Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
KI271369 Leptotrichia wadei F0279 genomic scaffold Scaffold158, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271386 Leptotrichia wadei F0279 genomic scaffold Scaffold290, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271385 Leptotrichia wadei F0279 genomic scaffold Scaffold29, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271373 Leptotrichia wadei F0279 genomic scaffold Scaffold177, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271420 Leptotrichia wadei F0279 genomic scaffold Scaffold721, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
KI271426 Leptotrichia wadei F0279 genomic scaffold Scaffold88, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271415 Leptotrichia wadei F0279 genomic scaffold Scaffold66, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
KI271367 Leptotrichia wadei F0279 genomic scaffold Scaffold14, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271421 Leptotrichia wadei F0279 genomic scaffold Scaffold804, whole genome shotgun sequence 2 crisprs cas2,cas1,cas13a 4 7 0 0
KI271371 Leptotrichia wadei F0279 genomic scaffold Scaffold164, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271392 Leptotrichia wadei F0279 genomic scaffold Scaffold35, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271384 Leptotrichia wadei F0279 genomic scaffold Scaffold287, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271410 Leptotrichia wadei F0279 genomic scaffold Scaffold61, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271381 Leptotrichia wadei F0279 genomic scaffold Scaffold24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271393 Leptotrichia wadei F0279 genomic scaffold Scaffold355, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271409 Leptotrichia wadei F0279 genomic scaffold Scaffold6, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271377 Leptotrichia wadei F0279 genomic scaffold Scaffold206, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271397 Leptotrichia wadei F0279 genomic scaffold Scaffold43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271416 Leptotrichia wadei F0279 genomic scaffold Scaffold67, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
KI271395 Leptotrichia wadei F0279 genomic scaffold Scaffold41, whole genome shotgun sequence 1 crisprs cas2,cas1,cas13a 0 2 0 0
KI271378 Leptotrichia wadei F0279 genomic scaffold Scaffold215, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271372 Leptotrichia wadei F0279 genomic scaffold Scaffold171, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
KI271424 Leptotrichia wadei F0279 genomic scaffold Scaffold823, whole genome shotgun sequence 0 crisprs DinG,PD-DExK,cas2,cas1,cas13a 0 0 1 2
KI271413 Leptotrichia wadei F0279 genomic scaffold Scaffold63, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271425 Leptotrichia wadei F0279 genomic scaffold Scaffold83, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271418 Leptotrichia wadei F0279 genomic scaffold Scaffold69, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271370 Leptotrichia wadei F0279 genomic scaffold Scaffold16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271388 Leptotrichia wadei F0279 genomic scaffold Scaffold30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271402 Leptotrichia wadei F0279 genomic scaffold Scaffold49, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
KI271362 Leptotrichia wadei F0279 genomic scaffold Scaffold10, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271398 Leptotrichia wadei F0279 genomic scaffold Scaffold452, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271414 Leptotrichia wadei F0279 genomic scaffold Scaffold64, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271365 Leptotrichia wadei F0279 genomic scaffold Scaffold13, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271361 Leptotrichia wadei F0279 genomic scaffold Scaffold1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271406 Leptotrichia wadei F0279 genomic scaffold Scaffold55, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271432 Leptotrichia wadei F0279 genomic scaffold Scaffold96, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271412 Leptotrichia wadei F0279 genomic scaffold Scaffold625, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271417 Leptotrichia wadei F0279 genomic scaffold Scaffold679, whole genome shotgun sequence 0 crisprs cas2,DEDDh 0 0 0 0
KI271379 Leptotrichia wadei F0279 genomic scaffold Scaffold22, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271428 Leptotrichia wadei F0279 genomic scaffold Scaffold90, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271403 Leptotrichia wadei F0279 genomic scaffold Scaffold50, whole genome shotgun sequence 0 crisprs cas3,cas14j 0 0 0 0
KI271383 Leptotrichia wadei F0279 genomic scaffold Scaffold26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271380 Leptotrichia wadei F0279 genomic scaffold Scaffold23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271375 Leptotrichia wadei F0279 genomic scaffold Scaffold196, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271407 Leptotrichia wadei F0279 genomic scaffold Scaffold558, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271374 Leptotrichia wadei F0279 genomic scaffold Scaffold178, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271364 Leptotrichia wadei F0279 genomic scaffold Scaffold11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271411 Leptotrichia wadei F0279 genomic scaffold Scaffold62, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271363 Leptotrichia wadei F0279 genomic scaffold Scaffold104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271366 Leptotrichia wadei F0279 genomic scaffold Scaffold135, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271399 Leptotrichia wadei F0279 genomic scaffold Scaffold46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271430 Leptotrichia wadei F0279 genomic scaffold Scaffold94, whole genome shotgun sequence 0 crisprs NA 0 0 2 3
KI271394 Leptotrichia wadei F0279 genomic scaffold Scaffold377, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271427 Leptotrichia wadei F0279 genomic scaffold Scaffold9, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271391 Leptotrichia wadei F0279 genomic scaffold Scaffold33, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271360 Leptotrichia wadei F0279 genomic scaffold Scaffold0, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271390 Leptotrichia wadei F0279 genomic scaffold Scaffold32, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271396 Leptotrichia wadei F0279 genomic scaffold Scaffold42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271400 Leptotrichia wadei F0279 genomic scaffold Scaffold48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271382 Leptotrichia wadei F0279 genomic scaffold Scaffold25, whole genome shotgun sequence 2 crisprs NA 0 0 0 0
KI271431 Leptotrichia wadei F0279 genomic scaffold Scaffold95, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271433 Leptotrichia wadei F0279 genomic scaffold Scaffold98, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271419 Leptotrichia wadei F0279 genomic scaffold Scaffold710, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271401 Leptotrichia wadei F0279 genomic scaffold Scaffold484, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271389 Leptotrichia wadei F0279 genomic scaffold Scaffold31, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271408 Leptotrichia wadei F0279 genomic scaffold Scaffold57, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271376 Leptotrichia wadei F0279 genomic scaffold Scaffold2, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271387 Leptotrichia wadei F0279 genomic scaffold Scaffold3, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271404 Leptotrichia wadei F0279 genomic scaffold Scaffold51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271429 Leptotrichia wadei F0279 genomic scaffold Scaffold93, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271368 Leptotrichia wadei F0279 genomic scaffold Scaffold15, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271405 Leptotrichia wadei F0279 genomic scaffold Scaffold517, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271423 Leptotrichia wadei F0279 genomic scaffold Scaffold82, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
KI271422 Leptotrichia wadei F0279 genomic scaffold Scaffold809, whole genome shotgun sequence 0 crisprs cas3 0 0 1 2

Results visualization

1. KI271371
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. KI271397
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. KI271422
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15165 : 50181 54 Clostridium_phage(40.91%) portal,plate,tail,terminase,integrase attL 3917:3932|attR 33943:33958
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
KI271422.1|ERK48333.1|22211_22442_+|hypothetical-protein 22211_22442_+ 76 aa aa AcrVIA4 NA NA 15165-50181 NA
KI271422.1|ERK48335.1|22880_23141_+|hypothetical-protein 22880_23141_+ 86 aa aa AcrVIA3 NA NA 15165-50181 NA
4. KI271395
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
KI271395_1 24616-24775 TypeVI-A NA
2 spacers
cas2,cas1,cas13a

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
KI271395_1 1.1|24655|28|KI271395|PILER-CR 24655-24682 28 MT074146 Bacteroides phage SJC03, complete genome 52403-52430 5 0.821
KI271395_1 1.2|24722|29|KI271395|PILER-CR 24722-24750 29 AP014312 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S30-C72, *** SEQUENCING IN PROGRESS *** 17695-17723 7 0.759

1. spacer 1.1|24655|28|KI271395|PILER-CR matches to MT074146 (Bacteroides phage SJC03, complete genome) position: , mismatch: 5, identity: 0.821

aagataatacaacattaggactttattt	CRISPR spacer
aagataatacatcaataggacttcttgt	Protospacer
*********** ** ********. * *

2. spacer 1.2|24722|29|KI271395|PILER-CR matches to AP014312 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S30-C72, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759

taaaaagcttttcttctaacaggggggaa	CRISPR spacer
taaaaagcttttcttcttacaacacttaa	Protospacer
***************** ***. .   **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. KI271382
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
KI271382_1 19572-19676 Orphan I-B
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
KI271382_2 19775-19878 Orphan I-B
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. KI271421
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
KI271421_1 63701-64006 TypeVI-A NA
4 spacers
cas2,cas1,cas13a

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
KI271421_2 64093-64331 TypeVI-A NA
3 spacers
cas2,cas1,cas13a

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
KI271421_1 1.4|63940|29|KI271421|CRT 63940-63968 29 KI271397.1 451-479 0 1.0
KI271421_2 2.1|64132|28|KI271421|PILER-CR 64132-64159 28 KI271421.1 88-115 0 1.0
KI271421_2 2.1|64132|28|KI271421|PILER-CR 64132-64159 28 KI271422.1 55761-55788 0 1.0
KI271421_2 2.6|64130|31|KI271421|CRT 64130-64160 31 KI271421.1 86-116 0 1.0
KI271421_2 2.6|64130|31|KI271421|CRT 64130-64160 31 KI271422.1 55759-55789 0 1.0
KI271421_2 2.8|64264|32|KI271421|CRT 64264-64295 32 KI271371.1 5327-5358 0 1.0

1. spacer 1.4|63940|29|KI271421|CRT matches to position: 451-479, mismatch: 0, identity: 1.0

tttatatcaattcttgcatcaagctccaa	CRISPR spacer
tttatatcaattcttgcatcaagctccaa	Protospacer
*****************************

2. spacer 2.1|64132|28|KI271421|PILER-CR matches to position: 88-115, mismatch: 0, identity: 1.0

tctctttcaatctaaatgaattatatca	CRISPR spacer
tctctttcaatctaaatgaattatatca	Protospacer
****************************

3. spacer 2.1|64132|28|KI271421|PILER-CR matches to position: 55761-55788, mismatch: 0, identity: 1.0

tctctttcaatctaaatgaattatatca	CRISPR spacer
tctctttcaatctaaatgaattatatca	Protospacer
****************************

4. spacer 2.6|64130|31|KI271421|CRT matches to position: 86-116, mismatch: 0, identity: 1.0

aatctctttcaatctaaatgaattatatcat	CRISPR spacer
aatctctttcaatctaaatgaattatatcat	Protospacer
*******************************

5. spacer 2.6|64130|31|KI271421|CRT matches to position: 55759-55789, mismatch: 0, identity: 1.0

aatctctttcaatctaaatgaattatatcat	CRISPR spacer
aatctctttcaatctaaatgaattatatcat	Protospacer
*******************************

6. spacer 2.8|64264|32|KI271421|CRT matches to position: 5327-5358, mismatch: 0, identity: 1.0

aacctagaagatgcagaacaatgggctgtaaa	CRISPR spacer
aacctagaagatgcagaacaatgggctgtaaa	Protospacer
********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
KI271421_2 2.8|64264|32|KI271421|CRT 64264-64295 32 NZ_AP019838 Leptotrichia wadei strain JMUB3934 plasmid pJMUB3934p3, complete sequence 4866-4897 0 1.0
KI271421_1 1.6|63874|27|KI271421|PILER-CR 63874-63900 27 NZ_LR214954 Mycoplasma neurolyticum strain NCTC10166 plasmid 4 15982-16008 3 0.889
KI271421_2 2.6|64130|31|KI271421|CRT 64130-64160 31 NZ_CP025980 Escherichia marmotae strain HT073016 plasmid pEM148, complete sequence 77355-77385 3 0.903
KI271421_1 1.3|63874|28|KI271421|CRT 63874-63901 28 NZ_LR214954 Mycoplasma neurolyticum strain NCTC10166 plasmid 4 15981-16008 4 0.857
KI271421_2 2.5|64257|39|KI271421|CRISPRCasFinder 64257-64295 39 NZ_AP019838 Leptotrichia wadei strain JMUB3934 plasmid pJMUB3934p3, complete sequence 4859-4897 4 0.897
KI271421_1 1.3|63874|28|KI271421|CRT 63874-63901 28 AP013781 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C14-MedDCM-OCT-S40-C51, *** SEQUENCING IN PROGRESS *** 4670-4697 5 0.821
KI271421_1 1.6|63874|27|KI271421|PILER-CR 63874-63900 27 AP013781 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C14-MedDCM-OCT-S40-C51, *** SEQUENCING IN PROGRESS *** 4670-4696 5 0.815
KI271421_1 1.1|63739|29|KI271421|CRT 63739-63767 29 NZ_CP015507 Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence 238603-238631 6 0.793
KI271421_1 1.1|63739|29|KI271421|CRT 63739-63767 29 NZ_AP019800 Vibrio rotiferianus strain AM7 plasmid pAM7, complete sequence 37946-37974 6 0.793
KI271421_1 1.4|63940|29|KI271421|CRT 63940-63968 29 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 166407-166435 7 0.759
KI271421_2 2.8|64264|32|KI271421|CRT 64264-64295 32 MH248138 Erwinia phage vB_EamM_Alexandra, complete genome 122700-122731 8 0.75
KI271421_2 2.8|64264|32|KI271421|CRT 64264-64295 32 NZ_CP015507 Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence 340062-340093 9 0.719

1. spacer 2.8|64264|32|KI271421|CRT matches to NZ_AP019838 (Leptotrichia wadei strain JMUB3934 plasmid pJMUB3934p3, complete sequence) position: , mismatch: 0, identity: 1.0

aacctagaagatgcagaacaatgggctgtaaa	CRISPR spacer
aacctagaagatgcagaacaatgggctgtaaa	Protospacer
********************************

2. spacer 1.6|63874|27|KI271421|PILER-CR matches to NZ_LR214954 (Mycoplasma neurolyticum strain NCTC10166 plasmid 4) position: , mismatch: 3, identity: 0.889

atgtagaagaagttattgtatctattt	CRISPR spacer
atgttgaagaagttgttgtatctatat	Protospacer
**** *********.********** *

3. spacer 2.6|64130|31|KI271421|CRT matches to NZ_CP025980 (Escherichia marmotae strain HT073016 plasmid pEM148, complete sequence) position: , mismatch: 3, identity: 0.903

aatctctttcaatctaaatgaattatatcat-	CRISPR spacer
aatctctttcaatataaatcaa-tatatcatc	Protospacer
************* ***** ** ******** 

4. spacer 1.3|63874|28|KI271421|CRT matches to NZ_LR214954 (Mycoplasma neurolyticum strain NCTC10166 plasmid 4) position: , mismatch: 4, identity: 0.857

atgtagaagaagttattgtatctatttt	CRISPR spacer
atgttgaagaagttgttgtatctatata	Protospacer
**** *********.********** * 

5. spacer 2.5|64257|39|KI271421|CRISPRCasFinder matches to NZ_AP019838 (Leptotrichia wadei strain JMUB3934 plasmid pJMUB3934p3, complete sequence) position: , mismatch: 4, identity: 0.897

ctaaatcaacctagaagatgcagaacaatgggctgtaaa	CRISPR spacer
gcaaaataacctagaagatgcagaacaatgggctgtaaa	Protospacer
 .*** .********************************

6. spacer 1.3|63874|28|KI271421|CRT matches to AP013781 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C14-MedDCM-OCT-S40-C51, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 5, identity: 0.821

atgtagaagaagttattgtatctatttt	CRISPR spacer
gtgtagaagaaggtattgtctctaatct	Protospacer
.*********** ****** **** *.*

7. spacer 1.6|63874|27|KI271421|PILER-CR matches to AP013781 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C14-MedDCM-OCT-S40-C51, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 5, identity: 0.815

atgtagaagaagttattgtatctattt	CRISPR spacer
gtgtagaagaaggtattgtctctaatc	Protospacer
.*********** ****** **** *.

8. spacer 1.1|63739|29|KI271421|CRT matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 6, identity: 0.793

agaaatggttttgtctaaatgatgtatgt	CRISPR spacer
agaaatggttttttctaaattatcctttt	Protospacer
************ ******* ** . * *

9. spacer 1.1|63739|29|KI271421|CRT matches to NZ_AP019800 (Vibrio rotiferianus strain AM7 plasmid pAM7, complete sequence) position: , mismatch: 6, identity: 0.793

agaaatggttttgtctaaatgatgtatgt	CRISPR spacer
ggaaatggtattggctaaatgatgggttt	Protospacer
.******** *** ********** .* *

10. spacer 1.4|63940|29|KI271421|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.759

tttatatcaattcttgcatcaagctccaa	CRISPR spacer
ccgatatcaactcttgcatcaagcccgca	Protospacer
.. *******.*************.*  *

11. spacer 2.8|64264|32|KI271421|CRT matches to MH248138 (Erwinia phage vB_EamM_Alexandra, complete genome) position: , mismatch: 8, identity: 0.75

aacctagaagatgcagaacaatgggctgtaaa	CRISPR spacer
gcatgagaagatgcagaacagtgggctgtgat	Protospacer
.  . ***************.********.* 

12. spacer 2.8|64264|32|KI271421|CRT matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 9, identity: 0.719

aacctagaagatgcagaacaatgggctgtaaa	CRISPR spacer
tgcctagaaggtgcacaacaatgggtagtttc	Protospacer
 .********.**** *********. **   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. KI271424
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 84233 : 93540 7 Staphylococcus_phage(33.33%) NA NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
KI271424.1|ERK48068.1|23497_24073_-|hypothetical-protein 23497_24073_- 191 aa aa AcrIB NA NA No NA
KI271424.1|ERK48092.1|44242_44617_+|hypothetical-protein 44242_44617_+ 124 aa aa AcrVIA5 NA NA No NA
8. KI271430
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2368 : 29703 48 Fusobacterium_phage(29.41%) tail,plate,terminase,portal NA
DBSCAN-SWA_2 36666 : 41595 11 Clostridium_phage(50.0%) integrase attL 38459:38470|attR 41651:41662
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
KI271430.1|ERK51680.1|27783_28008_-|hypothetical-protein 27783_28008_- 74 aa aa AcrVIA1 NA NA 2368-29703 NA
KI271430.1|ERK51681.1|27970_28204_-|hypothetical-protein 27970_28204_- 77 aa aa AcrVIA2 NA NA 2368-29703 NA
KI271430.1|ERK51685.1|29811_30051_-|hypothetical-protein 29811_30051_- 79 aa aa AcrVIA3 NA NA No NA