The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR782233	Escherichia coli isolate SC468 chromosome omosome1	4426017	453744	463186	4426017		Enterobacteria_phage(85.71%)	10	NA	NA
WP_175058376.1|453744_454671_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.3	2.6e-08
WP_000783108.1|454675_455407_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_021559962.1|455387_455495_-	protein YohO	NA	NA	NA	NA	NA
WP_001240405.1|455554_456286_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001295431.1|456507_458193_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|458189_458909_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|458955_459426_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|459466_459928_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001357189.1|460052_462053_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001357188.1|462049_463186_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 2
NZ_LR782233	Escherichia coli isolate SC468 chromosome omosome1	4426017	475146	540586	4426017	portal,head,tail,lysis,plate,integrase,capsid,terminase,holin,tRNA	Escherichia_phage(50.0%)	71	502316:502342	535861:535887
WP_001296226.1|475146_477180_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
WP_001005448.1|477311_478421_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_021520886.1|478683_478965_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830479.1|479258_479801_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677331.1|479881_480556_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_175058379.1|480571_483052_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_175058380.1|483067_484102_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|484182_484521_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134614.1|484739_485564_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|485684_485957_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195613.1|486179_486968_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|486964_487765_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_175058381.1|487829_488648_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	7.2e-23
WP_000434038.1|488699_489446_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011945.1|489419_490385_-	sugar kinase	NA	NA	NA	NA	NA
WP_024224710.1|490381_491386_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	5.8e-14
WP_000858523.1|491382_492660_-	MFS transporter	NA	NA	NA	NA	NA
WP_175058382.1|492916_493969_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_175058383.1|494195_495050_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853835.1|495078_496341_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|496350_496803_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823289.1|496833_497118_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490682.1|497121_498477_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000844231.1|498524_499565_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178556.1|499664_500444_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_021541114.1|500525_501425_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	4.4e-13
WP_001441996.1|501839_502157_+	hypothetical protein	NA	NA	NA	NA	NA
502316:502342	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_175058747.1|502421_503399_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.3e-185
WP_001306384.1|503548_503848_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|503962_504238_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|504248_504419_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|504415_504916_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001530544.1|504979_505204_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.4e-32
WP_001277958.1|505203_505506_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_001113263.1|505505_505730_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_000027667.1|505726_506002_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_175058384.1|509035_509572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175058385.1|509938_510373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175058386.1|510400_511096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175058387.1|511790_512174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115915329.1|512404_512551_+	vacuolating cytotoxin domain-containing protein	NA	M1TAP7	Escherichia_phage	100.0	1.7e-07
WP_000038159.1|512527_513562_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	2.1e-200
WP_000156861.1|513561_515334_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085975.1|515507_516362_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	98.6	3.5e-137
WP_001248558.1|516420_517494_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
WP_097404393.1|517497_518241_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.0	3.3e-123
WP_000988642.1|518340_518850_+|head	head completion/stabilization protein	head	A0A0F7L9Y3	Escherichia_phage	100.0	1.9e-90
WP_000846399.1|518849_519053_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|519056_519338_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|519337_519835_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_175058388.1|519849_520275_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	92.9	1.7e-55
WP_096211250.1|520262_520688_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	5.2e-65
WP_072275434.1|520659_520833_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.0e-23
WP_096997806.1|520795_521263_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.7	5.1e-82
WP_096211249.1|521255_521708_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	4.1e-76
WP_175058389.1|522741_523377_+|plate	phage baseplate assembly protein V	plate	Q858V7	Yersinia_virus	98.1	3.4e-113
WP_089584434.1|523373_523721_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_097555553.1|523725_524634_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	1.4e-160
WP_175058390.1|529156_530347_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_001251408.1|530359_530878_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|530933_531209_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|531241_531361_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_119186429.1|531353_533801_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.0	0.0e+00
WP_049038111.1|533815_534295_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	2.5e-84
WP_096969611.1|534294_535458_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	5.4e-205
WP_000468308.1|535539_535758_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476019.1|536031_537393_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
535861:535887	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_175058391.1|537495_537792_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000929408.1|537951_538284_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|538463_539186_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675178.1|539182_540586_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 3
NZ_LR782233	Escherichia coli isolate SC468 chromosome omosome1	4426017	999985	1048589	4426017	tail,protease	Enterobacteria_phage(38.89%)	36	NA	NA
WP_001260849.1|999985_1000807_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1000906_1000990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024227007.1|1001082_1001418_-	acid shock protein	NA	NA	NA	NA	NA
WP_175058439.1|1003176_1004070_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|1004204_1005425_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|1005549_1006245_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001592042.1|1006197_1007490_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148699.1|1007649_1008264_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
WP_001357323.1|1008520_1008826_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001350228.1|1008933_1009644_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|1009646_1010207_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705201.1|1010241_1010583_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|1010717_1011044_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001298659.1|1011249_1012464_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
WP_000836083.1|1012475_1013495_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
WP_001389342.1|1013552_1013681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175058440.1|1015000_1015252_-	excisionase family protein	NA	S4TND0	Salmonella_phage	48.7	1.1e-14
WP_175058441.1|1017851_1018043_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854562.1|1018039_1018228_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_175058750.1|1019621_1020041_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.4	3.1e-22
WP_000476993.1|1020108_1020336_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_175058442.1|1020319_1020556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175058443.1|1023302_1023932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044703989.1|1025362_1025500_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.6	1.1e-13
WP_000980999.1|1025716_1025968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023140913.1|1026034_1026313_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_000066484.1|1028803_1029019_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000066495.1|1031643_1031856_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_175058444.1|1033560_1033767_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	89.7	2.5e-25
WP_001072975.1|1036919_1037132_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001283153.1|1041011_1041287_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_175058445.1|1042239_1042983_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	96.8	4.4e-128
WP_175058751.1|1043043_1043430_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	96.1	1.8e-61
WP_001161009.1|1043438_1043768_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000447253.1|1046803_1047133_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_021560601.1|1047845_1048589_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	5.4e-150
>prophage 4
NZ_LR782233	Escherichia coli isolate SC468 chromosome omosome1	4426017	4299632	4312815	4426017		Escherichia_phage(50.0%)	12	NA	NA
WP_001374596.1|4299632_4300394_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4300387_4301014_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|4301153_4302293_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4302355_4303348_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104432.1|4303441_4304806_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001357575.1|4304894_4305671_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001279001.1|4305675_4306314_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
WP_175058726.1|4306310_4307573_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	1.4e-134
WP_000847997.1|4307569_4308478_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001298167.1|4308673_4309441_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_001141304.1|4309491_4310148_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_000103862.1|4310253_4312815_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.2e-31
