The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR745042	Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 chromosome Kpn154	5245353	1326563	1341285	5245353	tail,integrase	Morganella_phage(50.0%)	17	1326316:1326336	1346380:1346400
1326316:1326336	attL	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
WP_032424540.1|1326563_1327817_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.4	7.2e-147
WP_004213158.1|1327912_1328920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213159.1|1329050_1329269_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004213160.1|1329268_1329703_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.3	2.4e-25
WP_004213161.1|1329716_1330319_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	57.8	1.2e-54
WP_004213162.1|1330318_1330498_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023302683.1|1330494_1331460_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	44.3	3.9e-07
WP_004213165.1|1331456_1331960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213166.1|1331956_1332166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213167.1|1332162_1332789_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.6e-25
WP_004213168.1|1332798_1333149_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	3.4e-38
WP_004213169.1|1333141_1335904_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	2.8e-292
WP_032424539.1|1336243_1336690_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_077252710.1|1336703_1337054_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213172.1|1337058_1337532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213174.1|1337885_1338212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213175.1|1338219_1341285_+|tail	phage tail length tape-measure protein 1	tail	B1GS57	Salmonella_phage	40.5	2.0e-94
1346380:1346400	attR	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
>prophage 2
NZ_LR745042	Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 chromosome Kpn154	5245353	1682944	1689849	5245353	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1682944_1683808_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004214747.1|1683818_1684592_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_004151134.1|1684832_1685729_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1685971_1687333_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004201558.1|1687651_1688374_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004214740.1|1688370_1689849_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
>prophage 3
NZ_LR745042	Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 chromosome Kpn154	5245353	2722916	2732330	5245353		Escherichia_phage(87.5%)	9	NA	NA
WP_161267581.1|2722916_2724551_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.5	4.4e-181
WP_004176258.1|2724605_2725871_+	MFS transporter	NA	NA	NA	NA	NA
WP_004209813.1|2725901_2726990_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.0e-210
WP_004176262.1|2727076_2727337_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2727634_2728495_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004209817.1|2728515_2729277_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.6	5.5e-134
WP_002903955.1|2729537_2730440_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004183946.1|2730451_2731717_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|2731709_2732330_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_LR745042	Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 chromosome Kpn154	5245353	2767538	2847996	5245353	integrase,head,portal,tail,terminase,protease,capsid	Salmonella_phage(19.05%)	86	2772235:2772251	2846795:2846811
WP_004209779.1|2767538_2768351_+|protease	serine protease	protease	NA	NA	NA	NA
WP_002903685.1|2768364_2768481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903683.1|2768524_2768854_-	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_002903681.1|2768840_2769203_-	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903679.1|2769645_2770680_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002903677.1|2770904_2772560_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
2772235:2772251	attL	TGCCGCTGGCGCCGGTG	NA	NA	NA	NA
WP_004143107.1|2772559_2773402_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_002903639.1|2773419_2773719_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_004143105.1|2773711_2774545_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_004209782.1|2774544_2775345_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_004209783.1|2775481_2776441_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
WP_004209784.1|2776444_2777062_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_004209787.1|2777061_2777964_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_004148289.1|2777953_2778880_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022615525.1|2779037_2780693_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_004209791.1|2780957_2781878_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004179716.1|2782041_2782398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004183910.1|2782553_2784170_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004176303.1|2784166_2784886_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_004209794.1|2784866_2785817_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_023302610.1|2785884_2788662_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.0	6.8e-65
WP_002903581.1|2789379_2790816_+	anion permease	NA	NA	NA	NA	NA
WP_004152246.1|2790870_2792523_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_023302609.1|2792685_2794302_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004143067.1|2795346_2795736_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_004215412.1|2795728_2796493_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_020316475.1|2796482_2797835_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_004214878.1|2797844_2799047_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_004176317.1|2799057_2799714_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_002903522.1|2799724_2800411_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004151560.1|2800580_2801387_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143055.1|2801383_2801947_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_004148273.1|2802048_2802957_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004214881.1|2803123_2804434_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004176321.1|2804433_2805879_+	amidohydrolase	NA	NA	NA	NA	NA
WP_022615523.1|2805998_2807117_+	transporter	NA	NA	NA	NA	NA
WP_004214887.1|2807245_2808346_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	8.3e-115
WP_004214894.1|2809546_2809846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022615522.1|2810013_2810658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022615521.1|2810713_2811448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022615520.1|2811460_2813614_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	6.2e-90
WP_023302608.1|2813686_2816764_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	61.8	0.0e+00
WP_023302607.1|2816760_2817141_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	79.4	7.9e-57
WP_023302606.1|2817153_2817630_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
WP_023302605.1|2817616_2818090_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.4	1.2e-54
WP_023302604.1|2818111_2821690_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	59.1	1.2e-242
WP_023302603.1|2821752_2822274_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	45.2	1.7e-09
WP_023302602.1|2822348_2822654_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_032424504.1|2822656_2823061_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	54.6	3.6e-31
WP_023302600.1|2823091_2823796_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	1.6e-79
WP_023302599.1|2823852_2824200_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_019705270.1|2824196_2824646_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_023302597.1|2824633_2824981_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.5e-41
WP_021313626.1|2824989_2825310_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.1	4.8e-15
WP_023302596.1|2825306_2825510_-	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	2.3e-07
WP_021313628.1|2825548_2826757_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.5	9.9e-194
WP_032424503.1|2826771_2827425_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	86.9	1.0e-104
WP_023302594.1|2827411_2828641_-|portal	phage portal protein	portal	U5P411	Shigella_phage	81.2	5.0e-201
WP_023302593.1|2828835_2830566_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.0	2.3e-300
WP_004884285.1|2830562_2831057_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_023302592.1|2831187_2831538_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	80.2	7.1e-52
WP_032424502.1|2831552_2831858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023302590.1|2832169_2832520_-	hypothetical protein	NA	H2EQH5	Salmonella_phage	39.7	2.1e-11
WP_023302589.1|2832516_2833056_-	lysozyme	NA	K7PM52	Enterobacteria_phage	79.0	1.0e-81
WP_023302588.1|2833058_2833307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302587.1|2833557_2834643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023302586.1|2834642_2835635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023302585.1|2835674_2836022_-	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	4.0e-55
WP_032424501.1|2836040_2837021_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.9e-134
WP_004184734.1|2837033_2837411_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
WP_023302583.1|2837420_2838230_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.7	1.6e-110
WP_023302582.1|2838226_2839195_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	4.6e-85
WP_071787065.1|2839232_2839364_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	76.7	2.4e-13
WP_023302581.1|2839601_2840054_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.8	2.6e-67
WP_004197463.1|2840082_2840346_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	47.9	3.7e-13
WP_004184740.1|2840447_2840924_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	45.3	2.0e-12
WP_004184742.1|2841095_2842250_+	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	28.2	1.5e-34
WP_004184745.1|2842633_2843557_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.8	4.5e-106
WP_021313641.1|2843644_2843944_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	9.4e-13
WP_004213351.1|2843943_2844729_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	5.3e-63
WP_004213355.1|2844856_2845201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530208.1|2845193_2845856_+	hypothetical protein	NA	Q71T76	Escherichia_phage	56.0	2.2e-54
WP_004213359.1|2845852_2846038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530209.1|2846157_2846418_+	hypothetical protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_002903398.1|2847029_2847188_-	hypothetical protein	NA	NA	NA	NA	NA
2846795:2846811	attR	TGCCGCTGGCGCCGGTG	NA	NA	NA	NA
WP_004213367.1|2847480_2847996_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.9	2.0e-23
>prophage 5
NZ_LR745042	Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 chromosome Kpn154	5245353	3431447	3440911	5245353	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004209699.1|3431447_3433169_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|3433195_3433915_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3434268_3434487_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3434607_3436887_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3436917_3437235_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3437560_3437782_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_023302553.1|3437858_3439799_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.2e-36
WP_002896440.1|3439795_3440911_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_LR745043	Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154	215306	108597	157783	215306	transposase,integrase	Bacillus_phage(27.78%)	41	99058:99072	144720:144734
99058:99072	attL	TTTGTTGAATAAATA	NA	NA	NA	NA
WP_004213592.1|108597_111567_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
WP_004213590.1|111569_112127_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
WP_000118563.1|112256_113333_-	signal peptidase II	NA	NA	NA	NA	NA
WP_004213585.1|113329_115735_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_000405672.1|115820_116255_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004152084.1|116550_117951_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_131312232.1|117947_118628_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004213583.1|118682_119612_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|119616_119997_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_011251290.1|120036_120933_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_004213580.1|120932_122750_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|122983_123433_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|123721_124459_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|124492_124690_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|124730_127178_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|127304_127745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|127831_130978_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004213579.1|130988_132281_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004213578.1|132394_132757_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004213577.1|132785_134171_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_004213574.1|134360_135041_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.7	1.3e-30
WP_000555737.1|135033_136509_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_023302802.1|136759_137191_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_004213569.1|137334_137685_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	3.2e-20
WP_023302803.1|138071_138980_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_004213565.1|139616_140591_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_077250520.1|141523_142336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213560.1|142332_143112_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
WP_004213558.1|143256_144186_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_077250517.1|144498_144657_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
WP_011154535.1|144771_145740_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	1.1e-171
144720:144734	attR	TTTGTTGAATAAATA	NA	NA	NA	NA
WP_023302792.1|145780_146635_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_004215174.1|146683_148909_-	exclusion suppressor FxsA	NA	NA	NA	NA	NA
WP_004215173.1|148910_149813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004225020.1|149896_150079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004215188.1|150097_150559_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004215186.1|150674_151622_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004225018.1|151957_152953_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|153158_154172_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004210220.1|154284_154812_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_077250518.1|154825_157783_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
>prophage 2
NZ_LR745043	Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154	215306	207464	214577	215306	transposase	Stx2-converting_phage(28.57%)	7	NA	NA
WP_004213807.1|207464_208433_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_023302784.1|208701_210294_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	4.2e-176
WP_004189161.1|210324_210675_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004215130.1|210671_211112_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004902307.1|211308_211491_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_023302806.1|212439_213411_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	89.7	6.6e-156
WP_004211841.1|213410_214577_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
