The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR792628	Klebsiella pneumoniae isolate SB5881 chromosome SB5881_omosome	5448386	1784019	1790926	5448386	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_042940510.1|1784019_1784883_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|1784893_1785667_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|1785909_1786806_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_016529104.1|1787048_1788410_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	8.8e-207
WP_016529103.1|1788728_1789451_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1789447_1790926_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 2
NZ_LR792628	Klebsiella pneumoniae isolate SB5881 chromosome SB5881_omosome	5448386	1887930	1990499	5448386	terminase,transposase,integrase,tRNA,tail,portal,holin,protease	Enterobacteria_phage(23.08%)	104	1887816:1887840	1917916:1917940
1887816:1887840	attL	TGTCAAGACCACCAGAATGACCACC	NA	NA	NA	NA
WP_085955508.1|1887930_1889051_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
WP_004899307.1|1889390_1890197_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016529980.1|1890273_1892313_+	FUSC family protein	NA	NA	NA	NA	NA
WP_004899298.1|1892302_1892518_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_004899294.1|1892514_1893378_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_016530710.1|1896908_1897715_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016530711.1|1897887_1899075_+	MFS transporter	NA	NA	NA	NA	NA
WP_004899261.1|1899051_1901826_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016529049.1|1902061_1902919_-	EamA family transporter	NA	NA	NA	NA	NA
WP_004899254.1|1902918_1903803_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004899253.1|1903879_1904776_+	oxidoreductase	NA	NA	NA	NA	NA
WP_032105408.1|1904787_1905510_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_004899245.1|1905659_1906928_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	9.7e-75
WP_004151469.1|1907357_1908794_+	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_004148975.1|1909159_1910614_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004141189.1|1910743_1910989_-	signal transduction protein PmrD	NA	NA	NA	NA	NA
WP_042940675.1|1911261_1912884_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004184763.1|1912794_1913727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009484420.1|1913847_1914825_-	oxidoreductase	NA	NA	NA	NA	NA
WP_016530080.1|1914821_1915526_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016530081.1|1916117_1917752_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_001560582.1|1918108_1918600_+	hypothetical protein	NA	NA	NA	NA	NA
1917916:1917940	attR	TGTCAAGACCACCAGAATGACCACC	NA	NA	NA	NA
WP_115217266.1|1918900_1920129_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.0	1.1e-168
WP_014228879.1|1920735_1921080_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016160636.1|1921122_1921317_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_012542200.1|1922159_1922549_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
WP_012542199.1|1922650_1922866_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_014907826.1|1922868_1923423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171819471.1|1924243_1924915_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	69.5	1.9e-61
WP_016528969.1|1924928_1925369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016528968.1|1925747_1926329_+	ComF family protein	NA	NA	NA	NA	NA
WP_016528967.1|1926331_1926886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016528966.1|1927308_1928013_-	hypothetical protein	NA	A0A1B1IPD9	uncultured_Mediterranean_phage	41.6	2.5e-19
WP_012542186.1|1928365_1928599_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
WP_077253592.1|1928610_1928901_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	1.4e-16
WP_016528965.1|1928941_1929334_+	LexA DNA binding domain-containing protein	NA	K7PHB4	Enterobacterial_phage	35.6	6.8e-11
WP_174893368.1|1929534_1930566_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	48.4	9.9e-94
WP_016528963.1|1930578_1930926_+	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	83.6	3.1e-52
WP_016528962.1|1930944_1931829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023159888.1|1931838_1932351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016528961.1|1933303_1933540_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	87.0	2.1e-28
WP_042940377.1|1933517_1934048_+	lysozyme	NA	G9L6J6	Escherichia_phage	83.2	3.1e-83
WP_046044041.1|1934080_1934557_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_165454527.1|1934638_1934803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016528958.1|1934786_1935119_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.6	1.6e-53
WP_016528957.1|1935100_1935421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016528956.1|1935420_1935843_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	63.5	1.0e-41
WP_016530358.1|1936074_1936563_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	87.0	2.5e-71
WP_016530357.1|1936562_1938665_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	84.0	0.0e+00
WP_016530356.1|1938661_1938874_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	80.0	2.2e-24
WP_016530355.1|1938873_1940376_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.0	6.2e-246
WP_071609143.1|1940326_1942348_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	81.8	0.0e+00
WP_016530353.1|1942431_1942758_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.7	8.1e-34
WP_023342887.1|1942750_1943026_+	hypothetical protein	NA	K7PH43	Enterobacteria_phage	57.1	1.1e-23
WP_016530351.1|1943029_1943608_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	81.2	1.7e-79
WP_016530350.1|1943604_1944006_+|tail	minor tail family protein	tail	K7PHM6	Enterobacterial_phage	75.6	2.7e-55
WP_016530349.1|1944014_1944758_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	83.0	1.7e-111
WP_072216832.1|1944768_1945197_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	60.0	2.7e-37
WP_071609142.1|1945217_1945532_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	75.0	5.0e-41
WP_174893369.1|1945515_1948659_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	72.9	0.0e+00
WP_016530343.1|1948663_1949011_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	67.0	1.4e-39
WP_016530342.1|1949007_1949763_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	84.1	1.3e-130
WP_023342884.1|1949764_1950475_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.7	1.1e-136
WP_016530340.1|1950506_1951097_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.0	2.5e-81
WP_174893370.1|1951159_1959964_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	44.1	0.0e+00
WP_016532336.1|1960025_1961522_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	64.2	3.4e-127
WP_004892953.1|1961676_1961829_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_004224172.1|1962101_1962815_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004190914.1|1962811_1963204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150797.1|1963196_1963520_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_042942835.1|1963639_1963816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|1963969_1964197_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140529.1|1964309_1965503_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004150795.1|1966124_1966310_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|1966400_1966895_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|1966921_1967428_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|1967444_1968332_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|1968387_1969794_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_046043052.1|1969790_1970801_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|1970916_1971114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|1971680_1972313_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140501.1|1972352_1972532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174893371.1|1972929_1973634_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004150789.1|1973746_1973911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016532342.1|1973944_1975453_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_016532343.1|1975573_1976464_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046043054.1|1976470_1978255_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|1978328_1979537_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_046043056.1|1979839_1980883_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148038.1|1981543_1982458_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|1982547_1983186_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|1983316_1983580_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_016531462.1|1983639_1983759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|1983876_1983951_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|1983950_1984052_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_016531463.1|1984109_1985123_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.8	1.1e-12
WP_016531464.1|1985423_1985663_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|1985652_1985991_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_004176547.1|1985995_1986505_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|1986650_1987343_+	CTP synthase	NA	NA	NA	NA	NA
WP_171819493.1|1987374_1988550_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004224197.1|1988657_1989452_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|1989435_1989882_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901088.1|1989998_1990499_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 3
NZ_LR792628	Klebsiella pneumoniae isolate SB5881 chromosome SB5881_omosome	5448386	2293683	2374797	5448386	terminase,transposase,integrase,tail,capsid,head,portal,holin,protease	Escherichia_phage(19.05%)	86	2284197:2284213	2346173:2346189
2284197:2284213	attL	GATTGGCGTGCTGGCGA	NA	NA	NA	NA
WP_002903396.1|2293683_2294199_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
WP_002903398.1|2294491_2294650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530209.1|2295261_2295522_-	pyocin activator PrtN family protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_004213359.1|2295641_2295827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016530208.1|2295823_2296486_-	hypothetical protein	NA	Q71T76	Escherichia_phage	56.0	2.2e-54
WP_004213355.1|2296478_2296823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213351.1|2296950_2297736_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	5.3e-63
WP_004213349.1|2297735_2298035_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	9.4e-13
WP_016530207.1|2298802_2299462_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.7	7.3e-74
WP_016530206.1|2299554_2299752_+	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_004213338.1|2299777_2300239_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_004184738.1|2300476_2300656_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
WP_016530205.1|2300645_2301584_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	74.5	2.6e-101
WP_016530204.1|2301580_2302390_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	4.5e-110
WP_004184734.1|2302399_2302777_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
WP_004213334.1|2302789_2303770_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.6	7.1e-134
WP_004213332.1|2303783_2304362_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	3.5e-48
WP_129015083.1|2304473_2305046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213330.1|2305138_2305534_+|holin	phage holin family protein	holin	G8C7V8	Escherichia_phage	73.1	1.5e-45
WP_016530201.1|2305520_2305802_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	71.0	1.6e-30
WP_016530200.1|2305801_2306431_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	88.0	1.4e-103
WP_016530199.1|2306438_2306714_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	36.0	1.7e-05
WP_077260995.1|2306996_2307872_+	DUF4747 family protein	NA	NA	NA	NA	NA
WP_016530196.1|2307876_2308503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530194.1|2309136_2309487_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.8	7.8e-51
WP_016530193.1|2309644_2310142_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.9	5.7e-63
WP_016530192.1|2310145_2311897_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.5	6.7e-252
WP_016530191.1|2311893_2312055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530190.1|2312044_2313271_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
WP_000999827.1|2313263_2313863_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_004104235.1|2313872_2315111_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
WP_016530189.1|2315188_2315506_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	51.0	1.8e-22
WP_016530188.1|2315514_2315853_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	7.8e-40
WP_016530187.1|2315849_2316299_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	7.4e-62
WP_016530186.1|2316295_2316643_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_016530185.1|2316699_2317404_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	67.4	6.6e-81
WP_016530184.1|2317434_2317839_+|tail	phage tail assembly chaperone	tail	K7PKV6	Enterobacterial_phage	57.4	3.2e-32
WP_016530183.1|2317841_2318147_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_016530182.1|2318220_2318454_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_016530181.1|2318514_2321904_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	60.6	0.0e+00
WP_004177132.1|2321924_2322398_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004864228.1|2322384_2322861_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_022615519.1|2322873_2323254_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_016530179.1|2323250_2326328_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	61.5	0.0e+00
WP_039108567.1|2326400_2328554_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	4.8e-90
WP_022615521.1|2328566_2329301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046043215.1|2329356_2330001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004214894.1|2330168_2330468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004214887.1|2331668_2332769_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	8.3e-115
WP_022615523.1|2332897_2334016_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_046043218.1|2334135_2335581_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004892311.1|2335580_2336891_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_046043221.1|2337057_2337966_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004143055.1|2338067_2338631_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_004151560.1|2338627_2339434_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025368161.1|2339603_2340290_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_016530130.1|2340300_2340957_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_025368159.1|2340967_2342170_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_046043228.1|2342179_2343532_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_016529532.1|2343521_2344286_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_004143067.1|2344278_2344668_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_016530664.1|2345711_2346956_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
2346173:2346189	attR	TCGCCAGCACGCCAATC	NA	NA	NA	NA
WP_023316278.1|2346980_2347328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152246.1|2347491_2349144_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_046044049.1|2349198_2350635_-	anion permease	NA	NA	NA	NA	NA
WP_046043231.1|2351351_2354129_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	1.2e-66
WP_016531700.1|2354196_2355147_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_004176303.1|2355127_2355847_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_046043233.1|2355843_2357460_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_016529947.1|2357615_2357972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016529946.1|2358135_2359056_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004190310.1|2359319_2360975_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_085955508.1|2361461_2362581_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
WP_129015084.1|2362763_2363987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174893380.1|2364735_2365638_-	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_016531804.1|2365637_2366255_-	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_004148291.1|2366258_2367218_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
WP_004224637.1|2367354_2368155_-	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_016529222.1|2368154_2368988_-	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_004143106.1|2368980_2369280_-	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_174893381.1|2369297_2370140_-	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_016529225.1|2370139_2371795_-	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_002903679.1|2372019_2373054_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016529226.1|2373496_2373811_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_024623203.1|2373854_2373971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002903687.1|2373984_2374797_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 4
NZ_LR792628	Klebsiella pneumoniae isolate SB5881 chromosome SB5881_omosome	5448386	3048892	3120932	5448386	plate,transposase,tRNA,protease	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_016531392.1|3048892_3050149_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|3050419_3051031_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004898981.1|3051030_3051879_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|3052062_3053010_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004200291.1|3053134_3054814_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_004175547.1|3054814_3055861_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|3056081_3056357_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004180389.1|3056629_3057214_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|3057331_3058423_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016530916.1|3058505_3058835_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_046043538.1|3059733_3061149_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004175538.1|3061168_3061612_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_077255016.1|3061614_3062151_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_164995970.1|3062131_3063148_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_046043540.1|3063177_3064941_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_016532067.1|3068570_3069716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016532068.1|3069835_3070099_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_016532069.1|3070188_3071166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129015098.1|3071380_3072436_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_046043544.1|3072482_3073763_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_038431327.1|3073800_3075072_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_046043546.1|3075071_3076943_-	phospholipase	NA	NA	NA	NA	NA
WP_040148336.1|3077111_3078185_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_046043550.1|3078222_3079497_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_046043552.1|3081060_3083760_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.6	2.2e-15
WP_032102707.1|3084218_3085916_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004891113.1|3085919_3086573_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032102706.1|3086569_3087910_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002910650.1|3088478_3088808_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910652.1|3088922_3089462_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_016530143.1|3089487_3090186_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	9.0e-06
WP_002910657.1|3090376_3090859_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|3090968_3091868_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004899032.1|3091842_3092652_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152313.1|3092663_3093959_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_002910715.1|3094262_3095189_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910717.1|3095287_3095764_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046043555.1|3095813_3097457_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910720.1|3097740_3098634_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016530335.1|3098639_3099359_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	8.6e-12
WP_004189332.1|3099355_3100231_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004148804.1|3100227_3101514_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004175489.1|3101523_3102438_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_016530773.1|3102547_3103606_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004225356.1|3103894_3104041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530774.1|3104092_3106387_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.1e-158
WP_004175486.1|3106415_3107624_-	propionate kinase	NA	NA	NA	NA	NA
WP_004145486.1|3107651_3108983_-	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_016531140.1|3109008_3109998_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_002910764.1|3110091_3111033_-	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_004219597.1|3111209_3111353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004145488.1|3111650_3111773_+	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_016531139.1|3111810_3112611_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_029884237.1|3112603_3113590_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_002910830.1|3114028_3114775_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_002910832.1|3114791_3115607_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_004184646.1|3115603_3116533_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_046043559.1|3116526_3117966_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_042940402.1|3118251_3119637_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_115217266.1|3119704_3120932_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.0	1.1e-168
>prophage 5
NZ_LR792628	Klebsiella pneumoniae isolate SB5881 chromosome SB5881_omosome	5448386	3634912	3724852	5448386	plate,lysis,terminase,integrase,tRNA,tail,capsid,head,portal,protease	Salmonella_phage(60.0%)	94	3673452:3673467	3728989:3729004
WP_002898139.1|3634912_3636205_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3636295_3637639_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3637647_3638259_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_046042979.1|3638381_3642584_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.1e-88
WP_000228469.1|3642719_3643214_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3643746_3644715_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_046042977.1|3644829_3646596_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	1.3e-21
WP_016532437.1|3646596_3648318_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3648362_3649064_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3649417_3649636_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016532438.1|3649766_3652046_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	2.1e-165
WP_002896520.1|3652076_3652394_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3652719_3652941_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896440.1|3654941_3656057_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004176693.1|3656203_3657862_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_016529507.1|3658281_3658977_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3659092_3659992_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_004176696.1|3660135_3661788_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_016529505.1|3661798_3662767_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3662978_3663413_-	DoxX family protein	NA	NA	NA	NA	NA
WP_004176700.1|3663564_3665283_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_004176702.1|3665321_3666323_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3666333_3667776_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3667863_3668877_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004209681.1|3668873_3669704_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_174893409.1|3669735_3670875_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3671753_3672269_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3672495_3673224_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3673244_3673976_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
3673452:3673467	attL	GACAGCCTGATCCCGG	NA	NA	NA	NA
WP_002896386.1|3673982_3674699_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004141917.1|3674698_3675367_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3675550_3676282_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016531909.1|3676324_3677797_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3677793_3678510_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3678588_3679716_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3679757_3680246_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3680303_3681149_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3681145_3682099_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3682109_3683243_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3683406_3684519_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3684867_3685347_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3685435_3686338_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_016529763.1|3686452_3687175_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_016529762.1|3687158_3687446_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3687648_3687912_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3687918_3688302_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_004179131.1|3688568_3690254_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3690474_3690693_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3690783_3691884_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_016529761.1|3691880_3692366_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_046042972.1|3692362_3695440_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.4	0.0e+00
WP_000763311.1|3695432_3695552_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3695566_3695869_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001504081.1|3695923_3696439_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_016529757.1|3696448_3697621_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	5.1e-203
WP_016529756.1|3697763_3698330_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.7	4.2e-86
WP_077255116.1|3698993_3699146_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	71.1	5.8e-11
WP_016529754.1|3699126_3699309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046042969.1|3699308_3701030_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.4	3.5e-152
WP_046042967.1|3701026_3701632_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	4.0e-111
WP_046042965.1|3701624_3702533_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	9.2e-144
WP_046042963.1|3702519_3702879_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	3.6e-51
WP_016531508.1|3702875_3703454_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000829146.1|3703522_3703969_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_001039939.1|3703961_3704393_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_165957398.1|3704355_3704514_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	1.8e-15
WP_016531511.1|3704488_3704917_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	9.9e-48
WP_016531512.1|3704913_3705291_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	38.4	1.5e-15
WP_001513678.1|3705292_3705805_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	9.0e-88
WP_000171568.1|3705785_3706001_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868192.1|3706004_3706208_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_016531513.1|3706207_3706672_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	8.4e-77
WP_016531514.1|3706767_3707418_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	4.3e-111
WP_174893410.1|3707421_3708480_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_046042962.1|3708496_3709330_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	3.3e-124
WP_016529206.1|3709472_3711239_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_042940604.1|3711238_3711964_+|terminase	terminase-like family protein	terminase	E5FFI8	Burkholderia_phage	31.0	2.1e-21
WP_016529208.1|3711960_3713001_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.8	2.2e-173
WP_016529209.1|3713035_3714469_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_016529210.1|3714684_3715527_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.5	1.3e-59
WP_016529211.1|3715526_3715745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016529212.1|3716031_3716265_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	89.6	1.1e-32
WP_001154434.1|3716275_3716464_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_174893411.1|3716617_3719032_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_016529329.1|3719028_3719886_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	1.6e-161
WP_016529330.1|3719882_3720110_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_016529331.1|3720109_3720343_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	1.2e-31
WP_016529332.1|3720410_3720752_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_000956190.1|3720715_3720916_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_016529334.1|3720923_3721433_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	97.6	2.9e-86
WP_000188448.1|3721465_3721687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016529335.1|3721775_3722714_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.6	6.1e-34
WP_046044032.1|3722801_3723713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074422434.1|3723871_3724852_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.9	4.1e-97
3728989:3729004	attR	GACAGCCTGATCCCGG	NA	NA	NA	NA
>prophage 6
NZ_LR792628	Klebsiella pneumoniae isolate SB5881 chromosome SB5881_omosome	5448386	4183382	4194020	5448386	tail	Cronobacter_phage(66.67%)	8	NA	NA
WP_029884077.1|4183382_4185566_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.7	1.3e-82
WP_174893424.1|4185652_4188124_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.2	1.1e-202
WP_016531193.1|4188110_4188506_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	52.8	2.3e-35
WP_004223344.1|4188502_4188973_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	37.0	9.9e-25
WP_023283377.1|4188972_4189449_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	3.0e-37
WP_071609155.1|4189562_4189829_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_016531188.1|4189805_4189985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174893425.1|4191602_4194020_-|tail	phage tail protein	tail	F1C5E9	Cronobacter_phage	62.3	7.5e-209
>prophage 7
NZ_LR792628	Klebsiella pneumoniae isolate SB5881 chromosome SB5881_omosome	5448386	4197975	4235092	5448386	coat,tRNA,head	Cronobacter_phage(19.15%)	55	NA	NA
WP_174893426.1|4197975_4198443_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	37.7	9.5e-20
WP_061353713.1|4198485_4198938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016528886.1|4198934_4199507_-	SocA family protein	NA	NA	NA	NA	NA
WP_016528887.1|4199817_4200507_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	3.5e-63
WP_016528888.1|4200575_4201340_-	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.8	1.2e-40
WP_016528889.1|4201398_4201782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016528890.1|4201778_4202147_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	80.3	8.8e-45
WP_016528891.1|4202149_4202512_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	2.5e-20
WP_016528892.1|4202511_4202685_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	5.4e-13
WP_016528893.1|4202684_4203065_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_159209652.1|4203067_4203379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016529581.1|4203411_4204467_-|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.0	6.5e-101
WP_016529582.1|4204463_4204925_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_016529583.1|4204924_4206280_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	52.4	8.1e-128
WP_129015077.1|4206509_4207526_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.2	5.9e-115
WP_016529585.1|4207443_4208892_-	hypothetical protein	NA	F1C5D7	Cronobacter_phage	51.2	1.9e-119
WP_016529586.1|4208903_4210376_-	hypothetical protein	NA	G0ZND4	Cronobacter_phage	85.9	1.8e-253
WP_016529587.1|4210362_4210842_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	85.0	9.0e-58
WP_016529588.1|4210874_4211510_-	hypothetical protein	NA	I6S676	Salmonella_phage	82.5	5.5e-103
WP_016529589.1|4212133_4212511_-	hypothetical protein	NA	M9NYX9	Enterobacteria_phage	47.5	4.7e-09
WP_016529590.1|4212611_4213115_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	2.9e-75
WP_004146347.1|4213117_4213432_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_016530705.1|4214247_4214937_-	phage antitermination protein Q	NA	I6PDF8	Cronobacter_phage	54.1	1.1e-61
WP_016530704.1|4214933_4215464_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	3.0e-30
WP_109266547.1|4215456_4215594_-	YlcG family protein	NA	NA	NA	NA	NA
WP_016530703.1|4215590_4216226_-	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	78.4	3.5e-81
WP_016530702.1|4216218_4216389_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	4.3e-15
WP_016530701.1|4216369_4216837_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	1.5e-33
WP_016530700.1|4217088_4217394_-	hypothetical protein	NA	K7PJS3	Enterobacterial_phage	62.5	1.1e-27
WP_016530698.1|4218297_4218486_-	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	88.7	6.3e-23
WP_052715514.1|4218485_4219058_-	hypothetical protein	NA	H2BD37	Pseudomonas_phage	50.5	1.5e-22
WP_016530554.1|4219054_4219783_-	site-specific DNA-methyltransferase	NA	A0A2I7QM56	Vibrio_phage	59.4	1.0e-76
WP_016530553.1|4219779_4220142_-	hypothetical protein	NA	Q5G8U7	Enterobacteria_phage	84.5	5.2e-58
WP_016530552.1|4220138_4220609_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	32.5	6.0e-06
WP_016530551.1|4220605_4220899_-	hypothetical protein	NA	O48423	Enterobacteria_phage	65.6	4.3e-26
WP_077261005.1|4220895_4221747_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	64.3	7.9e-89
WP_016530549.1|4221749_4222619_-	replication protein	NA	K7PGT1	Enterobacteria_phage	49.8	7.9e-60
WP_016530548.1|4222653_4222938_-	bacteriophage CII family protein	NA	K7PHN8	Enterobacterial_phage	56.2	2.2e-19
WP_004201115.1|4222978_4223206_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_032422319.1|4223317_4224016_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	83.6	6.9e-107
WP_046042794.1|4224094_4225015_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	48.2	5.9e-90
WP_042940647.1|4225055_4225259_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	7.0e-20
WP_016529272.1|4225545_4225704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016529274.1|4225908_4226424_+	HNH endonuclease	NA	A0A291AXF2	Shigella_phage	51.6	8.5e-38
WP_016529276.1|4226745_4227030_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_029602661.1|4227045_4227891_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.2	1.5e-68
WP_016529278.1|4227887_4228568_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.6	5.7e-122
WP_016529279.1|4228564_4228723_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
WP_016529281.1|4229461_4230184_+	hypothetical protein	NA	R9VWB9	Serratia_phage	66.5	4.8e-87
WP_016529282.1|4230180_4230558_+	DUF2591 family protein	NA	A0A1J0GUX1	Halomonas_phage	31.6	4.0e-08
WP_016529283.1|4230554_4230773_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
WP_016529284.1|4230774_4231110_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004143017.1|4232580_4233447_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_016529287.1|4233448_4233661_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4233706_4235092_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
NZ_LR792629	Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II	160760	11438	103733	160760	integrase,transposase	Shigella_phage(13.33%)	59	11410:11428	35902:35920
11410:11428	attL	TACAGGACGTCATGCCAGG	NA	NA	NA	NA
WP_016530750.1|11438_12179_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	9.1e-25
WP_016530749.1|12939_13476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046042002.1|14735_15752_+|transposase	IS110-like element ISKpn2 family transposase	transposase	NA	NA	NA	NA
WP_016529496.1|21410_23585_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	30.6	2.8e-05
WP_016529497.1|24044_25274_-	esterase family protein	NA	NA	NA	NA	NA
WP_046042014.1|25379_29024_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.7	2.5e-46
WP_016529499.1|29166_30282_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_074160420.1|30297_30525_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016529500.1|30631_31276_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.2	2.1e-54
WP_016529501.1|31260_32493_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	34.0	6.3e-63
WP_004181898.1|33326_33485_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_004117900.1|34125_34293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016529123.1|36345_36999_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
35902:35920	attR	CCTGGCATGACGTCCTGTA	NA	NA	NA	NA
WP_171819463.1|38232_39237_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_032446641.1|39236_40193_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046042034.1|40214_41042_-	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.4	1.3e-11
WP_077251134.1|41806_41911_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_016530671.1|44391_44670_-|transposase	transposase	transposase	Q71TE9	Escherichia_phage	68.2	4.3e-28
WP_016530670.1|45295_46288_-	DsbA family protein	NA	NA	NA	NA	NA
WP_042941664.1|51498_52020_+	CSS-motif domain-containing protein	NA	NA	NA	NA	NA
WP_171819462.1|52202_53051_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004144375.1|53549_54410_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_016529083.1|54516_55134_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	35.3	2.7e-22
WP_004026629.1|59285_59684_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004181928.1|60445_60757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016529087.1|60773_61502_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_016529091.1|65115_66153_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_046042027.1|67223_67601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016530173.1|67793_68549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026319.1|69144_69609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530174.1|69608_70397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042940293.1|73556_73874_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_004145290.1|74422_74932_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
WP_032105366.1|75299_75944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032105367.1|75955_76387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032105368.1|76392_76749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158414502.1|76772_76931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108523659.1|77797_78997_-	MFS transporter	NA	NA	NA	NA	NA
WP_032105369.1|79153_80878_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_016528828.1|80878_81826_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_016528829.1|81825_83559_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_174893464.1|83562_84897_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_032105370.1|84922_87124_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_004145307.1|87783_88044_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	51.0	1.1e-06
WP_016529247.1|88086_88647_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004902152.1|88683_89112_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_016529248.1|89199_89475_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_042940632.1|89537_90029_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_016529250.1|90077_90998_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004145313.1|91641_92220_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.1	6.5e-26
WP_128972610.1|95341_95623_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	55.0	3.1e-10
WP_004213635.1|95845_96367_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_032105434.1|97403_99530_+	TonB-dependent receptor family protein	NA	NA	NA	NA	NA
WP_016528985.1|99604_99760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016528984.1|99904_100126_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	66.2	8.5e-19
WP_016528982.1|100824_101268_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_016528981.1|101264_101735_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_016528980.1|101845_102106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115217266.1|102505_103733_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.0	1.1e-168
