The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR782231	Escherichia coli isolate SC457 chromosome omosome1	4555909	651814	744395	4555909	tRNA,protease,plate,transposase	uncultured_Mediterranean_phage(11.11%)	57	NA	NA
WP_000753946.1|651814_653239_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
WP_000929439.1|653393_654551_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272188.1|654639_655026_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_001186656.1|655338_656163_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001018194.1|658928_659723_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000818114.1|661074_661926_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|662072_662798_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|663089_663647_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811918.1|663738_664935_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001295562.1|665123_665882_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922437.1|665894_666752_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001306222.1|666763_668116_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|668145_670578_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|670699_671185_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|671188_672214_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|672318_672774_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|672777_673566_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139675.1|673565_674714_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569441.1|674710_675307_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	6.0e-27
WP_174498538.1|675343_678826_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	4.8e-209
WP_000055741.1|678838_679798_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_174498537.1|679896_682038_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_024229456.1|682094_682484_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176529.1|682548_683844_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062315.1|683892_684153_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|684139_684340_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185300.1|684505_685051_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|685047_685470_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239179.1|685483_686194_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001260707.1|687086_688805_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094022.1|688915_689623_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|689619_690024_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|690141_690957_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|690996_691650_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|691642_692674_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140178.1|692861_693434_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997023.1|699194_699998_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	31.4	4.4e-33
WP_000648591.1|699994_700909_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|701149_701950_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211713.1|702026_702797_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|702844_704203_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_174498535.1|704274_705030_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|705063_705786_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|705782_706250_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_024165575.1|706314_707046_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_175058005.1|707581_708367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175058076.1|708988_709705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174498534.1|716764_717508_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_175058077.1|721016_721721_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_175057989.1|721639_721825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175058006.1|721796_722348_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_175058007.1|730460_730979_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_175058008.1|735333_735816_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_000786991.1|737877_738135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175058009.1|738532_739669_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_175057990.1|740821_741571_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_175058010.1|743276_744395_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_LR782231	Escherichia coli isolate SC457 chromosome omosome1	4555909	1023469	1080735	4555909	terminase,protease,portal,lysis,integrase,tRNA,tail,head,capsid	Enterobacteria_phage(59.62%)	65	1033621:1033667	1081158:1081204
WP_000912345.1|1023469_1024855_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143511.1|1024890_1025412_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1025519_1025732_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729161.1|1025733_1026600_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1027070_1027613_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1027832_1028525_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001314546.1|1028555_1031165_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_097291394.1|1031177_1032185_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255233.1|1032195_1032711_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1032713_1033346_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1033621:1033667	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001361259.1|1033680_1034844_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000488407.1|1035042_1035321_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|1035368_1035587_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_077252933.1|1035679_1035967_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.6e-47
WP_000548530.1|1035977_1036169_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_097499499.1|1036141_1036324_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	95.0	1.5e-26
WP_000186848.1|1036320_1037001_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1036997_1037783_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995443.1|1037788_1038085_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
WP_023148105.1|1038160_1038451_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_175058016.1|1038961_1039717_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	74.1	5.2e-92
WP_001182881.1|1040054_1040594_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_097499497.1|1040590_1041610_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	1.0e-111
WP_000788877.1|1041606_1042308_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000145915.1|1042304_1042607_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_097499547.1|1042674_1043007_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_033869699.1|1043054_1043204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1043261_1044788_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_175058017.1|1044899_1045217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303586.1|1046443_1046545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104274860.1|1046541_1046997_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
WP_000224916.1|1046996_1047167_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|1047159_1047450_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|1047446_1047809_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1047805_1047946_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204780.1|1048031_1048415_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000839582.1|1050048_1050264_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001135296.1|1050263_1050761_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_001228695.1|1050977_1051160_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|1051250_1051544_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_000453576.1|1052488_1053034_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_137487721.1|1053008_1054934_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1054930_1055137_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_174498053.1|1055133_1056735_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	3.8e-310
WP_042019488.1|1056715_1058035_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.4	1.1e-233
WP_001299443.1|1058044_1058377_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063252.1|1058432_1059458_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	3.9e-191
WP_000158862.1|1059499_1059898_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	83.3	1.2e-50
WP_042003257.1|1059909_1060263_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	98.3	3.4e-62
WP_094308181.1|1060274_1060853_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.9e-79
WP_000683105.1|1060849_1061245_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001577918.1|1061252_1061993_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_000479163.1|1062008_1062431_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
WP_000459457.1|1062412_1062847_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_137487723.1|1062839_1065404_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.1	0.0e+00
WP_000847348.1|1065400_1065730_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	1.8e-57
WP_053273195.1|1066432_1067176_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_175058018.1|1067073_1067721_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	1.3e-112
WP_175058019.1|1067781_1071195_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.6	0.0e+00
WP_175058020.1|1071264_1071864_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	1.3e-109
WP_175058021.1|1074844_1075420_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	3.6e-101
WP_000086527.1|1075517_1076108_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|1076424_1076658_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1076726_1076840_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001201825.1|1079781_1080735_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
1081158:1081204	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_LR782231	Escherichia coli isolate SC457 chromosome omosome1	4555909	2610597	2620040	4555909		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001314875.1|2610597_2611734_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_001314876.1|2611730_2613731_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|2613855_2614317_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2614358_2614829_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001314877.1|2614875_2615595_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|2615591_2617277_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240398.1|2617498_2618230_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|2618289_2618397_+	protein YohO	NA	NA	NA	NA	NA
WP_000783144.1|2618377_2619109_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569374.1|2619113_2620040_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 4
NZ_LR782231	Escherichia coli isolate SC457 chromosome omosome1	4555909	3568114	3598400	4555909	tRNA,tail	Escherichia_phage(33.33%)	24	NA	NA
WP_000708490.1|3568114_3569353_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	7.7e-93
WP_001586277.1|3569433_3570255_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001295541.1|3570345_3570714_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001272796.1|3570818_3571436_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_000935213.1|3571448_3572381_-	DNA-binding transcriptional activator TtdR	NA	NA	NA	NA	NA
WP_000986809.1|3572587_3573499_+	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_000722957.1|3573495_3574101_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_000804922.1|3574149_3575613_+	L-tartrate/succinate antiporter	NA	NA	NA	NA	NA
WP_001264365.1|3575655_3576669_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|3576906_3577122_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|3577232_3578978_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|3579172_3581014_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228943.1|3581084_3581591_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_175058063.1|3581868_3582018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072033766.1|3582536_3582758_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	79.5	6.9e-29
WP_000763326.1|3586890_3587010_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_175058081.1|3587009_3587348_-|tail	phage tail assembly protein	tail	Q858U8	Yersinia_virus	76.6	6.6e-31
WP_175058064.1|3587913_3589101_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	83.3	2.6e-191
WP_175058065.1|3590302_3590569_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_175058066.1|3590680_3591073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047674765.1|3592098_3592710_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	83.1	4.8e-96
WP_047674759.1|3593611_3593959_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	70.4	1.6e-40
WP_175058067.1|3596107_3596521_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	69.1	2.6e-45
WP_001019825.1|3598196_3598400_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	79.1	6.1e-24
