CRT matches to MF918372 (Klebsiella pneumoniae plasmid p1512-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

106. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP050367 (Klebsiella pneumoniae strain 47733 plasmid p47733_NDM_5, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

107. spacer 1.7|321307|31|AYQC01000019|CRT matches to NC_019073 (Escherichia coli plasmid pHN7A8, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

108. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

109. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP017084 (Proteus mirabilis strain T21 plasmid pT212, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

110. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

111. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP040029 (Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

112. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP031122 (Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

113. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP047407 (Escherichia coli strain MS6193 plasmid pMS6193B, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

114. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

115. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

116. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

117. spacer 1.7|321307|31|AYQC01000019|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

118. spacer 1.7|321307|31|AYQC01000019|CRT matches to MN822125 (Escherichia coli strain 14E509 plasmid p14E509-2FII, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

119. spacer 1.7|321307|31|AYQC01000019|CRT matches to MN865122 (Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

120. spacer 1.7|321307|31|AYQC01000019|CRT matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

121. spacer 1.7|321307|31|AYQC01000019|CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

122. spacer 1.7|321307|31|AYQC01000019|CRT matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

123. spacer 1.7|321307|31|AYQC01000019|CRT matches to MN823988 (Escherichia coli strain 14406 plasmid p14406-FII, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

124. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

125. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

126. spacer 1.7|321307|31|AYQC01000019|CRT matches to MF353156 (Escherichia coli plasmid pLZ135-NDM, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

127. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP012197 (Escherichia coli strain ECwhn14 plasmid pECwhn14, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

128. spacer 1.7|321307|31|AYQC01000019|CRT matches to AP023220 (Escherichia coli M505 plasmid pM505-NDM5 DNA, complete genome) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

129. spacer 1.7|321307|31|AYQC01000019|CRT matches to AP023236 (Escherichia coli YJ6 plasmid pYJ6-NDM5 DNA, complete genome) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

130. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

131. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP026579 (Escherichia coli strain WCHEC005237 plasmid pRmtB1_005237, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

132. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

133. spacer 1.7|321307|31|AYQC01000019|CRT matches to MN419308 (Klebsiella pneumoniae strain 12478 plasmid p12478-rmtB, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

134. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

135. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP050735 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

136. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

137. spacer 1.7|321307|31|AYQC01000019|CRT matches to NC_016839 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

138. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

139. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP038455 (Escherichia coli strain EC-129 plasmid pEC129_2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

140. spacer 1.7|321307|31|AYQC01000019|CRT matches to CP028547 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid pKPC2_020143, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

141. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP043936 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-4, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

142. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_AP018833 (Escherichia coli strain M309 plasmid pM309-NDM5, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

143. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

144. spacer 1.7|321307|31|AYQC01000019|CRT matches to NC_010558 (Escherichia coli plasmid pIP1206, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

145. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP050770 (Salmonella enterica subsp. enterica serovar Indiana strain SI108 plasmid pSI108-1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

146. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

147. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_AP018137 (Escherichia coli strain M105 isolate M105 plasmid pM105_mF, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

148. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_AP018136 (Escherichia coli strain M105 isolate M105 plasmid pM105_FII, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

149. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_AP018138 (Escherichia coli strain M107 isolate M107 plasmid pM107_FII, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

150. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_AP018144 (Escherichia coli strain M214 isolate M214 plasmid pM214_FII, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

151. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_AP018139 (Escherichia coli strain M109 isolate M109 plasmid pM109_FII, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

152. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP023942 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

153. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP026589 (Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

154. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP027695 (Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

155. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

156. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MK878893 (Escherichia coli strain J53 plasmid pMG335, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

157. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

158. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MN702385 (Escherichia coli strain LWY24J plasmid pLWY24J-3, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

159. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

160. spacer 1.7|321307|31|AYQC01000019|CRT matches to MN262643 (Escherichia coli strain EC009 plasmid pEC009.2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

161. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP053082 (Escherichia coli strain HB37 plasmid pHB37-2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

162. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MH316135 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-16 plasmid pGDD25-16, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

163. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MH316136 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-21 plasmid pGDD25-21, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

164. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MH255829 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-CTX-TEM, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

165. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MH316133 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-3 plasmid pGDD25-3, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

166. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MH316134 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-5 plasmid pGDD25-5, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

167. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MH213345 (Escherichia coli strain EC1188 plasmid pEC1188-NDM16, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

168. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MH917284 (Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

169. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KY748189 (Escherichia coli strain EC007 plasmid pEC007, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

170. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KY865323 (Escherichia coli strain SY286M plasmid pECM13, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

171. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MH329656 (Escherichia coli strain 92944 plasmid p92944-CTXM, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

172. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

173. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MK079574 (Escherichia coli strain TS62CTX plasmid pHNTS62, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

174. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MH161192 (Klebsiella pneumoniae strain SCKLB138 plasmid pSCKLB138-1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

175. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

176. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MK036886 (Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

177. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MN197360 (Escherichia coli strain 5P plasmid pVSI_NDM_5, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

178. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MN218686 (Escherichia coli strain 5M plasmid pISV_IncFII_NDM-5, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

179. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

180. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MF168403 (Klebsiella pneumoniae strain 12139 plasmid p12139-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

181. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MG197488 (Escherichia coli strain 04NHB3 plasmid pHN04NHB3, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

182. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

183. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MF156713 (Escherichia coli strain 06028078 plasmid p28078-NDM, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

184. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MG197497 (Escherichia coli strain HNC02 plasmid pHNHNC02, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

185. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

186. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MG197496 (Escherichia coli strain AHC33 plasmid pHNAH33, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

187. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

188. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

189. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

190. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MG197499 (Escherichia coli strain HZMPC32 plasmid pHNMPC32, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

191. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MF156695 (Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

192. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MF168405 (Klebsiella pneumoniae strain 64917 plasmid p64917-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

193. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MG014720 (Escherichia coli strain A74 plasmid pA74T, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

194. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MF168406 (Klebsiella pneumoniae strain 283747 plasmid p283747-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

195. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

196. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

197. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KY748188 (Escherichia coli strain EC006 plasmid pEC006, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

198. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MG764548 (Escherichia coli strain 11011 plasmid p11011-fosA, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

199. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_KY748190 (Escherichia coli strain EC008 plasmid pEC008, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

200. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MG197490 (Escherichia coli strain FKD271 plasmid pHNFKD271, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

201. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

202. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MF344574 (Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

203. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MG515250 (Escherichia coli strain 16-50 plasmid pNDM-EC16-50, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

204. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MG591701 (Escherichia coli strain EC36 plasmid pEC36-2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

205. spacer 1.7|321307|31|AYQC01000019|CRT matches to LN897474 (Klebsiella pneumoniae p397Kp plasmid, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

206. spacer 1.7|321307|31|AYQC01000019|CRT matches to LN897475 (Klebsiella pneumoniae p477Kp plasmid, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

207. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

208. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP030132 (Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

209. spacer 1.7|321307|31|AYQC01000019|CRT matches to MN823991 (Escherichia coli strain 140801063 plasmid p801063-FII, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

210. spacer 1.7|321307|31|AYQC01000019|CRT matches to MT109193 (Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

211. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP015725 (Salmonella enterica strain C629 plasmid pC629, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

212. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_LC506716 (Klebsiella pneumoniae strain JUNP053 plasmid pJUNP53, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

213. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_LC506719 (Klebsiella pneumoniae strain JUNP254 plasmid pJUNP254, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

214. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_LC506717 (Klebsiella pneumoniae strain JUNP054 plasmid pJUNP054, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

215. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_LC506718 (Klebsiella pneumoniae strain JUNP055 plasmid pJUNP055, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

216. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_LC506720 (Klebsiella pneumoniae strain JUNP268 plasmid pJUNP268, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

217. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

218. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_MF150118 (Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

219. spacer 1.7|321307|31|AYQC01000019|CRT matches to MF554641 (uncultured bacterium clone AA-104 plasmid pFEMG, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

220. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP025463 (Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

221. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP027200 (Escherichia coli strain WCHEC025943 plasmid p2_025943, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

222. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

223. spacer 1.7|321307|31|AYQC01000019|CRT matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

224. spacer 1.7|321307|31|AYQC01000019|CRT matches to MT108205 (Klebsiella pneumoniae strain 71221 plasmid p71221-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

225. spacer 1.7|321307|31|AYQC01000019|CRT matches to MT108206 (Klebsiella pneumoniae strain A1743 plasmid pA1743-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

226. spacer 1.7|321307|31|AYQC01000019|CRT matches to MT108208 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

227. spacer 1.7|321307|31|AYQC01000019|CRT matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 8, identity: 0.742

acaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .****** ********* *******.. .*

228. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 10, identity: 0.706

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc	Protospacer
 *. .****** ********* *******.. .*

229. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP027038 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 10, identity: 0.706

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc	Protospacer
 *. .****** ********* *******.. .*

230. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP027055 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2) position: , mismatch: 10, identity: 0.706

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc	Protospacer
 *. .****** ********* *******.. .*

231. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP031802 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc	Protospacer
 *. .****** ********* *******.. .*

232. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP027043 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 10, identity: 0.706

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc	Protospacer
 *. .****** ********* *******.. .*

233. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 10, identity: 0.706

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc	Protospacer
 *. .****** ********* *******.. .*

234. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 10, identity: 0.706

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc	Protospacer
 *. .****** ********* *******.. .*

235. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP027038 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 10, identity: 0.706

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc	Protospacer
 *. .****** ********* *******.. .*

236. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP027055 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2) position: , mismatch: 10, identity: 0.706

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc	Protospacer
 *. .****** ********* *******.. .*

237. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP031802 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc	Protospacer
 *. .****** ********* *******.. .*

238. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP027043 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 10, identity: 0.706

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc	Protospacer
 *. .****** ********* *******.. .*

239. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 10, identity: 0.706

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc	Protospacer
 *. .****** ********* *******.. .*

240. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP025949 (Escherichia coli strain SCEC020023 plasmid pCTXM55_020023, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

241. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KX928752 (Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

242. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP025626 (Escherichia coli strain SCEC020007 plasmid pNDM5_020007, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

243. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

244. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KT282968 (Escherichia coli strain EC012 plasmid pEC012, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

245. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KT879914 (Escherichia coli strain HNEC55 plasmid pHNEC55, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

246. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

247. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

248. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KT725788 (Klebsiella pneumoniae strain ST147 plasmid pCC1410-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

249. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KT725789 (Klebsiella pneumoniae strain ST147 plasmid pCC1409-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

250. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

251. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KR259134 (Enterobacter cloacae strain ECL3786 plasmid pECL3786, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

252. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

253. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KR259130 (Escherichia coli strain EC3157 plasmid pEC3157, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

254. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KR078259 (Escherichia coli strain YD472 plasmid pYHCC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

255. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KR259131 (Escherichia coli strain EC3587 plasmid pEC3587, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

256. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP048368 (Escherichia coli strain 163 plasmid pC-F-164_A-OXA140, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

257. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

258. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP040124 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

259. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NC_020278 (Escherichia coli strain 3A11 plasmid pHN3A11, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

260. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP042601 (Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

261. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

262. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

263. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP049351 (Escherichia coli strain 3R plasmid p3R-3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

264. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to KY130431 (Klebsiella pneumoniae plasmid pABC143C-NDM, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

265. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

266. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NC_025106 (Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

267. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

268. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP020510 (Escherichia coli strain 165 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

269. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KJ020575 (Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

270. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

271. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP025470 (Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

272. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

273. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MN007141 (Escherichia coli strain 91 plasmid p91_NDM5, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

274. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

275. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

276. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP054942 (Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

277. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

278. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP020515 (Escherichia coli strain 219 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

279. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP019260 (Escherichia coli strain 13C1065T plasmid p13C1065T-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

280. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

281. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

282. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

283. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

284. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

285. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

286. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

287. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MN061455 (Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

288. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MN641485 (Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

289. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

290. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

291. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to CP052444 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

292. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

293. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

294. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

295. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

296. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

297. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

298. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP034254 (Escherichia coli strain IVRI Kol CP4 plasmid p1ESCUMpO83_CORR) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

299. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to KY463220 (Escherichia coli plasmid pNDM5-IBAC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

300. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

301. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP024836 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

302. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP026201 (Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

303. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

304. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

305. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

306. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP028996 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

307. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

308. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP040034 (Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

309. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_AP018147 (Escherichia coli strain M217 isolate M217 plasmid pM217_FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

310. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP033159 (Escherichia coli strain CM IVRI KOL-1 plasmid p1ESCUMpO83_CORR) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

311. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP048372 (Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

312. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP041182 (Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food plasmid p13520, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

313. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NC_019095 (Escherichia coli plasmid pXZ, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

314. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP040807 (Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

315. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP046117 (Enterobacter cloacae strain CBG15936 plasmid pTEM-CBG, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

316. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP017086 (Proteus mirabilis strain T18 plasmid pT18, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

317. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP036180 (Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

318. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP036306 (Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

319. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP041180 (Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

320. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to CP028790 (Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

321. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP024840 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

322. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP022157 (Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

323. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

324. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

325. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP023895 (Escherichia coli strain FDAARGOS_433 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

326. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

327. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

328. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MF918372 (Klebsiella pneumoniae plasmid p1512-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

329. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP050367 (Klebsiella pneumoniae strain 47733 plasmid p47733_NDM_5, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

330. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NC_019073 (Escherichia coli plasmid pHN7A8, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

331. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

332. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP017084 (Proteus mirabilis strain T21 plasmid pT212, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

333. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

334. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP040029 (Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

335. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP031122 (Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

336. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP047407 (Escherichia coli strain MS6193 plasmid pMS6193B, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

337. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

338. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

339. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

340. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

341. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MN822125 (Escherichia coli strain 14E509 plasmid p14E509-2FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

342. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MN865122 (Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

343. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

344. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

345. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

346. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MN823988 (Escherichia coli strain 14406 plasmid p14406-FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

347. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

348. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MF353156 (Escherichia coli plasmid pLZ135-NDM, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

349. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP012197 (Escherichia coli strain ECwhn14 plasmid pECwhn14, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

350. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to AP023220 (Escherichia coli M505 plasmid pM505-NDM5 DNA, complete genome) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

351. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to AP023236 (Escherichia coli YJ6 plasmid pYJ6-NDM5 DNA, complete genome) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

352. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

353. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP026579 (Escherichia coli strain WCHEC005237 plasmid pRmtB1_005237, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

354. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

355. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MN419308 (Klebsiella pneumoniae strain 12478 plasmid p12478-rmtB, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

356. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

357. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP050735 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

358. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

359. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NC_016839 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

360. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

361. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP038455 (Escherichia coli strain EC-129 plasmid pEC129_2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

362. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to CP028547 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid pKPC2_020143, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

363. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP043936 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-4, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

364. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_AP018833 (Escherichia coli strain M309 plasmid pM309-NDM5, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

365. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

366. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NC_010558 (Escherichia coli plasmid pIP1206, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

367. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP050770 (Salmonella enterica subsp. enterica serovar Indiana strain SI108 plasmid pSI108-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

368. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

369. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_AP018137 (Escherichia coli strain M105 isolate M105 plasmid pM105_mF, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

370. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_AP018136 (Escherichia coli strain M105 isolate M105 plasmid pM105_FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

371. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_AP018138 (Escherichia coli strain M107 isolate M107 plasmid pM107_FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

372. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_AP018144 (Escherichia coli strain M214 isolate M214 plasmid pM214_FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

373. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_AP018139 (Escherichia coli strain M109 isolate M109 plasmid pM109_FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

374. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP023942 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

375. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP026589 (Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

376. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP027695 (Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

377. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

378. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MK878893 (Escherichia coli strain J53 plasmid pMG335, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

379. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

380. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MN702385 (Escherichia coli strain LWY24J plasmid pLWY24J-3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

381. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

382. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MN262643 (Escherichia coli strain EC009 plasmid pEC009.2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

383. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP053082 (Escherichia coli strain HB37 plasmid pHB37-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

384. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MH316135 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-16 plasmid pGDD25-16, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

385. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MH316136 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-21 plasmid pGDD25-21, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

386. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MH255829 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-CTX-TEM, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

387. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MH316133 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-3 plasmid pGDD25-3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

388. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MH316134 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-5 plasmid pGDD25-5, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

389. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MH213345 (Escherichia coli strain EC1188 plasmid pEC1188-NDM16, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

390. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MH917284 (Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

391. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KY748189 (Escherichia coli strain EC007 plasmid pEC007, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

392. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KY865323 (Escherichia coli strain SY286M plasmid pECM13, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

393. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MH329656 (Escherichia coli strain 92944 plasmid p92944-CTXM, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

394. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

395. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MK079574 (Escherichia coli strain TS62CTX plasmid pHNTS62, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

396. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MH161192 (Klebsiella pneumoniae strain SCKLB138 plasmid pSCKLB138-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

397. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

398. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MK036886 (Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

399. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MN197360 (Escherichia coli strain 5P plasmid pVSI_NDM_5, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

400. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MN218686 (Escherichia coli strain 5M plasmid pISV_IncFII_NDM-5, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

401. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

402. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MF168403 (Klebsiella pneumoniae strain 12139 plasmid p12139-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

403. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MG197488 (Escherichia coli strain 04NHB3 plasmid pHN04NHB3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

404. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

405. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MF156713 (Escherichia coli strain 06028078 plasmid p28078-NDM, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

406. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MG197497 (Escherichia coli strain HNC02 plasmid pHNHNC02, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

407. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

408. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MG197496 (Escherichia coli strain AHC33 plasmid pHNAH33, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

409. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

410. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

411. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

412. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MG197499 (Escherichia coli strain HZMPC32 plasmid pHNMPC32, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

413. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MF156695 (Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

414. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MF168405 (Klebsiella pneumoniae strain 64917 plasmid p64917-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

415. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MG014720 (Escherichia coli strain A74 plasmid pA74T, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

416. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MF168406 (Klebsiella pneumoniae strain 283747 plasmid p283747-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

417. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

418. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

419. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KY748188 (Escherichia coli strain EC006 plasmid pEC006, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

420. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MG764548 (Escherichia coli strain 11011 plasmid p11011-fosA, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

421. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_KY748190 (Escherichia coli strain EC008 plasmid pEC008, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

422. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MG197490 (Escherichia coli strain FKD271 plasmid pHNFKD271, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

423. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

424. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MF344574 (Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

425. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MG515250 (Escherichia coli strain 16-50 plasmid pNDM-EC16-50, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

426. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MG591701 (Escherichia coli strain EC36 plasmid pEC36-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

427. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to LN897474 (Klebsiella pneumoniae p397Kp plasmid, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

428. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to LN897475 (Klebsiella pneumoniae p477Kp plasmid, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

429. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

430. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP030132 (Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

431. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MN823991 (Escherichia coli strain 140801063 plasmid p801063-FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

432. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MT109193 (Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

433. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP015725 (Salmonella enterica strain C629 plasmid pC629, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

434. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_LC506716 (Klebsiella pneumoniae strain JUNP053 plasmid pJUNP53, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

435. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_LC506719 (Klebsiella pneumoniae strain JUNP254 plasmid pJUNP254, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

436. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_LC506717 (Klebsiella pneumoniae strain JUNP054 plasmid pJUNP054, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

437. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_LC506718 (Klebsiella pneumoniae strain JUNP055 plasmid pJUNP055, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

438. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_LC506720 (Klebsiella pneumoniae strain JUNP268 plasmid pJUNP268, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

439. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

440. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_MF150118 (Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

441. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MF554641 (uncultured bacterium clone AA-104 plasmid pFEMG, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

442. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP025463 (Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

443. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP027200 (Escherichia coli strain WCHEC025943 plasmid p2_025943, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

444. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

445. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

446. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MT108205 (Klebsiella pneumoniae strain 71221 plasmid p71221-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

447. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MT108206 (Klebsiella pneumoniae strain A1743 plasmid pA1743-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

448. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to MT108208 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

449. spacer 1.3|321304|34|AYQC01000019|CRISPRCasFinder matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

450. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP025949 (Escherichia coli strain SCEC020023 plasmid pCTXM55_020023, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

451. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KX928752 (Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

452. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP025626 (Escherichia coli strain SCEC020007 plasmid pNDM5_020007, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

453. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

454. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KT282968 (Escherichia coli strain EC012 plasmid pEC012, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

455. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KT879914 (Escherichia coli strain HNEC55 plasmid pHNEC55, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

456. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

457. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

458. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KT725788 (Klebsiella pneumoniae strain ST147 plasmid pCC1410-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

459. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KT725789 (Klebsiella pneumoniae strain ST147 plasmid pCC1409-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

460. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

461. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KR259134 (Enterobacter cloacae strain ECL3786 plasmid pECL3786, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

462. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

463. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KR259130 (Escherichia coli strain EC3157 plasmid pEC3157, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

464. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KR078259 (Escherichia coli strain YD472 plasmid pYHCC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

465. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KR259131 (Escherichia coli strain EC3587 plasmid pEC3587, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

466. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP048368 (Escherichia coli strain 163 plasmid pC-F-164_A-OXA140, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

467. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

468. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP040124 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

469. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NC_020278 (Escherichia coli strain 3A11 plasmid pHN3A11, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

470. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP042601 (Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

471. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

472. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

473. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP049351 (Escherichia coli strain 3R plasmid p3R-3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

474. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to KY130431 (Klebsiella pneumoniae plasmid pABC143C-NDM, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

475. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

476. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NC_025106 (Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

477. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

478. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP020510 (Escherichia coli strain 165 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

479. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KJ020575 (Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

480. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

481. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP025470 (Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

482. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

483. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MN007141 (Escherichia coli strain 91 plasmid p91_NDM5, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

484. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

485. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

486. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP054942 (Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

487. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

488. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP020515 (Escherichia coli strain 219 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

489. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP019260 (Escherichia coli strain 13C1065T plasmid p13C1065T-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

490. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

491. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

492. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

493. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

494. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

495. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

496. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

497. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MN061455 (Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

498. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MN641485 (Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

499. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

500. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

501. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to CP052444 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

502. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

503. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

504. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

505. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

506. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

507. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

508. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP034254 (Escherichia coli strain IVRI Kol CP4 plasmid p1ESCUMpO83_CORR) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

509. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to KY463220 (Escherichia coli plasmid pNDM5-IBAC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

510. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

511. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP024836 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

512. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP026201 (Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

513. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

514. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

515. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

516. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP028996 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

517. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

518. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP040034 (Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

519. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_AP018147 (Escherichia coli strain M217 isolate M217 plasmid pM217_FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

520. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP033159 (Escherichia coli strain CM IVRI KOL-1 plasmid p1ESCUMpO83_CORR) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

521. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP048372 (Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

522. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP041182 (Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food plasmid p13520, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

523. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NC_019095 (Escherichia coli plasmid pXZ, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

524. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP040807 (Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

525. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP046117 (Enterobacter cloacae strain CBG15936 plasmid pTEM-CBG, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

526. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP017086 (Proteus mirabilis strain T18 plasmid pT18, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

527. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP036180 (Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

528. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP036306 (Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

529. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP041180 (Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

530. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to CP028790 (Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

531. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP024840 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

532. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP022157 (Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

533. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

534. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

535. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP023895 (Escherichia coli strain FDAARGOS_433 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

536. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

537. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

538. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MF918372 (Klebsiella pneumoniae plasmid p1512-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

539. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP050367 (Klebsiella pneumoniae strain 47733 plasmid p47733_NDM_5, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

540. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NC_019073 (Escherichia coli plasmid pHN7A8, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

541. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

542. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP017084 (Proteus mirabilis strain T21 plasmid pT212, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

543. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

544. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP040029 (Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

545. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP031122 (Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

546. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP047407 (Escherichia coli strain MS6193 plasmid pMS6193B, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

547. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

548. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

549. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

550. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

551. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MN822125 (Escherichia coli strain 14E509 plasmid p14E509-2FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

552. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MN865122 (Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

553. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

554. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

555. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

556. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MN823988 (Escherichia coli strain 14406 plasmid p14406-FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

557. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

558. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MF353156 (Escherichia coli plasmid pLZ135-NDM, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

559. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP012197 (Escherichia coli strain ECwhn14 plasmid pECwhn14, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

560. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to AP023220 (Escherichia coli M505 plasmid pM505-NDM5 DNA, complete genome) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

561. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to AP023236 (Escherichia coli YJ6 plasmid pYJ6-NDM5 DNA, complete genome) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

562. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

563. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP026579 (Escherichia coli strain WCHEC005237 plasmid pRmtB1_005237, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

564. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

565. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MN419308 (Klebsiella pneumoniae strain 12478 plasmid p12478-rmtB, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

566. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

567. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP050735 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

568. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

569. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NC_016839 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

570. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

571. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP038455 (Escherichia coli strain EC-129 plasmid pEC129_2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

572. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to CP028547 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid pKPC2_020143, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

573. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP043936 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-4, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

574. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_AP018833 (Escherichia coli strain M309 plasmid pM309-NDM5, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

575. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

576. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NC_010558 (Escherichia coli plasmid pIP1206, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

577. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP050770 (Salmonella enterica subsp. enterica serovar Indiana strain SI108 plasmid pSI108-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

578. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

579. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_AP018137 (Escherichia coli strain M105 isolate M105 plasmid pM105_mF, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

580. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_AP018136 (Escherichia coli strain M105 isolate M105 plasmid pM105_FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

581. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_AP018138 (Escherichia coli strain M107 isolate M107 plasmid pM107_FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

582. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_AP018144 (Escherichia coli strain M214 isolate M214 plasmid pM214_FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

583. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_AP018139 (Escherichia coli strain M109 isolate M109 plasmid pM109_FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

584. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP023942 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

585. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP026589 (Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

586. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP027695 (Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

587. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

588. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MK878893 (Escherichia coli strain J53 plasmid pMG335, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

589. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

590. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MN702385 (Escherichia coli strain LWY24J plasmid pLWY24J-3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

591. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

592. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MN262643 (Escherichia coli strain EC009 plasmid pEC009.2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

593. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP053082 (Escherichia coli strain HB37 plasmid pHB37-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

594. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MH316135 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-16 plasmid pGDD25-16, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

595. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MH316136 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-21 plasmid pGDD25-21, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

596. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MH255829 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-CTX-TEM, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

597. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MH316133 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-3 plasmid pGDD25-3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

598. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MH316134 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-5 plasmid pGDD25-5, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

599. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MH213345 (Escherichia coli strain EC1188 plasmid pEC1188-NDM16, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

600. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MH917284 (Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

601. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KY748189 (Escherichia coli strain EC007 plasmid pEC007, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

602. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KY865323 (Escherichia coli strain SY286M plasmid pECM13, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

603. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MH329656 (Escherichia coli strain 92944 plasmid p92944-CTXM, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

604. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

605. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MK079574 (Escherichia coli strain TS62CTX plasmid pHNTS62, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

606. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MH161192 (Klebsiella pneumoniae strain SCKLB138 plasmid pSCKLB138-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

607. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

608. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MK036886 (Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

609. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MN197360 (Escherichia coli strain 5P plasmid pVSI_NDM_5, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

610. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MN218686 (Escherichia coli strain 5M plasmid pISV_IncFII_NDM-5, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

611. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

612. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MF168403 (Klebsiella pneumoniae strain 12139 plasmid p12139-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

613. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MG197488 (Escherichia coli strain 04NHB3 plasmid pHN04NHB3, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

614. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

615. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MF156713 (Escherichia coli strain 06028078 plasmid p28078-NDM, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

616. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MG197497 (Escherichia coli strain HNC02 plasmid pHNHNC02, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

617. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

618. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MG197496 (Escherichia coli strain AHC33 plasmid pHNAH33, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

619. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

620. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

621. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

622. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MG197499 (Escherichia coli strain HZMPC32 plasmid pHNMPC32, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

623. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MF156695 (Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

624. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MF168405 (Klebsiella pneumoniae strain 64917 plasmid p64917-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

625. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MG014720 (Escherichia coli strain A74 plasmid pA74T, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

626. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MF168406 (Klebsiella pneumoniae strain 283747 plasmid p283747-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

627. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

628. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

629. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KY748188 (Escherichia coli strain EC006 plasmid pEC006, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

630. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MG764548 (Escherichia coli strain 11011 plasmid p11011-fosA, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

631. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_KY748190 (Escherichia coli strain EC008 plasmid pEC008, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

632. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MG197490 (Escherichia coli strain FKD271 plasmid pHNFKD271, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

633. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

634. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MF344574 (Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

635. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MG515250 (Escherichia coli strain 16-50 plasmid pNDM-EC16-50, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

636. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MG591701 (Escherichia coli strain EC36 plasmid pEC36-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

637. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to LN897474 (Klebsiella pneumoniae p397Kp plasmid, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

638. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to LN897475 (Klebsiella pneumoniae p477Kp plasmid, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

639. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

640. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP030132 (Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

641. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MN823991 (Escherichia coli strain 140801063 plasmid p801063-FII, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

642. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MT109193 (Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

643. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP015725 (Salmonella enterica strain C629 plasmid pC629, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

644. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_LC506716 (Klebsiella pneumoniae strain JUNP053 plasmid pJUNP53, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

645. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_LC506719 (Klebsiella pneumoniae strain JUNP254 plasmid pJUNP254, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

646. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_LC506717 (Klebsiella pneumoniae strain JUNP054 plasmid pJUNP054, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

647. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_LC506718 (Klebsiella pneumoniae strain JUNP055 plasmid pJUNP055, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

648. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_LC506720 (Klebsiella pneumoniae strain JUNP268 plasmid pJUNP268, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

649. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

650. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_MF150118 (Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

651. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MF554641 (uncultured bacterium clone AA-104 plasmid pFEMG, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

652. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP025463 (Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

653. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP027200 (Escherichia coli strain WCHEC025943 plasmid p2_025943, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

654. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

655. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

656. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MT108205 (Klebsiella pneumoniae strain 71221 plasmid p71221-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

657. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MT108206 (Klebsiella pneumoniae strain A1743 plasmid pA1743-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

658. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to MT108208 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

659. spacer 1.9|321307|34|AYQC01000019|PILER-CR matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 11, identity: 0.676

tgcacaggagagaccgatgaaaatcaacggcttc	CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc	Protospacer
 .. .****** ********* *******.. .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 304436 : 320772 21 Rhodobacter_phage(30.77%) terminase,capsid,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. AYQC01000027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 230110 : 238307 9 Acidithiobacillus_phage(66.67%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. AYQC01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 90852 : 145124 67 Rhodobacter_phage(96.88%) terminase,protease,capsid,head,portal,integrase,tail attL 85497:85514|attR 148584:148601
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
AYQC01000008.1|ETD79037.1|105014_105254_+|hypothetical-protein 105014_105254_+ 79 aa aa AcrIC9 NA NA 90852-145124 yes
6. AYQC01000013
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AYQC01000013_1 199218-199468 TypeIII NA
3 spacers
cas10,csm3gr7,cas2,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AYQC01000013_2 205966-206141 TypeIII NA
2 spacers
cas2,csm3gr7,cas10,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AYQC01000013_3 208314-208637 TypeIII NA
4 spacers
cas2,csm3gr7,cas10,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AYQC01000013_4 245031-249350 TypeI I-C
64 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AYQC01000013_5 285566-285992 Unclear I-C
6 spacers
cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
AYQC01000013_4 4.6|245397|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 245397-245429 33 AYQC01000008.1 128338-128370 0 1.0
AYQC01000013_4 4.9|245597|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 245597-245630 34 AYQC01000008.1 108402-108435 1 0.971
AYQC01000013_4 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246068-246103 36 AYQC01000008.1 106368-106403 1 0.972
AYQC01000013_4 4.35|247331|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247331-247365 35 AYQC01000008.1 145054-145088 0 1.0
AYQC01000013_4 4.62|249150|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 249150-249184 35 AYQC01000008.1 138234-138268 0 1.0
AYQC01000013_5 5.2|285664|33|AYQC01000013|CRT,PILER-CR,CRISPRCasFinder 285664-285696 33 AYQC01000008.1 117975-118007 2 0.939
AYQC01000013_5 5.5|285861|35|AYQC01000013|CRT,PILER-CR,CRISPRCasFinder 285861-285895 35 AYQC01000012.1 8960-8994 2 0.943

1. spacer 4.6|245397|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to position: 128338-128370, mismatch: 0, identity: 1.0

tggtatggatctggcgcaaacggaaagtctgtc	CRISPR spacer
tggtatggatctggcgcaaacggaaagtctgtc	Protospacer
*********************************

2. spacer 4.9|245597|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to position: 108402-108435, mismatch: 1, identity: 0.971

gatgcgttcatggcctacgtcgggcagtggactg	CRISPR spacer
gacgcgttcatggcctacgtcgggcagtggactg	Protospacer
**.*******************************

3. spacer 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to position: 106368-106403, mismatch: 1, identity: 0.972

cgcgccctgcgggtgatggcgacgggcaccacggcg	CRISPR spacer
cgcgccatgcgggtgatggcgacgggcaccacggcg	Protospacer
****** *****************************

4. spacer 4.35|247331|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to position: 145054-145088, mismatch: 0, identity: 1.0

tacagagttccggtcttgttctgttccggtaacag	CRISPR spacer
tacagagttccggtcttgttctgttccggtaacag	Protospacer
***********************************

5. spacer 4.62|249150|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to position: 138234-138268, mismatch: 0, identity: 1.0

ccggcacctcagccccgcccgctgtctcaccaaca	CRISPR spacer
ccggcacctcagccccgcccgctgtctcaccaaca	Protospacer
***********************************

6. spacer 5.2|285664|33|AYQC01000013|CRT,PILER-CR,CRISPRCasFinder matches to position: 117975-118007, mismatch: 2, identity: 0.939

gtctccgctctgcttcacggctgcgtcaacctt	CRISPR spacer
gtcgccgctctgcttcatggctgcgtcaacctt	Protospacer
*** *************.***************

7. spacer 5.5|285861|35|AYQC01000013|CRT,PILER-CR,CRISPRCasFinder matches to position: 8960-8994, mismatch: 2, identity: 0.943

gacgcgctgaaggagggtgatctcggtggcgcctt	CRISPR spacer
gacgcgctgaaggaaggtgatcttggtggcgcctt	Protospacer
**************.********.***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AYQC01000013_4 4.6|245397|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 245397-245429 33 NC_020489 Rhodobacter phage RcapNL, complete genome 39291-39323 0 1.0
AYQC01000013_4 4.6|245397|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 245397-245429 33 JF974309 Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces 49442-49474 0 1.0
AYQC01000013_4 4.35|247331|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247331-247365 35 NC_020489 Rhodobacter phage RcapNL, complete genome 22575-22609 0 1.0
AYQC01000013_4 4.35|247331|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247331-247365 35 JF974309 Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces 22549-22583 0 1.0
AYQC01000013_4 4.62|249150|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 249150-249184 35 NC_020489 Rhodobacter phage RcapNL, complete genome 29394-29428 0 1.0
AYQC01000013_4 4.62|249150|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 249150-249184 35 JF974309 Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces 29368-29402 0 1.0
AYQC01000013_4 4.9|245597|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 245597-245630 34 NC_020489 Rhodobacter phage RcapNL, complete genome 18758-18791 1 0.971
AYQC01000013_4 4.9|245597|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 245597-245630 34 JF974309 Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces 18732-18765 1 0.971
AYQC01000013_4 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246068-246103 36 NC_020489 Rhodobacter phage RcapNL, complete genome 20789-20824 1 0.972
AYQC01000013_4 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246068-246103 36 JF974309 Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces 20763-20798 1 0.972
AYQC01000013_4 4.11|245730|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 245730-245764 35 NC_020489 Rhodobacter phage RcapNL, complete genome 7697-7731 2 0.943
AYQC01000013_4 4.11|245730|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 245730-245764 35 JF974309 Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces 7671-7705 2 0.943
AYQC01000013_4 4.42|247801|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247801-247835 35 NC_020489 Rhodobacter phage RcapNL, complete genome 24669-24703 2 0.943
AYQC01000013_4 4.42|247801|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247801-247835 35 JF974309 Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces 24643-24677 2 0.943
AYQC01000013_4 4.48|248205|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 248205-248239 35 NC_016165 Rhodobacter phage RcapMu, complete genome 10621-10655 2 0.943
AYQC01000013_5 5.2|285664|33|AYQC01000013|CRT,PILER-CR,CRISPRCasFinder 285664-285696 33 NC_020489 Rhodobacter phage RcapNL, complete genome 9191-9223 2 0.939
AYQC01000013_5 5.2|285664|33|AYQC01000013|CRT,PILER-CR,CRISPRCasFinder 285664-285696 33 JF974309 Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces 9165-9197 2 0.939
AYQC01000013_5 5.5|285861|35|AYQC01000013|CRT,PILER-CR,CRISPRCasFinder 285861-285895 35 NC_016165 Rhodobacter phage RcapMu, complete genome 30436-30470 2 0.943
AYQC01000013_5 5.5|285861|35|AYQC01000013|CRT,PILER-CR,CRISPRCasFinder 285861-285895 35 JF974309 Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces 38921-38955 2 0.943
AYQC01000013_1 1.2|199325|35|AYQC01000013|PILER-CR 199325-199359 35 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 548712-548746 6 0.829
AYQC01000013_1 1.2|199325|35|AYQC01000013|PILER-CR 199325-199359 35 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1368207-1368241 6 0.829
AYQC01000013_1 1.2|199325|35|AYQC01000013|PILER-CR 199325-199359 35 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 550205-550239 6 0.829
AYQC01000013_1 1.2|199325|35|AYQC01000013|PILER-CR 199325-199359 35 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 549300-549334 6 0.829
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 221889-221922 6 0.824
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP015740 Shinella sp. HZN7 plasmid pShin-04, complete sequence 97217-97250 6 0.824
AYQC01000013_4 4.28|246865|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246865-246899 35 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 757051-757085 6 0.829
AYQC01000013_4 4.33|247198|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247198-247232 35 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 469047-469081 6 0.829
AYQC01000013_1 1.2|199325|35|AYQC01000013|PILER-CR 199325-199359 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5263725-5263759 7 0.8
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 CP054924 Verrucosispora sp. NA02020 plasmid unnamed, complete sequence 64148-64181 7 0.794
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 114898-114931 7 0.794
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1142455-1142488 7 0.794
AYQC01000013_4 4.33|247198|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247198-247232 35 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 138046-138080 7 0.8
AYQC01000013_4 4.46|248071|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 248071-248105 35 NC_012807 Methylorubrum extorquens AM1 plasmid p1META1, complete sequence 34840-34874 7 0.8
AYQC01000013_1 1.2|199325|35|AYQC01000013|PILER-CR 199325-199359 35 NZ_CP041652 Streptomyces sp. RLB1-9 plasmid pRLB1-9.2, complete sequence 46702-46736 8 0.771
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1109735-1109768 8 0.765
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 614519-614552 8 0.765
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1279919-1279952 8 0.765
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1117903-1117936 8 0.765
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1117849-1117882 8 0.765
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 606491-606524 8 0.765
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP041156 Leisingera aquaemixtae strain R2C4 plasmid unnamed1, complete sequence 69412-69445 8 0.765
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_LR536451 Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2 148174-148207 8 0.765
AYQC01000013_4 4.25|246667|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246667-246699 33 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 287425-287457 8 0.758
AYQC01000013_4 4.25|246667|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246667-246699 33 NZ_KX710094 Leclercia adecarboxylata strain P10164 plasmid pP10164-3, complete sequence 73729-73761 8 0.758
AYQC01000013_4 4.25|246667|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246667-246699 33 NZ_CP040894 Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_3, complete sequence 25910-25942 8 0.758
AYQC01000013_4 4.31|247066|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247066-247099 34 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 125627-125660 8 0.765
AYQC01000013_4 4.31|247066|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247066-247099 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 155947-155980 8 0.765
AYQC01000013_4 4.31|247066|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247066-247099 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 173660-173693 8 0.765
AYQC01000013_4 4.31|247066|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247066-247099 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 366095-366128 8 0.765
AYQC01000013_4 4.31|247066|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247066-247099 34 NC_002682 Mesorhizobium japonicum MAFF 303099 plasmid pMLb, complete sequence 122068-122101 8 0.765
AYQC01000013_4 4.34|247265|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247265-247298 34 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 369320-369353 8 0.765
AYQC01000013_4 4.37|247464|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247464-247499 36 MH617261 Microviridae sp. isolate ctba13, complete genome 1572-1607 8 0.778
AYQC01000013_4 4.46|248071|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 248071-248105 35 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 815531-815565 8 0.771
AYQC01000013_4 4.56|248740|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 248740-248775 36 NC_049478 Arthrobacter phage Mufasa8, complete genome 29400-29435 8 0.778
AYQC01000013_1 1.2|199325|35|AYQC01000013|PILER-CR 199325-199359 35 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 367400-367434 9 0.743
AYQC01000013_1 1.2|199325|35|AYQC01000013|PILER-CR 199325-199359 35 NC_018023 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.02, complete sequence 85771-85805 9 0.743
AYQC01000013_1 1.2|199325|35|AYQC01000013|PILER-CR 199325-199359 35 NZ_CP009439 Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence 151753-151787 9 0.743
AYQC01000013_2 2.1|206003|32|AYQC01000013|PILER-CR,CRISPRCasFinder 206003-206034 32 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 325032-325063 9 0.719
AYQC01000013_4 4.5|245331|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 245331-245364 34 NC_014159 Tsukamurella paurometabola DSM 20162 plasmid pTpau01, complete sequence 12274-12307 9 0.735
AYQC01000013_4 4.5|245331|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 245331-245364 34 NZ_CP046100 Rhodococcus sp. AQ5-07 plasmid unnamed1, complete sequence 39488-39521 9 0.735
AYQC01000013_4 4.13|245865|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 245865-245900 36 NZ_AP015031 Pseudomonas putida strain KF715 plasmid pKF715B, complete sequence 183426-183461 9 0.75
AYQC01000013_4 4.13|245865|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 245865-245900 36 NZ_CP044084 Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence 292973-293008 9 0.75
AYQC01000013_4 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246068-246103 36 NZ_LR594661 Variovorax sp. PBL-H6 plasmid 3 29234-29269 9 0.75
AYQC01000013_4 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246068-246103 36 NZ_CP044974 Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B4) plasmid pPBL-H3_B4-2, complete sequence 101544-101579 9 0.75
AYQC01000013_4 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246068-246103 36 AP018707 Uncultured bacterium plasmid pSN1104-11 DNA, complete sequence 37770-37805 9 0.75
AYQC01000013_4 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246068-246103 36 AP018708 Uncultured bacterium plasmid pSN1104-34 DNA, complete sequence 37854-37889 9 0.75
AYQC01000013_4 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246068-246103 36 NZ_CP044977 Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-2, complete sequence 104095-104130 9 0.75
AYQC01000013_4 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246068-246103 36 NZ_CP044551 Hydrogenophaga sp. BPS33 plasmid pBPS33-2, complete sequence 103615-103650 9 0.75
AYQC01000013_4 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246068-246103 36 NZ_LR594677 Variovorax sp. PBS-H4 plasmid 3 50560-50595 9 0.75
AYQC01000013_4 4.19|246271|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246271-246304 34 NZ_CP036297 Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence 35247-35280 9 0.735
AYQC01000013_4 4.19|246271|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246271-246304 34 NZ_CP036288 Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence 35277-35310 9 0.735
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1118128-1118161 9 0.735
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 792471-792504 9 0.735
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1118249-1118282 9 0.735
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 842348-842381 9 0.735
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 842340-842373 9 0.735
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 842347-842380 9 0.735
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 850806-850839 9 0.735
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 814052-814085 9 0.735
AYQC01000013_4 4.25|246667|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246667-246699 33 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 23579-23611 9 0.727
AYQC01000013_4 4.25|246667|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246667-246699 33 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 122300-122332 9 0.727
AYQC01000013_4 4.28|246865|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246865-246899 35 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 448768-448802 9 0.743
AYQC01000013_4 4.33|247198|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247198-247232 35 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 59770-59804 9 0.743
AYQC01000013_4 4.46|248071|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 248071-248105 35 MH001460 Streptomyces phage Paedore, complete genome 19063-19097 9 0.743
AYQC01000013_4 4.56|248740|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 248740-248775 36 NC_007515 Geobacter metallireducens GS-15 plasmid, complete genome 7550-7585 9 0.75
AYQC01000013_4 4.57|248808|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 248808-248842 35 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 23195-23229 9 0.743
AYQC01000013_4 4.59|248945|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 248945-248979 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1787317-1787351 9 0.743
AYQC01000013_1 1.2|199325|35|AYQC01000013|PILER-CR 199325-199359 35 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 71977-72011 10 0.714
AYQC01000013_4 4.5|245331|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 245331-245364 34 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 419120-419153 10 0.706
AYQC01000013_4 4.22|246469|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246469-246501 33 NZ_CP026653 Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence 13931-13963 10 0.697
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 684048-684081 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 579412-579445 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP037902 Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence 341427-341460 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 390765-390798 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP046332 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2 207019-207052 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP026546 Cupriavidus metallidurans strain Ni-2 plasmid unnamed2 191498-191531 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 638236-638269 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 578527-578560 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 579400-579433 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 579419-579452 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 579397-579430 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 684106-684139 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 684106-684139 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NC_006466 Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence 215723-215756 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP043439 Cupriavidus campinensis strain MJ1 plasmid unnamed2, complete sequence 308189-308222 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 684095-684128 10 0.706
AYQC01000013_4 4.33|247198|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247198-247232 35 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 28662-28696 10 0.714
AYQC01000013_4 4.34|247265|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247265-247298 34 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 933669-933702 10 0.706
AYQC01000013_4 4.42|247801|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 247801-247835 35 NC_015258 Polymorphum gilvum SL003B-26A1 plasmid pSL003B, complete sequence 62251-62285 10 0.714
AYQC01000013_4 4.50|248339|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 248339-248372 34 NC_021241 Paracoccus marcusii strain DSM 11574 plasmid pMARC4, complete sequence 13585-13618 10 0.706
AYQC01000013_4 4.50|248339|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 248339-248372 34 NZ_CP034816 Paracoccus sp. Arc7-R13 plasmid unnamed6, complete sequence 22265-22298 10 0.706
AYQC01000013_4 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246601-246634 34 NZ_CP039912 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence 269179-269212 11 0.676
AYQC01000013_4 4.25|246667|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246667-246699 33 CP054928 Streptomyces fulvissimus strain NA06532 plasmid unnamed2, complete sequence 51251-51283 11 0.667
AYQC01000013_4 4.54|248604|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 248604-248638 35 NZ_LR723669 Rhizobium sp. Khangiran2 plasmid 2 36017-36051 11 0.686
AYQC01000013_4 4.57|248808|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 248808-248842 35 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1011584-1011618 11 0.686
AYQC01000013_4 4.19|246271|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246271-246304 34 MG592644 Vibrio phage 1.276.O._10N.286.54.E4, partial genome 10881-10914 12 0.647
AYQC01000013_4 4.19|246271|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246271-246304 34 MG592567 Vibrio phage 1.198.A._10N.286.54.F4, partial genome 12280-12313 12 0.647
AYQC01000013_4 4.19|246271|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT 246271-246304 34 MG592568 Vibrio phage 1.198.B._10N.286.54.F4, partial genome 12280-12313 12 0.647

1. spacer 4.6|245397|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_020489 (Rhodobacter phage RcapNL, complete genome) position: , mismatch: 0, identity: 1.0

tggtatggatctggcgcaaacggaaagtctgtc	CRISPR spacer
tggtatggatctggcgcaaacggaaagtctgtc	Protospacer
*********************************

2. spacer 4.6|245397|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 0, identity: 1.0

tggtatggatctggcgcaaacggaaagtctgtc	CRISPR spacer
tggtatggatctggcgcaaacggaaagtctgtc	Protospacer
*********************************

3. spacer 4.35|247331|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_020489 (Rhodobacter phage RcapNL, complete genome) position: , mismatch: 0, identity: 1.0

tacagagttccggtcttgttctgttccggtaacag	CRISPR spacer
tacagagttccggtcttgttctgttccggtaacag	Protospacer
***********************************

4. spacer 4.35|247331|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 0, identity: 1.0

tacagagttccggtcttgttctgttccggtaacag	CRISPR spacer
tacagagttccggtcttgttctgttccggtaacag	Protospacer
***********************************

5. spacer 4.62|249150|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_020489 (Rhodobacter phage RcapNL, complete genome) position: , mismatch: 0, identity: 1.0

ccggcacctcagccccgcccgctgtctcaccaaca	CRISPR spacer
ccggcacctcagccccgcccgctgtctcaccaaca	Protospacer
***********************************

6. spacer 4.62|249150|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 0, identity: 1.0

ccggcacctcagccccgcccgctgtctcaccaaca	CRISPR spacer
ccggcacctcagccccgcccgctgtctcaccaaca	Protospacer
***********************************

7. spacer 4.9|245597|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_020489 (Rhodobacter phage RcapNL, complete genome) position: , mismatch: 1, identity: 0.971

gatgcgttcatggcctacgtcgggcagtggactg	CRISPR spacer
gacgcgttcatggcctacgtcgggcagtggactg	Protospacer
**.*******************************

8. spacer 4.9|245597|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 1, identity: 0.971

gatgcgttcatggcctacgtcgggcagtggactg	CRISPR spacer
gacgcgttcatggcctacgtcgggcagtggactg	Protospacer
**.*******************************

9. spacer 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_020489 (Rhodobacter phage RcapNL, complete genome) position: , mismatch: 1, identity: 0.972

cgcgccctgcgggtgatggcgacgggcaccacggcg	CRISPR spacer
cgcgccatgcgggtgatggcgacgggcaccacggcg	Protospacer
****** *****************************

10. spacer 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 1, identity: 0.972

cgcgccctgcgggtgatggcgacgggcaccacggcg	CRISPR spacer
cgcgccatgcgggtgatggcgacgggcaccacggcg	Protospacer
****** *****************************

11. spacer 4.11|245730|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_020489 (Rhodobacter phage RcapNL, complete genome) position: , mismatch: 2, identity: 0.943

aggcgcatctgatgtatatgcccggtgagacggct	CRISPR spacer
gggcgcatcggatgtatatgcccggtgagacggct	Protospacer
.******** *************************

12. spacer 4.11|245730|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 2, identity: 0.943

aggcgcatctgatgtatatgcccggtgagacggct	CRISPR spacer
gggcgcatcggatgtatatgcccggtgagacggct	Protospacer
.******** *************************

13. spacer 4.42|247801|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_020489 (Rhodobacter phage RcapNL, complete genome) position: , mismatch: 2, identity: 0.943

gctggcgcgcgccgcgccggatctttgtctgcgcg	CRISPR spacer
gctggcgcgcgccgcgccggatcttcgtctgcgca	Protospacer
*************************.********.

14. spacer 4.42|247801|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 2, identity: 0.943

gctggcgcgcgccgcgccggatctttgtctgcgcg	CRISPR spacer
gctggcgcgcgccgcgccggatcttcgtctgcgca	Protospacer
*************************.********.

15. spacer 4.48|248205|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_016165 (Rhodobacter phage RcapMu, complete genome) position: , mismatch: 2, identity: 0.943

atggctatggcggcagtgtcaggttttccagcggc	CRISPR spacer
agggctatggcggcagcgtcaggttttccagcggc	Protospacer
* **************.******************

16. spacer 5.2|285664|33|AYQC01000013|CRT,PILER-CR,CRISPRCasFinder matches to NC_020489 (Rhodobacter phage RcapNL, complete genome) position: , mismatch: 2, identity: 0.939

gtctccgctctgcttcacggctgcgtcaacctt	CRISPR spacer
gtcgccgctctgcttcatggctgcgtcaacctt	Protospacer
*** *************.***************

17. spacer 5.2|285664|33|AYQC01000013|CRT,PILER-CR,CRISPRCasFinder matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 2, identity: 0.939

gtctccgctctgcttcacggctgcgtcaacctt	CRISPR spacer
gtcgccgctctgcttcatggctgcgtcaacctt	Protospacer
*** *************.***************

18. spacer 5.5|285861|35|AYQC01000013|CRT,PILER-CR,CRISPRCasFinder matches to NC_016165 (Rhodobacter phage RcapMu, complete genome) position: , mismatch: 2, identity: 0.943

gacgcgctgaaggagggtgatctcggtggcgcctt	CRISPR spacer
gacgcgctgaaggaaggtgatcttggtggcgcctt	Protospacer
**************.********.***********

19. spacer 5.5|285861|35|AYQC01000013|CRT,PILER-CR,CRISPRCasFinder matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 2, identity: 0.943

gacgcgctgaaggagggtgatctcggtggcgcctt	CRISPR spacer
gacgcgctgaaggaaggtgatcttggtggcgcctt	Protospacer
**************.********.***********

20. spacer 1.2|199325|35|AYQC01000013|PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.829

-acgggggcggcggcgaggcaggcgaaggcggcggc	CRISPR spacer
agcaggggc-tcggcgaggccgacgaaggcggcggc	Protospacer
 .*.*****  ********* *.*************

21. spacer 1.2|199325|35|AYQC01000013|PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.829

-acgggggcggcggcgaggcaggcgaaggcggcggc	CRISPR spacer
agcaggggc-tcggcgaggccgacgaaggcggcggc	Protospacer
 .*.*****  ********* *.*************

22. spacer 1.2|199325|35|AYQC01000013|PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.829

-acgggggcggcggcgaggcaggcgaaggcggcggc	CRISPR spacer
agcaggggc-tcggcgaggccgacgaaggcggcggc	Protospacer
 .*.*****  ********* *.*************

23. spacer 1.2|199325|35|AYQC01000013|PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.829

-acgggggcggcggcgaggcaggcgaaggcggcggc	CRISPR spacer
agcaggggc-tcggcgaggccgacgaaggcggcggc	Protospacer
 .*.*****  ********* *.*************

24. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.824

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
tgcctgcgcggccgcatcgccttccgcgtgaaag	Protospacer
 ****************** ******* ** . *

25. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015740 (Shinella sp. HZN7 plasmid pShin-04, complete sequence) position: , mismatch: 6, identity: 0.824

-agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
gagcgtgc-cgtccgcatcggcttgcgcctgcgac	Protospacer
 *** *** ** ************ ********  

26. spacer 4.28|246865|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 6, identity: 0.829

gtgtctgcc-acgacgccctgcaccagatccgcgcc	CRISPR spacer
-tctcggccttcgacgcgctgcagcagatccgcgcc	Protospacer
 * ** ***  ****** ***** ************

27. spacer 4.33|247198|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.829

--aacccgatcatggcccgcctcagcgccgcgctgac	CRISPR spacer
ctgaccc--tgatggtcggcctcagcgccgcgctgac	Protospacer
  .****  * ****.* *******************

28. spacer 1.2|199325|35|AYQC01000013|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.8

acgggggcggcggcgaggcaggcgaaggcggcggc	CRISPR spacer
gcggccgatgcggcgaggcaggcggaggcggcggg	Protospacer
.***  *  ***************.********* 

29. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to CP054924 (Verrucosispora sp. NA02020 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgtccgcgccgccgcctcggcttccgcctgcgcc	Protospacer
 *.*.**** ***** ****************. 

30. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

agcctg--cgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
--cccggccgcggcggcatcggctgccgcctgccgg	Protospacer
  **.*  ****** ********* ********  *

31. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.794

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
agactgcgcggtcgcatcggcttcacgcgccgtg	Protospacer
** ********.************   *  ****

32. spacer 4.33|247198|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 7, identity: 0.8

aacccgat---catggcccgcctcagcgccgcgctgac	CRISPR spacer
---ccggccgacatggcccggctcatcgccgcgctgac	Protospacer
   ***..   ********* **** ************

33. spacer 4.46|248071|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_012807 (Methylorubrum extorquens AM1 plasmid p1META1, complete sequence) position: , mismatch: 7, identity: 0.8

atcagcttgaccgcatcgaagctggtcacatcgcc	CRISPR spacer
atcagcttgaccgcatcgaagccgatcgccccgag	Protospacer
**********************.*.**.* .**  

34. spacer 1.2|199325|35|AYQC01000013|PILER-CR matches to NZ_CP041652 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.2, complete sequence) position: , mismatch: 8, identity: 0.771

acgggggcggcggcgaggcaggcgaaggcggcggc	CRISPR spacer
acggggacggcggccaggcaggcgagtacgacgag	Protospacer
******.******* **********. .**.**. 

35. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 8, identity: 0.765

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgccggcgcggccgcatcgacttccgccttgaga	Protospacer
 *** **************.*********  . .

36. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgcgcggaccgccgcgtcgacttccgcctgcgtg	Protospacer
 ** .* .* *****.***.**************

37. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgcgcggaccgccgcgtcgacttccgcctgcgtg	Protospacer
 ** .* .* *****.***.**************

38. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.765

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgcgcggaccgccgcgtcgacttccgcctgcgtg	Protospacer
 ** .* .* *****.***.**************

39. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgcgcggaccgccgcgtcgacttccgcctgcgtg	Protospacer
 ** .* .* *****.***.**************

40. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.765

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgcgcggaccgccgcgtcgacttccgcctgcgtg	Protospacer
 ** .* .* *****.***.**************

41. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041156 (Leisingera aquaemixtae strain R2C4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
tgcgagcgcggccgcggcggcttccgcctgaccg	Protospacer
 **  **********. *************  .*

42. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR536451 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2) position: , mismatch: 8, identity: 0.765

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
aacgagcgcggccgcagcggcctccgcctgagcc	Protospacer
*.*  *********** ****.******** *. 

43. spacer 4.25|246667|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 8, identity: 0.758

atcagctcgtcgttggtcagccggacgatgtcc	CRISPR spacer
gcgaagtagtcgttggtcagccggaagttgtcc	Protospacer
.. *. * ***************** * *****

44. spacer 4.25|246667|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX710094 (Leclercia adecarboxylata strain P10164 plasmid pP10164-3, complete sequence) position: , mismatch: 8, identity: 0.758

atcagctcgtcgttggtcagccggacgatgtcc----	CRISPR spacer
atcagctcgtcattggtcagcggg----tgctcttta	Protospacer
***********.********* **    **..*    

45. spacer 4.25|246667|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040894 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_3, complete sequence) position: , mismatch: 8, identity: 0.758

atcagctcgtcgttggtcagccggacgatgtcc----	CRISPR spacer
atcagctcgtcattggtcagcggg----tgctcttta	Protospacer
***********.********* **    **..*    

46. spacer 4.31|247066|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 8, identity: 0.765

tcttcaatggatatggcaaaaccgtccgcgacat	CRISPR spacer
tggcctttggacatgccaaaaccgtccgcgacct	Protospacer
*  .*  ****.*** **************** *

47. spacer 4.31|247066|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 8, identity: 0.765

tcttcaatggatatggcaaaaccgtccgcgacat	CRISPR spacer
tggcctttggacatgccaaaaccgtccgcgacct	Protospacer
*  .*  ****.*** **************** *

48. spacer 4.31|247066|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 8, identity: 0.765

tcttcaatggatatggcaaaaccgtccgcgacat	CRISPR spacer
tggcctttggacatgccaaaaccgtccgcgacct	Protospacer
*  .*  ****.*** **************** *

49. spacer 4.31|247066|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 8, identity: 0.765

tcttcaatggatatggcaaaaccgtccgcgacat	CRISPR spacer
tggcctttggacatgccaaaaccgtccgcgacct	Protospacer
*  .*  ****.*** **************** *

50. spacer 4.31|247066|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_002682 (Mesorhizobium japonicum MAFF 303099 plasmid pMLb, complete sequence) position: , mismatch: 8, identity: 0.765

tcttcaatggatatggcaaaaccgtccgcgacat	CRISPR spacer
tgacccttggacatgccaaaaccgtccgcgacct	Protospacer
*  .*  ****.*** **************** *

51. spacer 4.34|247265|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 8, identity: 0.765

atccgcggatcggcgtgacccgccccgcccatcg	CRISPR spacer
atccgcggatctgcgagacccgccacccgcctta	Protospacer
*********** *** ******** * * * *..

52. spacer 4.37|247464|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to MH617261 (Microviridae sp. isolate ctba13, complete genome) position: , mismatch: 8, identity: 0.778

tcggcaaggacatcgccgatctgggtaaggccggtg	CRISPR spacer
tcatagaggacatcgccgatttgggtaaggccaacg	Protospacer
**.  .**************.***********...*

53. spacer 4.46|248071|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.771

atcagcttgaccgcatcgaagctggtcacatcgcc	CRISPR spacer
atcagcttgaccgcaccgaagttggtatcctgcgc	Protospacer
***************.*****.****  * *   *

54. spacer 4.56|248740|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_049478 (Arthrobacter phage Mufasa8, complete genome) position: , mismatch: 8, identity: 0.778

accaatgccgaagccaaggccgcagcagcggctgcg	CRISPR spacer
gccaaggccgaagccaaggccgccgcagacgcccag	Protospacer
.**** ***************** ****  **.  *

55. spacer 1.2|199325|35|AYQC01000013|PILER-CR matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 9, identity: 0.743

acgggggcggcggcgaggcaggcgaaggcggcggc	CRISPR spacer
gcgaaggcggcggcgacgccggcgaaggcgcagag	Protospacer
.**..*********** ** **********  *. 

56. spacer 1.2|199325|35|AYQC01000013|PILER-CR matches to NC_018023 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.02, complete sequence) position: , mismatch: 9, identity: 0.743

acgggggcggcggcgaggcaggcgaaggcggcggc	CRISPR spacer
actatctcggcggcgaggcgggcgtaggcggccac	Protospacer
** .   ************.**** ******* .*

57. spacer 1.2|199325|35|AYQC01000013|PILER-CR matches to NZ_CP009439 (Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence) position: , mismatch: 9, identity: 0.743

acgggggcggcggcgaggcaggcgaaggcggcggc	CRISPR spacer
atgagggcggcggcgaggccgacgaaggccaggaa	Protospacer
*.*.*************** *.******* . *. 

58. spacer 2.1|206003|32|AYQC01000013|PILER-CR,CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

acccagaac---aggtgtttgagcggcccacccgc	CRISPR spacer
---tggggcgcaaggtgtttgaccgccccacccgc	Protospacer
   ..*..*   ********** ** *********

59. spacer 4.5|245331|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_014159 (Tsukamurella paurometabola DSM 20162 plasmid pTpau01, complete sequence) position: , mismatch: 9, identity: 0.735

atctgcatgtagtcggcgggcagttcgagccgca	CRISPR spacer
gcgcgcaggtagtcggcgggcagttcgatgcgtc	Protospacer
.. .*** ********************  **. 

60. spacer 4.5|245331|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046100 (Rhodococcus sp. AQ5-07 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

atctgcatgtagtcggcgggcagttcgagccgca	CRISPR spacer
agctgggtgtagtcggcgggcagttcggctggag	Protospacer
* *** .********************. . * .

61. spacer 4.13|245865|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP015031 (Pseudomonas putida strain KF715 plasmid pKF715B, complete sequence) position: , mismatch: 9, identity: 0.75

ccggcga--aaaacggccatgcctccgggtgtctggct	CRISPR spacer
--gacggcttcgacggccatggcgccgggtgtctggct	Protospacer
  *.**.    .********* * **************

62. spacer 4.13|245865|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044084 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.75

ccggcga--aaaacggccatgcctccgggtgtctggct	CRISPR spacer
--gacggcttcgacggccatggcgccgggtgtctggct	Protospacer
  *.**.    .********* * **************

63. spacer 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594661 (Variovorax sp. PBL-H6 plasmid 3) position: , mismatch: 9, identity: 0.75

cgcgccctgcgggtgatggcgacgggcaccacggcg	CRISPR spacer
caggccgcgcgggtgatggcgacgggcaccgtaaag	Protospacer
*. *** .**********************.... *

64. spacer 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044974 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B4) plasmid pPBL-H3_B4-2, complete sequence) position: , mismatch: 9, identity: 0.75

cgcgccctgcgggtgatggcgacgggcaccacggcg	CRISPR spacer
caggccgcgcgggtgatggcgacgggcaccgtaaag	Protospacer
*. *** .**********************.... *

65. spacer 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to AP018707 (Uncultured bacterium plasmid pSN1104-11 DNA, complete sequence) position: , mismatch: 9, identity: 0.75

cgcgccctgcgggtgatggcgacgggcaccacggcg	CRISPR spacer
caggccgcgcgggtgatggcgacgggcaccgtaaag	Protospacer
*. *** .**********************.... *

66. spacer 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to AP018708 (Uncultured bacterium plasmid pSN1104-34 DNA, complete sequence) position: , mismatch: 9, identity: 0.75

cgcgccctgcgggtgatggcgacgggcaccacggcg	CRISPR spacer
caggccgcgcgggtgatggcgacgggcaccgtaaag	Protospacer
*. *** .**********************.... *

67. spacer 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044977 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-2, complete sequence) position: , mismatch: 9, identity: 0.75

cgcgccctgcgggtgatggcgacgggcaccacggcg	CRISPR spacer
caggccgcgcgggtgatggcgacgggcaccgtaaag	Protospacer
*. *** .**********************.... *

68. spacer 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044551 (Hydrogenophaga sp. BPS33 plasmid pBPS33-2, complete sequence) position: , mismatch: 9, identity: 0.75

cgcgccctgcgggtgatggcgacgggcaccacggcg	CRISPR spacer
caggccgcgcgggtgatggcgacgggcaccgtaaag	Protospacer
*. *** .**********************.... *

69. spacer 4.16|246068|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594677 (Variovorax sp. PBS-H4 plasmid 3) position: , mismatch: 9, identity: 0.75

cgcgccctgcgggtgatggcgacgggcaccacggcg	CRISPR spacer
caggccgcgcgggtgatggcgacgggcaccgtaaag	Protospacer
*. *** .**********************.... *

70. spacer 4.19|246271|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036297 (Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence) position: , mismatch: 9, identity: 0.735

gatttcgtcgcttacgacgcctatctgatttcgg	CRISPR spacer
tgattcgtcgcttacgccgcctagctgccgccgg	Protospacer
 . ************* ****** *** . .***

71. spacer 4.19|246271|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036288 (Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence) position: , mismatch: 9, identity: 0.735

gatttcgtcgcttacgacgcctatctgatttcgg	CRISPR spacer
tgattcgtcgcttacgccgcctagctgccgccgg	Protospacer
 . ************* ****** *** . .***

72. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgcgcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 ** .* .. *****.***.**************

73. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.735

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgcgcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 ** .* .. *****.***.**************

74. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgcgcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 ** .* .. *****.***.**************

75. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgcgcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 ** .* .. *****.***.**************

76. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgcgcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 ** .* .. *****.***.**************

77. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgcgcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 ** .* .. *****.***.**************

78. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgcgcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 ** .* .. *****.***.**************

79. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgcgcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 ** .* .. *****.***.**************

80. spacer 4.25|246667|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 9, identity: 0.727

atcagctcgtcgttggtcagccggacgatgtcc	CRISPR spacer
gcgaagtactcgttggtcagccggaagttgtcc	Protospacer
.. *. *  **************** * *****

81. spacer 4.25|246667|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 9, identity: 0.727

atcagctcgtcgttggtcagccggacgatgtcc	CRISPR spacer
ttgcggatctcgttcgtcagccggacgacgtcc	Protospacer
 *  *  . ***** *************.****

82. spacer 4.28|246865|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 9, identity: 0.743

gtgtctgccacgacgccctgcaccagatccgcgcc	CRISPR spacer
tcgcggccttcgacgccctgcagcagatccgcgcc	Protospacer
 .*.   *. ************ ************

83. spacer 4.33|247198|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 9, identity: 0.743

aacccgatcatggcccgcctcagcgccgcgctgac	CRISPR spacer
gcgccgatcatggccggcctcatcgccgcagtcat	Protospacer
.  ************ ****** ******. * *.

84. spacer 4.46|248071|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to MH001460 (Streptomyces phage Paedore, complete genome) position: , mismatch: 9, identity: 0.743

atcagcttgaccgcatcgaagctggtcacatcgcc	CRISPR spacer
gccagcttgaccgcagcgaagcgggtcgtcgtgcc	Protospacer
..************* ****** ****..  .***

85. spacer 4.56|248740|36|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_007515 (Geobacter metallireducens GS-15 plasmid, complete genome) position: , mismatch: 9, identity: 0.75

accaatgccgaagccaaggccgcagcagcggctgcg	CRISPR spacer
ggcctcgccggagccaaggccgcagcagcagccggg	Protospacer
. *  .****.******************.**.* *

86. spacer 4.57|248808|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 9, identity: 0.743

aaaaagccgccgacaaacgcggcaaccggcccggc	CRISPR spacer
tacttgaagccgacaaccgcggcgaccggcccgtc	Protospacer
 *   *  ******** ******.********* *

87. spacer 4.59|248945|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.743

accccgaacctgtcggcggcgaacaccgataccgc	CRISPR spacer
tgcacgtgggtgtcggcgccgaacaccgagaccgc	Protospacer
  * ** .  ******** ********** *****

88. spacer 1.2|199325|35|AYQC01000013|PILER-CR matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 10, identity: 0.714

acgggggcggcggcgaggcaggcgaaggcggcggc	CRISPR spacer
gtgatggcgacggcgaggcaggcgagggcgaggag	Protospacer
..*. ****.***************.****. *. 

89. spacer 4.5|245331|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 10, identity: 0.706

atctgcatgtagtcggcgggcagttcgagccgca	CRISPR spacer
gtgcgggccgagacggcgggcagttcgggccgca	Protospacer
.* .* ..  ** **************.******

90. spacer 4.22|246469|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

cgtgtggatgatcatgcagcgcggacggcttgg	CRISPR spacer
tagccgcgtgatcatgcagcgtggacgggttgc	Protospacer
..  .* .*************.****** *** 

91. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgagcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 *  .* .. *****.***.**************

92. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgagcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 *  .* .. *****.***.**************

93. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037902 (Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
agcgtgcgcggccggatcggcttcgatgtcggcc	Protospacer
*** ********** ********* .. *  *. 

94. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
gcgctgcgcggccgctacggcttccgcggcctcg	Protospacer
.  ************  **********   * .*

95. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046332 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
agcgtgcgcggccggatcggcttcgatgtcggcc	Protospacer
*** ********** ********* .. *  *. 

96. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
agcgtgcgcggccggatcggcttcgatgtcggcc	Protospacer
*** ********** ********* .. *  *. 

97. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgagcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 *  .* .. *****.***.**************

98. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgagcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 *  .* .. *****.***.**************

99. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgagcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 *  .* .. *****.***.**************

100. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgagcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 *  .* .. *****.***.**************

101. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgagcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 *  .* .. *****.***.**************

102. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgagcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 *  .* .. *****.***.**************

103. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgagcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 *  .* .. *****.***.**************

104. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_006466 (Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
agcgtgcgcggccggatcggcttcgatgtcggcc	Protospacer
*** ********** ********* .. *  *. 

105. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043439 (Cupriavidus campinensis strain MJ1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
agcgtgcgcggccggatcggcttcgatgtcggcc	Protospacer
*** ********** ********* .. *  *. 

106. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
cgagcggatcgccgcgtcgacttccgcctgcgtg	Protospacer
 *  .* .. *****.***.**************

107. spacer 4.33|247198|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 10, identity: 0.714

aacccgatcatggcccgcctcagcgccgcgctgac	CRISPR spacer
ggcgcgaacaaggcccgcctcagcgccgccgaaag	Protospacer
..* *** ** ******************   .* 

108. spacer 4.34|247265|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

atccgcggatcggcgtgacccgccccgcccatcg	CRISPR spacer
atccgcagatcggcgtgatccgccgcttctggtc	Protospacer
******.***********.***** * .*.. . 

109. spacer 4.42|247801|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_015258 (Polymorphum gilvum SL003B-26A1 plasmid pSL003B, complete sequence) position: , mismatch: 10, identity: 0.714

gctggcgcgcgccgcgccggatctttgtctgcgcg	CRISPR spacer
acgggcgcgcgccgcgccggatccgtgttcctgaa	Protospacer
.* ********************. ***.. .* .

110. spacer 4.50|248339|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_021241 (Paracoccus marcusii strain DSM 11574 plasmid pMARC4, complete sequence) position: , mismatch: 10, identity: 0.706

aactgacccggcaacggcctatgcgctggacgtg	CRISPR spacer
gaccgacccggccacggcctatgcgggcgctgat	Protospacer
.**.******** ************   * .*  

111. spacer 4.50|248339|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034816 (Paracoccus sp. Arc7-R13 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706

aactgacccggcaacggcctatgcgctggacgtg	CRISPR spacer
gaccgacccggccacggcctatgcgggcgctgat	Protospacer
.**.******** ************   * .*  

112. spacer 4.24|246601|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 11, identity: 0.676

agcctgcgcggccgcatcggcttccgcctgcgtg	CRISPR spacer
gctctgcgcggcttcatcggcttccgcggcaacg	Protospacer
. .*********. *************    ..*

113. spacer 4.25|246667|33|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to CP054928 (Streptomyces fulvissimus strain NA06532 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.667

atcagctcgtcgttggtcagccggacgatgtcc	CRISPR spacer
ggggagtcgtcgtcggtcagccggaagatggtg	Protospacer
.  .. *******.*********** **** . 

114. spacer 4.54|248604|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR723669 (Rhizobium sp. Khangiran2 plasmid 2) position: , mismatch: 11, identity: 0.686

aatgcggcgcgggcctatggctgacggacccgccc	CRISPR spacer
tcattggcgcggggctatggctgacgggccagttg	Protospacer
    .******** *************.** *.. 

115. spacer 4.57|248808|35|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 11, identity: 0.686

aaaaagccgccgacaaacgcggcaaccggcccggc	CRISPR spacer
atcgcgccgccgacaaaagtggcaaccggcggcat	Protospacer
*  . ************ *.**********   ..

116. spacer 4.19|246271|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to MG592644 (Vibrio phage 1.276.O._10N.286.54.E4, partial genome) position: , mismatch: 12, identity: 0.647

gatttcgtcgcttacgacgcctatctgatttcgg	CRISPR spacer
acaagtacagctcacaacgcctatctgatttcgt	Protospacer
.    ... ***.**.***************** 

117. spacer 4.19|246271|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to MG592567 (Vibrio phage 1.198.A._10N.286.54.F4, partial genome) position: , mismatch: 12, identity: 0.647

gatttcgtcgcttacgacgcctatctgatttcgg	CRISPR spacer
acaagtacagctcacaacgcctatctgatttcgt	Protospacer
.    ... ***.**.***************** 

118. spacer 4.19|246271|34|AYQC01000013|PILER-CR,CRISPRCasFinder,CRT matches to MG592568 (Vibrio phage 1.198.B._10N.286.54.F4, partial genome) position: , mismatch: 12, identity: 0.647

gatttcgtcgcttacgacgcctatctgatttcgg	CRISPR spacer
acaagtacagctcacaacgcctatctgatttcgt	Protospacer
.    ... ***.**.***************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. AYQC01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. AYQC01000026
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AYQC01000026_1 192115-192439 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000001.1 15207-15222 1 0.938
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000005.1 305734-305749 1 0.938
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000013.1 343897-343912 1 0.938
AYQC01000026_1 1.6|192401|16|AYQC01000026|CRISPRCasFinder 192401-192416 16 AYQC01000017.1 34079-34094 1 0.938
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000001.1 19473-19488 2 0.875
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000001.1 125494-125509 2 0.875
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000001.1 126409-126424 2 0.875
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000005.1 235257-235272 2 0.875
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000005.1 250054-250069 2 0.875
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000008.1 258784-258799 2 0.875
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000009.1 11819-11834 2 0.875
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000009.1 124569-124584 2 0.875
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000012.1 24073-24088 2 0.875
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000012.1 84445-84460 2 0.875
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000018.1 152103-152118 2 0.875
AYQC01000026_1 1.1|192138|16|AYQC01000026|CRISPRCasFinder 192138-192153 16 AYQC01000023.1 18865-18880 2 0.875
AYQC01000026_1 1.6|192401|16|AYQC01000026|CRISPRCasFinder 192401-192416 16 AYQC01000001.1 81415-81430 2 0.875
AYQC01000026_1 1.6|192401|16|AYQC01000026|CRISPRCasFinder 192401-192416 16 AYQC01000001.1 248400-248415 2 0.875
AYQC01000026_1 1.6|192401|16|AYQC01000026|CRISPRCasFinder 192401-192416 16 AYQC01000008.1 213866-213881 2 0.875
AYQC01000026_1 1.6|192401|16|AYQC01000026|CRISPRCasFinder 192401-192416 16 AYQC01000018.1 10212-10227 2 0.875
AYQC01000026_1 1.6|192401|16|AYQC01000026|CRISPRCasFinder 192401-192416 16 AYQC01000018.1 113253-113268 2 0.875
AYQC01000026_1 1.6|192401|16|AYQC01000026|CRISPRCasFinder 192401-192416 16 AYQC01000018.1 207195-207210 2 0.875
AYQC01000026_1 1.6|192401|16|AYQC01000026|CRISPRCasFinder 192401-192416 16 AYQC01000023.1 637-652 2 0.875
AYQC01000026_1 1.6|192401|16|AYQC01000026|CRISPRCasFinder 192401-192416 16 AYQC01000027.1 131925-131940 2 0.875
AYQC01000026_1 1.6|192401|16|AYQC01000026|CRISPRCasFinder 192401-192416 16 AYQC01000032.1 42970-42985 2 0.875

1. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 15207-15222, mismatch: 1, identity: 0.938

cggagatcggcggcat	CRISPR spacer
cgcagatcggcggcat	Protospacer
** *************

2. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 305734-305749, mismatch: 1, identity: 0.938

cggagatcggcggcat	CRISPR spacer
cgcagatcggcggcat	Protospacer
** *************

3. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 343897-343912, mismatch: 1, identity: 0.938

cggagatcggcggcat	CRISPR spacer
cgcagatcggcggcat	Protospacer
** *************

4. spacer 1.6|192401|16|AYQC01000026|CRISPRCasFinder matches to position: 34079-34094, mismatch: 1, identity: 0.938

aggttatcgcggcggc	CRISPR spacer
aggtgatcgcggcggc	Protospacer
**** ***********

5. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 19473-19488, mismatch: 2, identity: 0.875

cggagatcggcggcat	CRISPR spacer
cgcagatcggcgtcat	Protospacer
** ********* ***

6. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 125494-125509, mismatch: 2, identity: 0.875

cggagatcggcggcat	CRISPR spacer
cggtgctcggcggcat	Protospacer
*** * **********

7. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 126409-126424, mismatch: 2, identity: 0.875

cggagatcggcggcat	CRISPR spacer
cgcagatcggtggcat	Protospacer
** *******.*****

8. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 235257-235272, mismatch: 2, identity: 0.875

cggagatcggcggcat	CRISPR spacer
cggacctcggcggcat	Protospacer
****  **********

9. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 250054-250069, mismatch: 2, identity: 0.875

cggagatcggcggcat	CRISPR spacer
cggagagccgcggcat	Protospacer
****** * *******

10. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 258784-258799, mismatch: 2, identity: 0.875

cggagatcggcggcat	CRISPR spacer
cggtgatcggcgacat	Protospacer
*** ********.***

11. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 11819-11834, mismatch: 2, identity: 0.875

cggagatcggcggcat	CRISPR spacer
cggaaataggcggcat	Protospacer
****.** ********

12. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 124569-124584, mismatch: 2, identity: 0.875

cggagatcggcggcat	CRISPR spacer
cggagatcgacgtcat	Protospacer
*********.** ***

13. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 24073-24088, mismatch: 2, identity: 0.875

cggagatcggcggcat	CRISPR spacer
cggacatctgcggcat	Protospacer
**** *** *******

14. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 84445-84460, mismatch: 2, identity: 0.875

cggagatcggcggcat	CRISPR spacer
cggaaaccggcggcat	Protospacer
****.*.*********

15. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 152103-152118, mismatch: 2, identity: 0.875

cggagatcggcggcat	CRISPR spacer
cggggatcggcagcat	Protospacer
***.*******.****

16. spacer 1.1|192138|16|AYQC01000026|CRISPRCasFinder matches to position: 18865-18880, mismatch: 2, identity: 0.875

cggagatcggcggcat	CRISPR spacer
cggtggtcggcggcat	Protospacer
*** *.**********

17. spacer 1.6|192401|16|AYQC01000026|CRISPRCasFinder matches to position: 81415-81430, mismatch: 2, identity: 0.875

aggttatcgcggcggc	CRISPR spacer
aggtgatcgcgggggc	Protospacer
**** ******* ***

18. spacer 1.6|192401|16|AYQC01000026|CRISPRCasFinder matches to position: 248400-248415, mismatch: 2, identity: 0.875

aggttatcgcggcggc	CRISPR spacer
aggtcagcgcggcggc	Protospacer
****.* *********

19. spacer 1.6|192401|16|AYQC01000026|CRISPRCasFinder matches to position: 213866-213881, mismatch: 2, identity: 0.875

aggttatcgcggcggc	CRISPR spacer
aggggatcgcggcggc	Protospacer
***  ***********

20. spacer 1.6|192401|16|AYQC01000026|CRISPRCasFinder matches to position: 10212-10227, mismatch: 2, identity: 0.875

aggttatcgcggcggc	CRISPR spacer
aggtgatggcggcggc	Protospacer
**** ** ********

21. spacer 1.6|192401|16|AYQC01000026|CRISPRCasFinder matches to position: 113253-113268, mismatch: 2, identity: 0.875

aggttatcgcggcggc	CRISPR spacer
agctgatcgcggcggc	Protospacer
** * ***********

22. spacer 1.6|192401|16|AYQC01000026|CRISPRCasFinder matches to position: 207195-207210, mismatch: 2, identity: 0.875

aggttatcgcggcggc	CRISPR spacer
aggagatcgcggcggc	Protospacer
***  ***********

23. spacer 1.6|192401|16|AYQC01000026|CRISPRCasFinder matches to position: 637-652, mismatch: 2, identity: 0.875

aggttatcgcggcggc	CRISPR spacer
aggttttcgcggcagc	Protospacer
***** *******.**

24. spacer 1.6|192401|16|AYQC01000026|CRISPRCasFinder matches to position: 131925-131940, mismatch: 2, identity: 0.875

aggttatcgcggcggc	CRISPR spacer
agctgatcgcggcggc	Protospacer
** * ***********

25. spacer 1.6|192401|16|AYQC01000026|CRISPRCasFinder matches to position: 42970-42985, mismatch: 2, identity: 0.875

aggttatcgcggcggc	CRISPR spacer
aggtgatcacggcggc	Protospacer
**** ***.*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 133907 : 148245 16 Streptococcus_phage(22.22%) integrase,capsid,terminase,portal,head,tail attL 133784:133800|attR 151467:151483
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. AYQC01000023
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12073 : 21290 8 Klosneuvirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. AYQC01000009
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. AYQC01000018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 211313 : 225148 16 Paracoccus_phage(30.0%) portal,tail,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. AYQC01000030
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 314 : 19097 26 Rhodobacter_phage(43.75%) capsid NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
AYQC01000030.1|ETD74580.1|17445_17703_-|hypothetical-protein 17445_17703_- 85 aa aa AcrVIA6 HTH_Hin_like,HTH_XRE NA 314-19097 NA
13. AYQC01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. AYQC01000012
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 40178 56 Rhodobacter_phage(98.15%) head,tail,portal,integrase,transposase attL 1971:1989|attR 34379:34397
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. AYQC01000032
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage