The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR745045	Klebsiella pneumoniae isolate Kpn2166 chromosome Kpn2166	5322833	1324638	1339360	5322833	tail,integrase	Morganella_phage(50.0%)	18	1324391:1324411	1344455:1344475
1324391:1324411	attL	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
WP_004213157.1|1324638_1325892_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.4	3.2e-147
WP_004213158.1|1325987_1326995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213159.1|1327125_1327344_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004213160.1|1327343_1327778_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.3	2.4e-25
WP_004213161.1|1327791_1328394_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	57.8	1.2e-54
WP_004213162.1|1328393_1328573_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023302683.1|1328569_1329535_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	44.3	3.9e-07
WP_004213165.1|1329531_1330035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213166.1|1330031_1330241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213167.1|1330237_1330864_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.6e-25
WP_004213168.1|1330873_1331224_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	3.4e-38
WP_004213169.1|1331216_1333979_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	2.8e-292
WP_032424539.1|1334318_1334765_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_004213171.1|1334745_1335129_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213172.1|1335133_1335607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213173.1|1335790_1335961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213174.1|1335960_1336287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213175.1|1336294_1339360_+|tail	phage tail length tape measure family protein	tail	B1GS57	Salmonella_phage	40.5	2.0e-94
1344455:1344475	attR	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
>prophage 2
NZ_LR745045	Klebsiella pneumoniae isolate Kpn2166 chromosome Kpn2166	5322833	1347473	1382633	5322833	tail,terminase,integrase	Salmonella_phage(35.9%)	45	1345722:1345736	1355623:1355637
1345722:1345736	attL	ATGGAACTTGATTGC	NA	NA	NA	NA
WP_004151980.1|1347473_1348940_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1349007_1350585_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_032457443.1|1350776_1352027_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.9	2.6e-205
WP_032457442.1|1352043_1352235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032457440.1|1352231_1352825_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	2.1e-109
WP_032457439.1|1352814_1353000_-	DUF1317 family protein	NA	A0A193GYJ8	Enterobacter_phage	89.3	2.6e-21
WP_023339275.1|1352992_1353286_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004144294.1|1353395_1353644_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_032457438.1|1353692_1354628_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	76.4	4.4e-141
WP_032457437.1|1354624_1355446_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	80.6	1.4e-130
WP_032441408.1|1355442_1355742_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	52.5	8.8e-19
1355623:1355637	attR	ATGGAACTTGATTGC	NA	NA	NA	NA
WP_004164037.1|1355738_1355888_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004144290.1|1356108_1356690_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1356844_1357078_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1357224_1357434_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_032457436.1|1357433_1358201_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032457435.1|1358197_1358983_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	1.1e-132
WP_023339267.1|1359102_1359447_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	84.2	1.5e-51
WP_162484370.1|1359639_1360056_+	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	80.7	5.0e-20
WP_032457433.1|1360048_1360444_+	ead/Ea22-like family protein	NA	Q716F4	Shigella_phage	39.4	6.4e-09
WP_023339691.1|1360443_1360632_+	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	88.7	3.7e-23
WP_077253820.1|1360759_1361317_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_130952493.1|1361313_1361514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032457431.1|1361506_1361845_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.4	2.7e-48
WP_023301597.1|1361921_1362251_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.1	8.7e-28
WP_032457429.1|1362308_1362893_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	5.8e-91
WP_032457428.1|1362889_1364365_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.3	1.2e-278
WP_032457427.1|1364376_1364649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032457426.1|1364727_1365159_-	hypothetical protein	NA	A0A248SKX0	Klebsiella_phage	53.5	3.7e-34
WP_004141368.1|1365895_1366102_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032457425.1|1366116_1367799_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	1.5e-264
WP_004141364.1|1367795_1368095_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	68.4	3.1e-32
WP_032457424.1|1368091_1368415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032457423.1|1368426_1369131_+	peptidase	NA	G9L6C4	Escherichia_phage	74.4	1.0e-65
WP_032413483.1|1369145_1370132_+	phage protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|1370185_1370623_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_032457422.1|1370633_1370975_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_032457421.1|1371025_1371349_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	84.1	3.5e-45
WP_004141350.1|1371348_1371954_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.5	1.4e-87
WP_032457420.1|1371953_1374431_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.7	0.0e+00
WP_032457419.1|1374430_1374895_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.0e-69
WP_004152437.1|1374894_1375434_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
WP_032457418.1|1375444_1377979_+	bacteriophage protein	NA	Q858G0	Salmonella_phage	81.4	0.0e+00
WP_032457417.1|1377978_1379877_+	hypothetical protein	NA	Q858F9	Salmonella_phage	89.0	0.0e+00
WP_032457416.1|1379876_1382633_+	hypothetical protein	NA	Q858F8	Salmonella_phage	93.1	0.0e+00
>prophage 3
NZ_LR745045	Klebsiella pneumoniae isolate Kpn2166 chromosome Kpn2166	5322833	1386358	1393243	5322833	holin	Salmonella_phage(57.14%)	7	NA	NA
WP_032457410.1|1386358_1386652_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	8.0e-25
WP_004197353.1|1389059_1389239_+	hypothetical protein	NA	A0A1I9SEW0	Klebsiella_phage	39.0	5.6e-05
WP_004146394.1|1389375_1389780_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_032457409.1|1389766_1390072_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	80.4	1.7e-38
WP_032418560.1|1390061_1390691_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	78.4	1.5e-92
WP_032457408.1|1390687_1391188_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	89.4	5.3e-69
WP_004152009.1|1391374_1393243_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_LR745045	Klebsiella pneumoniae isolate Kpn2166 chromosome Kpn2166	5322833	1721944	1728849	5322833	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1721944_1722808_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004214747.1|1722818_1723592_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_004151134.1|1723832_1724729_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1724971_1726333_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004201558.1|1726651_1727374_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004214740.1|1727370_1728849_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
>prophage 5
NZ_LR745045	Klebsiella pneumoniae isolate Kpn2166 chromosome Kpn2166	5322833	2757070	2767957	5322833		Escherichia_phage(87.5%)	9	NA	NA
WP_004209809.1|2757070_2760178_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
WP_004176258.1|2760232_2761498_+	MFS transporter	NA	NA	NA	NA	NA
WP_004209813.1|2761528_2762617_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.0e-210
WP_004176262.1|2762703_2762964_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2763261_2764122_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004209817.1|2764142_2764904_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.6	5.5e-134
WP_002903955.1|2765164_2766067_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004183946.1|2766078_2767344_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|2767336_2767957_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_LR745045	Klebsiella pneumoniae isolate Kpn2166 chromosome Kpn2166	5322833	2803164	2898483	5322833	holin,tail,integrase,head,transposase,capsid,protease,portal,terminase	Escherichia_phage(18.6%)	101	2821342:2821360	2871793:2871811
WP_004209779.1|2803164_2803977_+|protease	serine protease	protease	NA	NA	NA	NA
WP_002903685.1|2803990_2804107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903683.1|2804150_2804480_-	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_002903681.1|2804466_2804829_-	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903679.1|2805271_2806306_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002903677.1|2806530_2808186_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_004143107.1|2808185_2809028_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_002903639.1|2809045_2809345_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_004143105.1|2809337_2810171_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_004209782.1|2810170_2810971_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_004209783.1|2811107_2812067_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
WP_004209784.1|2812070_2812688_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_162484386.1|2812687_2813590_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_004148289.1|2813579_2814506_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022615525.1|2814663_2816319_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_032457363.1|2816583_2817504_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004179716.1|2817667_2818024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004183910.1|2818179_2819796_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004176303.1|2819792_2820512_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_004209794.1|2820492_2821443_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
2821342:2821360	attL	GAAAACGCTGGAGGCCATC	NA	NA	NA	NA
WP_004209796.1|2821510_2824288_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.0	6.8e-65
WP_002903581.1|2825005_2826442_+	anion permease	NA	NA	NA	NA	NA
WP_004152246.1|2826496_2828149_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_023302609.1|2828311_2829928_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004143067.1|2830972_2831362_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_004215412.1|2831354_2832119_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_020316475.1|2832108_2833461_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_004214878.1|2833470_2834673_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_004176317.1|2834683_2835340_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_002903522.1|2835350_2836037_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004151560.1|2836206_2837013_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143055.1|2837009_2837573_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_004148273.1|2837674_2838583_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004214881.1|2838749_2840060_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_022615524.1|2840059_2841505_+	amidohydrolase	NA	NA	NA	NA	NA
WP_022615523.1|2841624_2842743_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_004214887.1|2842871_2843972_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	8.3e-115
WP_004214894.1|2845172_2845472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022615522.1|2845639_2846284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022615521.1|2846339_2847074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138983668.1|2847101_2849240_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	4.7e-90
WP_016530179.1|2849312_2852390_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	61.5	0.0e+00
WP_022615519.1|2852386_2852767_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_004864228.1|2852779_2853256_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004177132.1|2853242_2853716_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_016530181.1|2853736_2857126_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	60.6	0.0e+00
WP_016530182.1|2857186_2857420_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_016530183.1|2857493_2857799_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_016530184.1|2857801_2858206_-|tail	phage tail assembly chaperone	tail	K7PKV6	Enterobacterial_phage	57.4	3.2e-32
WP_016530185.1|2858236_2858941_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	67.4	6.6e-81
WP_016530186.1|2858997_2859345_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_016530187.1|2859341_2859791_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	7.4e-62
WP_016530188.1|2859787_2860126_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	7.8e-40
WP_016530189.1|2860134_2860452_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	51.0	1.8e-22
WP_004104235.1|2860529_2861768_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
WP_000999827.1|2861777_2862377_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_016530190.1|2862369_2863596_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
WP_016530191.1|2863585_2863747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025108055.1|2863743_2865495_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.5	4.0e-252
WP_016530193.1|2865498_2865996_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.9	5.7e-63
WP_016530194.1|2866153_2866504_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.8	7.8e-51
WP_016530196.1|2867137_2867764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022615516.1|2867768_2868704_-	DUF4747 family protein	NA	NA	NA	NA	NA
WP_016530199.1|2868927_2869203_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	36.0	1.7e-05
WP_016530200.1|2869210_2869840_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	88.0	1.4e-103
WP_016530201.1|2869839_2870121_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	71.0	1.6e-30
WP_004213330.1|2870107_2870503_-|holin	phage holin family protein	holin	G8C7V8	Escherichia_phage	73.1	1.5e-45
WP_032427780.1|2870595_2871168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213332.1|2871279_2871858_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	3.5e-48
2871793:2871811	attR	GATGGCCTCCAGCGTTTTC	NA	NA	NA	NA
WP_032427779.1|2871871_2872852_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.3	4.6e-133
WP_004184734.1|2872864_2873242_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
WP_016530204.1|2873251_2874061_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	4.5e-110
WP_016530205.1|2874057_2874996_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	74.5	2.6e-101
WP_004184738.1|2874985_2875165_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
WP_004213338.1|2875402_2875864_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_016530206.1|2875889_2876087_-	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_016530207.1|2876179_2876839_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.7	7.3e-74
WP_004213349.1|2877606_2877906_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	9.4e-13
WP_004213351.1|2877905_2878691_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	5.3e-63
WP_004213355.1|2878818_2879163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530208.1|2879155_2879818_+	hypothetical protein	NA	Q71T76	Escherichia_phage	56.0	2.2e-54
WP_004213359.1|2879814_2880000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530209.1|2880119_2880380_+	pyocin activator PrtN family protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_002903398.1|2880991_2881150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213367.1|2881442_2881958_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.9	2.0e-23
WP_002903394.1|2882152_2882905_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_002903391.1|2883043_2883994_+	universal stress protein UspE	NA	NA	NA	NA	NA
WP_002903388.1|2884103_2884292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002903386.1|2884440_2885829_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_004148265.1|2885839_2887369_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_004140012.1|2887711_2887894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903384.1|2887890_2888841_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004183892.1|2889018_2890401_+	amino acid permease	NA	NA	NA	NA	NA
WP_004140019.1|2890437_2891160_+	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_002903379.1|2891156_2891492_-	GlpM family protein	NA	NA	NA	NA	NA
WP_002903377.1|2891620_2892340_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_002903374.1|2892582_2892945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140030.1|2893201_2894503_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.3	1.3e-18
WP_004148259.1|2894578_2895511_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_004176339.1|2895500_2896901_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_104716484.1|2897119_2898483_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.1	1.5e-73
>prophage 7
NZ_LR745045	Klebsiella pneumoniae isolate Kpn2166 chromosome Kpn2166	5322833	3181264	3227491	5322833	plate,tail,tRNA,head,integrase,capsid,portal,terminase	Enterobacteria_phage(56.25%)	54	3186492:3186509	3223758:3223775
WP_004213129.1|3181264_3181765_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3181881_3182328_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|3182311_3183106_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020324105.1|3183213_3184389_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3184420_3185113_-	CTP synthase	NA	NA	NA	NA	NA
WP_004176547.1|3185258_3185768_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|3185772_3186111_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004176548.1|3186100_3186340_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3186492:3186509	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|3186604_3186856_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_032457354.1|3186899_3188039_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	71.0	1.2e-145
WP_032457353.1|3188193_3189366_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	5.0e-158
WP_032414481.1|3189365_3189881_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	3.7e-57
WP_004131585.1|3189926_3190244_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_053086776.1|3190264_3190402_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_050594806.1|3190388_3193364_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.9	1.9e-222
WP_032457467.1|3193378_3193870_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	5.6e-55
WP_032457352.1|3194185_3195673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032457351.1|3195922_3197020_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	29.0	1.3e-11
WP_009486478.1|3197019_3197232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032457350.1|3197228_3200255_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_032457349.1|3200244_3201168_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	9.9e-53
WP_032411305.1|3201169_3201520_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	2.1e-27
WP_032457348.1|3201516_3202104_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.0	2.2e-61
WP_032457347.1|3202100_3202736_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	50.5	6.6e-56
WP_023328065.1|3202732_3203200_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	5.4e-47
WP_157835119.1|3203200_3203536_-	peptidase	NA	B6SD31	Bacteriophage	33.3	9.6e-06
WP_023339943.1|3203722_3204268_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_004213110.1|3204264_3204549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|3204539_3204740_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_004213109.1|3204739_3205255_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_032457346.1|3205367_3206225_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.1	1.1e-69
WP_004213107.1|3206274_3207309_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	6.2e-96
WP_004213106.1|3207318_3208158_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	5.6e-95
WP_004213105.1|3208314_3210042_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.3	3.1e-233
WP_004213104.1|3210035_3211097_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	3.1e-143
WP_032457345.1|3211547_3212066_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_032457344.1|3212055_3213201_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_032457343.1|3214107_3216222_-	DUF91 domain-containing protein	NA	NA	NA	NA	NA
WP_023328077.1|3218898_3219834_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	53.8	3.2e-83
WP_032457342.1|3220066_3220633_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	31.5	2.8e-13
WP_032457341.1|3220629_3220854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131520.1|3220922_3221195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032457340.1|3221210_3221588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131515.1|3221603_3221822_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	4.7e-06
WP_017898643.1|3221842_3222121_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	87.6	2.0e-41
WP_048024533.1|3222242_3222542_+	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	85.9	3.0e-43
WP_017898644.1|3222657_3223641_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.8	8.4e-151
WP_004176549.1|3223906_3224920_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3223758:3223775	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|3224977_3225079_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3225078_3225153_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3225270_3225396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3225454_3225718_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3225848_3226487_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3226576_3227491_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 1
NZ_LR745046	Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166	226671	123660	183739	226671	integrase,protease,transposase	Caulobacter_phage(16.67%)	52	122097:122124	156604:156631
122097:122124	attL	AGATCCGAAAAAAGGTAGTTCCGGATCT	NA	NA	NA	NA
WP_004213560.1|123660_124440_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
WP_004213558.1|124584_125514_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_077250517.1|125826_125985_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
WP_011154535.1|126099_127068_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	1.1e-171
WP_004213252.1|127767_128595_+	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.4	2.2e-11
WP_004213250.1|128616_129573_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004902166.1|129572_130577_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004902162.1|132425_133625_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_004902159.1|133722_134109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213915.1|134333_134651_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_004145290.1|135200_135710_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
WP_004213918.1|136570_136765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302795.1|137462_138662_-	MFS transporter	NA	NA	NA	NA	NA
WP_004213920.1|138818_140543_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_004213921.1|140543_141491_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004213922.1|141490_143224_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_004213923.1|143227_144505_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_004213924.1|144586_146788_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_004213925.1|147454_147715_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	51.0	1.1e-06
WP_004213927.1|147756_148317_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004902152.1|148354_148783_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_004213932.1|148866_149142_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_011251327.1|149204_149696_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_004213934.1|149744_150665_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004213072.1|153461_153905_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004213073.1|153901_154132_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004213075.1|154739_155873_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_004213076.1|155888_156182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213077.1|156171_156378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213078.1|156729_157020_+	hypothetical protein	NA	NA	NA	NA	NA
156604:156631	attR	AGATCCGAAAAAAGGTAGTTCCGGATCT	NA	NA	NA	NA
WP_004225022.1|157009_157909_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_004215174.1|157957_160183_-	exclusion suppressor FxsA	NA	NA	NA	NA	NA
WP_004215173.1|160184_161087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004225020.1|161170_161353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004215188.1|161371_161833_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004215186.1|161948_162896_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004225018.1|163231_164227_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|164432_165446_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_077250518.1|166099_169057_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
WP_004144375.1|169898_170759_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_004210231.1|172490_173138_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004210233.1|173474_174716_-	VWA domain-containing protein	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
WP_004026611.1|174800_175376_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
WP_004026609.1|175476_176055_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|176093_177134_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|177157_177613_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_011154617.1|177635_178787_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004210240.1|178783_179368_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	29.9	1.8e-12
WP_023302789.1|179679_180738_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_004210246.1|180749_181892_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.2	6.3e-33
WP_004181732.1|181884_182658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004210251.1|182659_183739_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	1.1e-39
>prophage 2
NZ_LR745046	Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166	226671	218529	225942	226671	transposase	Stx2-converting_phage(33.33%)	6	NA	NA
WP_004213807.1|218529_219498_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_004902302.1|219766_221359_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004189161.1|221389_221740_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004215130.1|221736_222177_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004117790.1|223804_224776_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004211841.1|224775_225942_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
