The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR782232	Escherichia coli isolate SC467 chromosome omosome1	4715938	1354715	1367898	4715938		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1354715_1355477_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1355470_1356097_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_038994957.1|1356236_1357376_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1357438_1358431_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|1358524_1359889_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1359977_1360754_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1360758_1361397_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1361393_1362656_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1362652_1363561_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1363756_1364524_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|1364574_1365231_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272898.1|1365336_1367898_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_LR782232	Escherichia coli isolate SC467 chromosome omosome1	4715938	1439209	1457119	4715938	integrase,transposase	Enterobacteria_phage(53.85%)	16	1445911:1445928	1457303:1457320
WP_087599250.1|1439209_1440371_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_053264689.1|1440523_1442242_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	1.2e-306
WP_000214990.1|1442243_1443992_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|1444063_1444480_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|1444518_1445748_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
1445911:1445928	attL	AAGTGGTGGAGCTGGCGG	NA	NA	NA	NA
WP_063815381.1|1446421_1448755_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.4	0.0e+00
WP_000856729.1|1448769_1449090_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459291.1|1449225_1449681_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|1449673_1449961_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_001360858.1|1449953_1450553_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	3.0e-50
WP_001149160.1|1450549_1450816_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283029.1|1451368_1452103_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.0e-129
WP_000638635.1|1452099_1452600_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446128.1|1452673_1453246_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	2.5e-94
WP_000258270.1|1453445_1455896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012599910.1|1455919_1457119_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.8	4.5e-106
1457303:1457320	attR	AAGTGGTGGAGCTGGCGG	NA	NA	NA	NA
>prophage 3
NZ_LR782232	Escherichia coli isolate SC467 chromosome omosome1	4715938	1999043	2065379	4715938	terminase,integrase,capsid,head,lysis,tail,holin,plate,tRNA,portal	Escherichia_phage(47.83%)	75	2026293:2026320	2060295:2060322
WP_001295427.1|1999043_2001077_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|2001208_2002318_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|2002580_2002862_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|2003154_2003697_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677398.1|2003777_2004452_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945407.1|2004467_2006948_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_038993934.1|2006963_2007998_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|2008079_2008418_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134575.1|2008636_2009461_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|2009581_2009854_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195588.1|2010076_2010865_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822270.1|2010861_2011662_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001351455.1|2011726_2012545_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000434038.1|2012596_2013343_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|2013316_2014282_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|2014278_2015283_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858498.1|2015279_2016557_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|2016813_2017866_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001307281.1|2018173_2019028_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853886.1|2019056_2020319_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182903.1|2020328_2020781_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823287.1|2020811_2021096_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490692.1|2021099_2022455_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844220.1|2022502_2023543_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|2023642_2024422_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|2024503_2025403_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|2025817_2026135_+	hypothetical protein	NA	NA	NA	NA	NA
2026293:2026320	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_046623131.1|2026399_2027413_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001306384.1|2027528_2027828_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|2027942_2028218_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|2028228_2028399_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217681.1|2028395_2028896_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.0e-91
WP_000557703.1|2028959_2029184_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277957.1|2029183_2029486_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_001113270.1|2029485_2029710_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027664.1|2029706_2029982_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_115915322.1|2029971_2032191_+	replication endonuclease	NA	A0A0F7LA09	Escherichia_phage	96.4	0.0e+00
WP_098027498.1|2032537_2036530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115915329.1|2036765_2036912_+	vacuolating cytotoxin domain-containing protein	NA	M1TAP7	Escherichia_phage	100.0	1.7e-07
WP_001531529.1|2036888_2037923_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	5.5e-201
WP_137550868.1|2037922_2039695_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_175055367.1|2039868_2040723_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	98.2	4.0e-133
WP_001248555.1|2040781_2041855_+|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.2	3.3e-201
WP_175055368.1|2041858_2042602_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.4e-126
WP_000988633.1|2042701_2043211_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|2043210_2043414_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_136731192.1|2043417_2043699_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	98.9	1.8e-42
WP_001144101.1|2043698_2044196_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_061351624.1|2044210_2044636_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	1.5e-59
WP_001374011.1|2044623_2045049_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.7	1.4e-65
WP_001300730.1|2045020_2045194_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917158.1|2045156_2045624_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	1.5e-81
WP_069898864.1|2045616_2046069_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	4.5e-75
WP_001471813.1|2046273_2047017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515321.1|2047100_2047736_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	4.5e-113
WP_000127163.1|2047732_2048080_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121497.1|2048084_2048993_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
WP_024213327.1|2048985_2049516_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	6.6e-102
WP_069904676.1|2049526_2051845_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	66.8	2.4e-212
WP_175055369.1|2051848_2052376_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	94.9	1.2e-90
WP_175055370.1|2052765_2053293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286716.1|2053591_2054782_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|2054794_2055313_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|2055369_2055645_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|2055677_2055797_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_175055371.1|2055789_2058237_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	89.2	0.0e+00
WP_000978896.1|2058251_2058731_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_097732211.1|2058730_2059894_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.9	1.8e-205
WP_000468308.1|2059975_2060194_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|2060466_2061828_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2060295:2060322	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|2061930_2062227_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|2062228_2062525_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|2062733_2063066_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|2063256_2063979_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|2063975_2065379_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 4
NZ_LR782232	Escherichia coli isolate SC467 chromosome omosome1	4715938	2561200	2575333	4715938		Escherichia_phage(11.11%)	18	NA	NA
WP_000041556.1|2561200_2563627_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001295396.1|2563825_2564131_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2564238_2564949_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2564951_2565512_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705214.1|2565546_2565888_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2566022_2566349_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2566554_2567769_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2567780_2568800_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001389342.1|2568857_2568986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|2568987_2570268_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_000005552.1|2570302_2570554_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_175055376.1|2570626_2573065_-	3'-5' exoribonuclease	NA	V5UQJ3	Shigella_phage	47.0	1.4e-114
WP_001070257.1|2573155_2573347_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854562.1|2573343_2573532_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001328010.1|2573947_2574235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241299.1|2574203_2574581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|2574580_2574733_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001003381.1|2574925_2575333_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
>prophage 5
NZ_LR782232	Escherichia coli isolate SC467 chromosome omosome1	4715938	2580592	2617600	4715938	terminase,lysis,tail,protease,portal	Enterobacteria_phage(54.05%)	42	NA	NA
WP_000543831.1|2580592_2580805_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	6.2e-27
WP_000980999.1|2581021_2581273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023140913.1|2581339_2581618_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001385829.1|2581619_2582669_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	3.7e-112
WP_001047131.1|2582682_2583435_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.4	1.4e-129
WP_000066484.1|2584110_2584326_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2585080_2585296_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189915.1|2585300_2585612_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2585608_2586142_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2586138_2586636_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2586998_2587211_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2587221_2587410_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|2587412_2587478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|2587557_2587713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2587884_2588058_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035577.1|2588209_2588620_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001031431.1|2588920_2589127_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000373425.1|2589689_2590184_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934102.1|2590183_2592286_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_001072975.1|2592282_2592495_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985958.1|2592494_2594003_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_175055377.1|2593947_2595975_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097039.1|2596061_2596385_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_001283153.1|2596377_2596653_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677102.1|2596664_2597243_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_072752502.1|2597239_2597641_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	1.2e-71
WP_000211132.1|2597651_2598395_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001341514.1|2598455_2598842_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_001161009.1|2598850_2599180_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_048236858.1|2599151_2602217_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.0	0.0e+00
WP_000447253.1|2602216_2602546_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152368.1|2602555_2603254_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000140752.1|2603259_2604003_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.5e-147
WP_000741589.1|2603900_2604548_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_175055378.1|2604608_2608088_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
WP_032292241.1|2608155_2608755_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	2.9e-106
WP_175055379.1|2608819_2612170_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	2.4e-11
WP_032292238.1|2612169_2612745_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	5.0e-103
WP_000086522.1|2612842_2613433_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|2613749_2613983_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2614051_2614165_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000527753.1|2616139_2617600_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
>prophage 6
NZ_LR782232	Escherichia coli isolate SC467 chromosome omosome1	4715938	3922920	3936512	4715938	integrase	Enterobacteria_phage(81.82%)	15	3924821:3924839	3936673:3936691
WP_001273868.1|3922920_3923472_+	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	2.0e-29
WP_000550450.1|3923812_3923971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788776.1|3924037_3924190_-	hypothetical protein	NA	NA	NA	NA	NA
3924821:3924839	attL	GATGGTGCCGATAATAGGA	NA	NA	NA	NA
WP_175055402.1|3925304_3927638_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|3927652_3927973_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459294.1|3928108_3928564_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|3928556_3928844_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980227.1|3928836_3929436_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001149162.1|3929432_3929699_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.4e-44
WP_175055403.1|3930251_3930986_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	6.7e-129
WP_000984202.1|3930982_3931228_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	98.8	3.9e-41
WP_021546004.1|3931242_3931815_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	99.5	1.8e-97
WP_046072792.1|3932016_3933639_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	24.4	8.2e-10
WP_175055404.1|3933635_3935336_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_046072790.1|3935336_3936512_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.7	2.5e-141
3936673:3936691	attR	GATGGTGCCGATAATAGGA	NA	NA	NA	NA
>prophage 7
NZ_LR782232	Escherichia coli isolate SC467 chromosome omosome1	4715938	4002619	4057345	4715938	plate,transposase,tRNA	uncultured_Caudovirales_phage(28.57%)	40	NA	NA
WP_175055407.1|4002619_4003756_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000508713.1|4004415_4008909_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	1.0e-22
WP_175055408.1|4008984_4011126_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	3.7e-26
WP_001142958.1|4011335_4011854_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037391.1|4012550_4013051_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4013085_4013310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056975.1|4013360_4014836_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|4014842_4015256_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393845.1|4015259_4017110_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|4017073_4018156_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|4018180_4019461_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4019457_4019982_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|4019984_4021316_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343302.1|4021320_4022082_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_175055409.1|4022090_4024847_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.8	4.0e-81
WP_000088862.1|4024843_4025587_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|4025591_4027004_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_137477691.1|4027112_4030547_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000377959.1|4030557_4031910_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001284199.1|4031933_4032416_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|4032459_4033374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|4033383_4033863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|4033999_4034785_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|4035320_4036052_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|4036116_4036584_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|4036580_4037303_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052707.1|4037336_4038092_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4038163_4039522_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211726.1|4039569_4040340_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4040417_4041218_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648576.1|4041458_4042373_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997049.1|4042369_4043173_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_001140175.1|4048933_4049509_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_001294600.1|4050721_4051375_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4051414_4052230_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4052347_4052752_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|4052748_4053456_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260716.1|4053566_4055285_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001346133.1|4055337_4056162_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399589.1|4056364_4057345_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
