The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR740776	Escherichia coli strain BEN2908 isolate 1 day old chicken chromosome APEC2908	5061728	274240	327023	5061728	transposase,capsid,plate,integrase	Enterobacteria_phage(30.0%)	53	314804:314823	327167:327186
WP_000224516.1|274240_275587_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013423.1|275589_276114_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433564.1|276110_277403_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896714.1|277407_278457_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000946068.1|280275_280701_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000111582.1|280705_282190_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041480.1|282212_282716_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|283421_283940_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000053636.1|284160_286143_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	2.6e-26
WP_000571853.1|286249_287296_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000528852.1|287288_288728_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000513317.1|288702_288993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227712.1|290243_290747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298174.1|290840_291329_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001118042.1|291599_292370_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532690.1|292523_292997_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973137.1|293039_295484_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|295723_296302_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001331866.1|296506_297274_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|297244_297985_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093934.1|298296_299046_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_000006241.1|299221_299719_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_014639450.1|299801_299960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021512212.1|300038_301778_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207544.1|301722_302508_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|302578_303634_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_161476128.1|303685_303979_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|303981_304380_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059895.1|304389_304842_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001331869.1|305019_306171_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
WP_000602123.1|306167_306782_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292999.1|306838_308296_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291988.1|308556_309015_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189577.1|309106_310351_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|310408_310810_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749902.1|310919_311975_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
WP_001285288.1|312263_313367_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893305.1|313378_314632_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
314804:314823	attL	ACTCCTATTATCGGCACCAT	NA	NA	NA	NA
WP_000788777.1|315453_315612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059250298.1|316041_316581_-	recombinase family protein	NA	Q2A092	Sodalis_phage	42.5	1.9e-27
WP_000870967.1|318574_318763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005056.1|318782_318950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129967574.1|319001_319655_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001513607.1|319666_319945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113854167.1|320074_320482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089551358.1|320483_320819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000898164.1|321162_321375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060877162.1|321371_321734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129967576.1|321752_322781_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000452041.1|322867_323071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161476129.1|323086_324919_+	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	30.0	4.7e-30
WP_161476130.1|324950_325664_+	hypothetical protein	NA	I7I023	Enterobacteria_phage	48.3	8.2e-47
WP_174235612.1|325745_327023_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
327167:327186	attR	ACTCCTATTATCGGCACCAT	NA	NA	NA	NA
>prophage 2
NZ_LR740776	Escherichia coli strain BEN2908 isolate 1 day old chicken chromosome APEC2908	5061728	901526	911766	5061728	protease	Vibrio_phage(33.33%)	6	NA	NA
WP_000188147.1|901526_903473_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|903545_903770_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|904092_904413_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|904443_906720_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|907552_908536_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101565.1|908532_911766_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
>prophage 3
NZ_LR740776	Escherichia coli strain BEN2908 isolate 1 day old chicken chromosome APEC2908	5061728	1159008	1207674	5061728	protease,capsid,lysis,tRNA,head,terminase,tail,integrase	Enterobacteria_phage(51.85%)	62	1149528:1149541	1179299:1179312
1149528:1149541	attL	CACCACCACAAATG	NA	NA	NA	NA
WP_001298466.1|1159008_1160115_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1160168_1160630_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|1160639_1161293_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1161464_1162715_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1162828_1163971_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1163960_1164197_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1164336_1164576_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1164559_1164886_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1164885_1165107_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|1165493_1165685_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1165657_1165840_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1165836_1166517_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1166513_1167299_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995434.1|1167304_1167601_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000372923.1|1167676_1167820_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|1167788_1167953_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|1168025_1168394_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|1168576_1168777_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066170.1|1168990_1169572_+	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000088199.1|1169588_1169861_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|1169838_1170021_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|1170297_1171050_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|1171046_1171604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302016.1|1171643_1172339_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1172414_1172630_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|1172771_1173068_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000185431.1|1173100_1174000_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000788872.1|1173996_1174698_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|1174694_1174985_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|1175058_1175499_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|1175495_1176023_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|1176019_1176196_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|1176198_1176540_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099712.1|1176746_1177109_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|1177105_1177246_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|1177331_1177715_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1177903_1178986_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1179574_1179790_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
1179299:1179312	attR	CATTTGTGGTGGTG	NA	NA	NA	NA
WP_001228695.1|1181280_1181463_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1181553_1181847_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1182327_1182654_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1182860_1183043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867568.1|1183606_1184155_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_161476313.1|1187037_1188744_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.3	1.0e-236
WP_000259002.1|1188727_1188934_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001253914.1|1190510_1192016_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256840.1|1192052_1192400_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522648.1|1192457_1193486_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000201530.1|1193537_1193912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|1193904_1194258_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|1194269_1194848_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_000683145.1|1194844_1195240_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001351266.1|1195247_1195988_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000479129.1|1196003_1196426_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459474.1|1196407_1196842_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_032153373.1|1196834_1199396_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	96.2	0.0e+00
WP_000847405.1|1199392_1199722_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_032165805.1|1200424_1201168_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	3.0e-145
WP_000090891.1|1201104_1201737_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515327.1|1201797_1205280_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000290543.1|1205338_1207399_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000654167.1|1207395_1207674_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
>prophage 4
NZ_LR740776	Escherichia coli strain BEN2908 isolate 1 day old chicken chromosome APEC2908	5061728	1314522	1383726	5061728	protease,capsid,portal,head,terminase,holin,tail,integrase	Escherichia_phage(38.46%)	78	1307127:1307142	1378988:1379003
1307127:1307142	attL	AAAACCTTTATCGTCG	NA	NA	NA	NA
WP_161476162.1|1314522_1315653_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	1.7e-102
WP_000113189.1|1315630_1315879_-	excisionase	NA	NA	NA	NA	NA
WP_000048437.1|1315943_1318415_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090200.1|1318507_1318699_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449191.1|1318695_1318884_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000358769.1|1319455_1319734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394529.1|1319693_1320095_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
WP_001171958.1|1320117_1320336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379612.1|1320495_1320651_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000753626.1|1320903_1321365_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_001053425.1|1321472_1321748_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000702041.1|1321731_1322157_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262415.1|1322228_1323269_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_001309414.1|1323180_1323723_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450702.1|1323756_1324527_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	6.7e-87
WP_001151161.1|1324542_1324968_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|1325142_1325808_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018428.1|1325988_1326201_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	3.1e-26
WP_001004956.1|1326366_1327017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|1326997_1328101_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000687431.1|1328258_1328432_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_001403449.1|1328491_1328764_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_001265091.1|1328765_1329812_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_001554974.1|1329824_1330184_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.8	3.5e-38
WP_001064895.1|1330180_1330870_+	antiterminator	NA	I6PDF8	Cronobacter_phage	45.1	1.1e-51
WP_001336255.1|1330941_1331781_+	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	40.2	1.8e-45
WP_000615423.1|1331777_1332521_+	protein phosphatase 2C domain-containing protein	NA	I6PCV8	Cronobacter_phage	43.1	1.6e-48
WP_077466990.1|1332631_1332958_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	96.8	2.0e-45
WP_000874518.1|1334231_1336085_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.2	0.0e+00
WP_000284510.1|1336235_1336451_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193304.1|1336455_1336800_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_000369850.1|1336765_1337038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021566721.1|1340529_1340712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|1340726_1340858_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_071606003.1|1341080_1341266_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	90.2	7.3e-24
WP_000347013.1|1341678_1341819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|1341951_1342137_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_001102142.1|1342524_1343073_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.0	6.7e-57
WP_001348272.1|1343044_1344973_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
WP_161476163.1|1344956_1345163_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	53.8	1.1e-09
WP_161476164.1|1345159_1346752_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	8.4e-185
WP_137539714.1|1346741_1348247_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.2	6.7e-99
WP_000256823.1|1348283_1348631_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|1348688_1349717_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201501.1|1349768_1350152_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|1350144_1350498_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|1350513_1351047_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|1351043_1351439_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|1351446_1352199_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479094.1|1352212_1352644_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	78.1	3.7e-42
WP_000533402.1|1352670_1353084_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000847298.1|1355633_1355963_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001335877.1|1355962_1356661_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000194723.1|1356671_1357415_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_072129443.1|1357360_1357993_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	2.1e-102
WP_016235292.1|1358336_1361810_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_001233154.1|1361877_1362477_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	4.5e-107
WP_161476165.1|1362628_1365655_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	55.0	4.0e-58
WP_000885577.1|1365654_1366239_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_023141128.1|1366293_1366962_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1367018_1367288_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|1367402_1367573_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079492.1|1368060_1368567_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|1368612_1369113_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|1369198_1369378_-	general stress protein	NA	NA	NA	NA	NA
WP_000443098.1|1369758_1370565_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|1370564_1371758_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195306.1|1371769_1373128_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|1373131_1374727_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194639.1|1374726_1376289_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1376380_1376425_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_021512122.1|1376562_1377444_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1377440_1378061_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001350892.1|1378088_1379984_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
1378988:1379003	attR	CGACGATAAAGGTTTT	NA	NA	NA	NA
WP_001291206.1|1380196_1381072_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|1381111_1381702_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_161476166.1|1381698_1382457_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	5.7e-06
WP_000422062.1|1382676_1383726_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_LR740776	Escherichia coli strain BEN2908 isolate 1 day old chicken chromosome APEC2908	5061728	2110315	2152727	5061728	capsid,terminase,plate,holin,integrase	Salmonella_phage(36.67%)	66	2121320:2121334	2155099:2155113
WP_000830156.1|2110315_2111482_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	2.9e-227
WP_021568403.1|2112211_2113249_+	acyltransferase	NA	NA	NA	NA	NA
WP_161476195.1|2113681_2114845_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	69.5	6.0e-63
WP_161476196.1|2114826_2115507_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	80.5	1.0e-107
WP_161476197.1|2115503_2116703_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	88.9	8.8e-195
WP_001270637.1|2116702_2117056_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	6.9e-55
WP_021568408.1|2117055_2117811_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	85.7	1.0e-111
WP_000095759.1|2117868_2118441_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_021568409.1|2118766_2119117_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.1	1.5e-22
WP_021568410.1|2119113_2120181_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.9	2.0e-153
WP_021568411.1|2120183_2120486_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	89.0	4.5e-47
WP_021568412.1|2120485_2121073_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	9.0e-84
WP_021568413.1|2121072_2123061_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	73.9	2.0e-268
2121320:2121334	attL	GGATCGCTCATATTC	NA	NA	NA	NA
WP_000393964.1|2123238_2123691_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.0	2.2e-58
WP_021568414.1|2123694_2124135_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	2.7e-56
WP_021568415.1|2124145_2125291_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	1.0e-160
WP_021568416.1|2125294_2125858_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	77.4	1.2e-82
WP_001142480.1|2125832_2126222_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	2.5e-66
WP_021568417.1|2126208_2126763_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	81.5	1.1e-78
WP_021568418.1|2126759_2127167_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	2.5e-69
WP_161476317.1|2127165_2127399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627479.1|2127395_2128337_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	5.4e-155
WP_001066728.1|2128348_2128855_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	1.3e-70
WP_021568419.1|2128858_2130079_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	92.2	2.4e-211
WP_000246482.1|2130093_2130831_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	96.0	6.0e-109
WP_021568420.1|2130715_2132185_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.5	4.3e-268
WP_001130793.1|2132184_2133807_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_001218996.1|2133809_2134361_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	70.3	1.9e-67
WP_032145900.1|2134314_2134929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113285.1|2135061_2135247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021568423.1|2135390_2135783_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	82.2	2.8e-49
WP_021568424.1|2135766_2136243_-	glycoside hydrolase family protein	NA	K7P7Y6	Enterobacteria_phage	93.7	2.1e-83
WP_000783734.1|2136226_2136550_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_161476318.1|2136806_2137043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161476198.1|2137076_2137565_-	antiterminator	NA	M1FPN0	Enterobacteria_phage	98.8	1.7e-88
WP_161476199.1|2137561_2137750_-	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	1.2e-26
WP_001008199.1|2137746_2138109_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_129429202.1|2138105_2138396_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	99.0	7.6e-52
WP_021514115.1|2138395_2139118_-	phage antirepressor KilAC domain-containing protein	NA	K7P7L0	Enterobacteria_phage	91.7	8.1e-119
WP_000566998.1|2139110_2139281_-	protein ninF	NA	A0A2I6PIG4	Escherichia_phage	100.0	7.2e-26
WP_062810299.1|2139277_2139460_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	98.3	2.8e-28
WP_063113109.1|2139456_2139867_-	recombination protein NinB	NA	K7P6Y3	Enterobacteria_phage	98.5	9.4e-72
WP_161476200.1|2139869_2140142_-	hypothetical protein	NA	K7PKU8	Enterobacteria_phage	63.5	6.7e-26
WP_001549089.1|2140632_2142069_-	AAA family ATPase	NA	K7PGR8	Enterobacteria_phage	100.0	7.9e-275
WP_000539336.1|2142058_2142949_-	hypothetical protein	NA	G5DA89	Enterobacteria_phage	99.7	3.4e-159
WP_000166961.1|2142935_2143097_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000536663.1|2143131_2143413_-	hypothetical protein	NA	K7PMG0	Enterobacteria_phage	98.9	7.4e-44
WP_000067728.1|2143529_2143745_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	98.6	8.2e-35
WP_001519589.1|2143820_2144516_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
WP_161476319.1|2144902_2145271_+	antitermination protein	NA	Q716D8	Shigella_phage	97.3	3.0e-53
WP_157912652.1|2145279_2145417_+	hypothetical protein	NA	Q716D9	Shigella_phage	95.6	1.1e-21
WP_161476201.1|2145471_2145921_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	87.2	1.8e-68
WP_000776961.1|2146109_2146421_+	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	98.1	4.6e-55
WP_000972063.1|2146496_2146631_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|2146615_2146768_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_130526253.1|2147022_2147730_+	recombinase	NA	K7PKU3	Enterobacteria_phage	98.3	7.2e-136
WP_103216220.1|2147730_2148204_+	single-stranded DNA-binding protein	NA	G8EYH4	Enterobacteria_phage	96.8	2.5e-60
WP_016063329.1|2148706_2149000_+	DUF2856 family protein	NA	K7P845	Enterobacteria_phage	100.0	8.5e-51
WP_161476202.1|2149010_2149178_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	92.7	1.5e-20
WP_161476203.1|2149174_2149567_+	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	45.7	9.7e-34
WP_161476204.1|2149568_2149760_+	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	96.8	1.8e-25
WP_161476205.1|2149762_2150605_+	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	53.7	3.5e-65
WP_000002107.1|2150597_2150882_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_001281192.1|2150954_2151299_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_000132739.1|2151376_2151568_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_024239930.1|2151548_2152727_-|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.7	6.8e-232
2155099:2155113	attR	GAATATGAGCGATCC	NA	NA	NA	NA
>prophage 6
NZ_LR740776	Escherichia coli strain BEN2908 isolate 1 day old chicken chromosome APEC2908	5061728	2181868	2189603	5061728		Enterobacteria_phage(33.33%)	8	NA	NA
WP_001033086.1|2181868_2182975_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.6	5.9e-44
WP_001332228.1|2182967_2183435_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_032139969.1|2183421_2183832_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000857507.1|2183849_2184725_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.6e-107
WP_001023648.1|2184783_2185683_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	8.2e-28
WP_000699453.1|2185682_2186768_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.6e-100
WP_000183029.1|2187140_2188034_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.4	1.3e-46
WP_001116045.1|2188208_2189603_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.4e-18
>prophage 7
NZ_LR740776	Escherichia coli strain BEN2908 isolate 1 day old chicken chromosome APEC2908	5061728	2498828	2570386	5061728	protease,coat,lysis,portal,tRNA,head,terminase,holin,tail,integrase	Enterobacteria_phage(77.59%)	87	2515786:2515802	2560503:2560519
WP_161476216.1|2498828_2499641_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289178.1|2499640_2500654_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699136.1|2500719_2501856_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
WP_000615815.1|2501954_2502950_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_161476321.1|2502946_2504125_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817178.1|2504389_2505610_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683753.1|2505768_2507775_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|2507895_2508174_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089236.1|2508207_2508756_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|2508755_2509565_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043802.1|2509564_2510389_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_161476217.1|2510392_2511478_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.5	2.0e-89
WP_001298774.1|2511512_2512445_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2512610_2513162_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001350713.1|2513481_2514324_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001050125.1|2514325_2514853_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000824843.1|2514849_2515329_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000642895.1|2515325_2515829_-	fimbrial protein	NA	NA	NA	NA	NA
2515786:2515802	attL	GCCAGCAATAGCGCGGC	NA	NA	NA	NA
WP_000120670.1|2515845_2516598_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001447287.1|2516617_2519266_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000032640.1|2519346_2519913_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001195816.1|2520478_2520964_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425008.1|2521166_2523311_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|2523310_2524621_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|2524801_2525086_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001350714.1|2525457_2526798_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|2526855_2527611_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|2527904_2528837_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
WP_000958671.1|2529148_2530306_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_161476218.1|2531489_2534435_-|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	99.4	0.0e+00
WP_048955279.1|2534613_2535492_-	antirepressor	NA	I6R977	Salmonella_phage	78.5	6.9e-96
WP_000620145.1|2535554_2535728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410001.1|2535724_2535877_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_049044991.1|2535991_2536246_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000954424.1|2536686_2537130_-	SocA family protein	NA	I6R0L8	Salmonella_phage	70.1	1.2e-59
WP_061335900.1|2537504_2537999_+	hypothetical protein	NA	A8CGD7	Salmonella_phage	91.5	3.1e-77
WP_161476322.1|2538021_2539860_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	75.1	5.1e-250
WP_161476219.1|2539859_2541269_-	phage DNA ejection protein	NA	A0A2H4FND5	Salmonella_phage	68.9	3.9e-149
WP_161476220.1|2541278_2541953_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	69.9	8.5e-54
WP_087905996.1|2541930_2542407_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	3.8e-64
WP_021562845.1|2542406_2543360_-	hypothetical protein	NA	Q716G6	Shigella_phage	83.9	1.0e-92
WP_161476221.1|2543359_2544778_-	hypothetical protein	NA	A0A2D1GM00	Escherichia_phage	99.4	9.2e-276
WP_001140510.1|2544787_2545249_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001389518.1|2545229_2545418_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_000370106.1|2545459_2546713_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	99.0	3.1e-235
WP_000372589.1|2546731_2547625_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000818372.1|2547715_2549914_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.4	0.0e+00
WP_000200770.1|2549915_2551331_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.6	7.5e-278
WP_000113731.1|2551327_2551768_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807790.1|2551770_2552013_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	1.1e-35
WP_001059339.1|2552313_2552838_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_001139677.1|2553040_2553193_-	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	98.0	8.1e-21
WP_000092261.1|2553180_2553648_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	96.1	4.6e-75
WP_000229392.1|2553644_2554121_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_112048543.1|2554124_2554421_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	2.2e-46
WP_001235421.1|2555099_2555723_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	1.5e-113
WP_000994515.1|2555719_2555908_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001008199.1|2555904_2556267_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002245.1|2556263_2556554_-	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001004257.1|2556553_2557276_-	phage antirepressor KilAC domain-containing protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000950950.1|2557268_2557445_-	protein ninF	NA	A5VW88	Enterobacteria_phage	100.0	1.5e-26
WP_000386637.1|2557437_2557785_-	DUF2591 domain-containing protein	NA	A5VW89	Enterobacteria_phage	100.0	1.8e-63
WP_001254255.1|2557787_2557964_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000736904.1|2557960_2558401_-	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.0e-81
WP_001248381.1|2558675_2560052_-	AAA family ATPase	NA	A5VW94	Enterobacteria_phage	100.0	5.7e-254
WP_000431320.1|2560048_2560936_-	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	1.3e-145
2560503:2560519	attR	GCCGCGCTATTGCTGGC	NA	NA	NA	NA
WP_001244621.1|2560998_2561271_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|2561293_2561587_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000276886.1|2561695_2561881_-	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|2561961_2562612_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_011478232.1|2562732_2563122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000219338.1|2563133_2563433_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	100.0	9.0e-32
WP_000213976.1|2563511_2563712_+	Restriction inhibitor protein ral	NA	A5VWA0	Enterobacteria_phage	100.0	3.2e-33
WP_000392426.1|2563770_2564193_+	hypothetical protein	NA	A5VWA1	Enterobacteria_phage	100.0	3.3e-72
WP_000638547.1|2565376_2565508_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|2565492_2565645_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000031365.1|2565901_2566507_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_000951332.1|2566506_2566890_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_001111304.1|2566913_2567210_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000812193.1|2567304_2567823_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_000215166.1|2567819_2568119_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_161476222.1|2568120_2568783_+	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	58.7	3.3e-58
WP_074417038.1|2568784_2569327_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	51.2	4.9e-36
WP_000253289.1|2569326_2569611_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_000002106.1|2569603_2569888_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000545737.1|2569960_2570128_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|2570185_2570386_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 8
NZ_LR740776	Escherichia coli strain BEN2908 isolate 1 day old chicken chromosome APEC2908	5061728	2791670	2885960	5061728	protease,capsid,lysis,portal,tRNA,head,terminase,plate,holin,tail,integrase	Shigella_phage(38.1%)	104	2826473:2826488	2858719:2858734
WP_000997387.1|2791670_2792708_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2792914_2793334_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|2793402_2794101_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082937.1|2794132_2796793_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2796906_2798262_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|2798307_2798631_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001298619.1|2798627_2799926_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001350770.1|2808358_2810932_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|2811061_2811793_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079114.1|2811789_2812770_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2812904_2813642_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2813911_2814253_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2814356_2814404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200106.1|2814502_2815663_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|2815705_2816827_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168025.1|2816837_2817908_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|2818117_2818483_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|2818631_2819150_+	YfiR family protein	NA	NA	NA	NA	NA
WP_161476232.1|2819139_2820366_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|2820381_2820864_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2820940_2821288_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2821329_2822097_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2822127_2822676_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2822694_2822943_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2823079_2824441_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2824607_2825399_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2825419_2826706_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
2826473:2826488	attL	GATGGCACCGCCAACG	NA	NA	NA	NA
WP_001332400.1|2826760_2827354_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2827476_2828355_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|2828440_2830102_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2830250_2830592_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2830653_2830944_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2830933_2831410_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2831541_2832024_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_024225803.1|2832785_2833997_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.6	7.5e-109
WP_089551099.1|2834247_2835132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062892011.1|2835568_2836141_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	8.5e-95
WP_000984201.1|2836155_2836401_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	100.0	1.8e-41
WP_062892013.1|2836397_2837132_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	2.3e-129
WP_001149160.1|2837684_2837951_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_161476233.1|2837947_2838547_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	7.8e-51
WP_001570614.1|2838539_2838827_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	95.8	9.5e-47
WP_097518746.1|2838819_2839275_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|2839410_2839731_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_039000567.1|2839745_2842079_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.2	0.0e+00
WP_058661114.1|2842576_2843263_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_062892052.1|2843230_2844064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000183405.1|2845463_2846252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174562.1|2846339_2846633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353910.1|2846843_2847617_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000834402.1|2848668_2850558_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001115559.1|2850811_2851303_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_001089535.1|2851305_2851749_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_000356380.1|2851720_2852323_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_000554665.1|2852322_2853066_-|tail	tail fiber protein	tail	O22004	Shigella_phage	92.6	3.7e-50
WP_000539246.1|2853069_2853654_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000785328.1|2853644_2854703_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000424731.1|2854689_2855115_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000103707.1|2855114_2855663_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000999498.1|2855662_2856742_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_001350765.1|2856738_2858067_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000807182.1|2858127_2859963_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
2858719:2858734	attR	GATGGCACCGCCAACG	NA	NA	NA	NA
WP_000661051.1|2860104_2860374_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|2860373_2860730_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_021512429.1|2860729_2862226_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	5.0e-272
WP_000497751.1|2862209_2862380_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_021512430.1|2862388_2862949_-	hypothetical protein	NA	S5FM61	Shigella_phage	99.5	4.0e-105
WP_000213503.1|2862945_2863452_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000702385.1|2863426_2863837_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000927711.1|2863833_2864157_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|2864159_2864360_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257492.1|2864409_2865615_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_001193631.1|2865629_2866280_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_161476234.1|2866257_2867028_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.6	9.2e-145
WP_161476235.1|2867070_2867499_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	99.3	3.1e-78
WP_000605604.1|2867498_2867681_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|2867692_2869189_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|2869422_2869917_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135216.1|2870042_2870393_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_000026993.1|2870495_2870936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001332386.1|2871042_2871294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092331.1|2871364_2871802_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001180490.1|2871798_2872275_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000544527.1|2872261_2872567_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_000606308.1|2872718_2873054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161476236.1|2873239_2873992_-	antitermination protein	NA	Q8SBE4	Shigella_phage	97.6	4.2e-134
WP_001061411.1|2874999_2875797_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_000767113.1|2875816_2876206_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210172.1|2876202_2876529_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_161476323.1|2876525_2876762_-	hypothetical protein	NA	A0A0P0ZCC0	Stx2-converting_phage	97.4	1.5e-37
WP_119159180.1|2876780_2877179_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.2	3.4e-74
WP_001332382.1|2877178_2877673_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104933.1|2877669_2878611_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001250269.1|2878600_2878780_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|2878955_2879507_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|2879550_2879751_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|2879841_2880516_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000500990.1|2880718_2881231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135691.1|2881699_2882062_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000081287.1|2882127_2882952_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008234.1|2883079_2883604_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_161476237.1|2883712_2884579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|2884620_2884827_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531794.1|2884787_2885960_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
>prophage 9
NZ_LR740776	Escherichia coli strain BEN2908 isolate 1 day old chicken chromosome APEC2908	5061728	2964314	2971454	5061728		Escherichia_phage(83.33%)	6	NA	NA
WP_161476239.1|2964314_2966876_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.0	2.0e-31
WP_001141302.1|2966981_2967638_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001296319.1|2967688_2968456_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|2968651_2969560_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590420.1|2969556_2970819_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279003.1|2970815_2971454_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 10
NZ_LR740776	Escherichia coli strain BEN2908 isolate 1 day old chicken chromosome APEC2908	5061728	4304408	4378487	5061728	protease,capsid,lysis,portal,tRNA,head,terminase,holin,plate,tail,integrase	Escherichia_phage(48.89%)	87	4331263:4331309	4362508:4362554
WP_000560983.1|4304408_4304846_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4304890_4305832_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001331553.1|4305895_4306804_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897302.1|4307032_4307344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4307344_4307635_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001296612.1|4307993_4308272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001314326.1|4308667_4308886_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_000027720.1|4309101_4310031_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|4310027_4310663_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4310659_4311562_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_012579028.1|4311574_4314625_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_137584739.1|4314818_4315652_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000749934.1|4316781_4318176_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000619492.1|4318216_4318531_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179744.1|4318540_4319365_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001298699.1|4319641_4320901_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144110.1|4320897_4322367_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217149.1|4322654_4323491_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_161476281.1|4323474_4324413_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063507.1|4324409_4325444_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001350871.1|4325728_4326349_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	2.4e-63
WP_001166063.1|4326608_4327592_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270237.1|4327740_4328415_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4328520_4329894_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|4329890_4330589_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001350872.1|4330738_4331239_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4331263:4331309	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000027751.1|4331424_4332405_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	96.9	4.1e-182
WP_000703053.1|4332517_4332811_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	64.9	4.0e-32
WP_001430611.1|4332958_4333231_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	80.0	3.1e-39
WP_001284599.1|4333285_4333474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998639.1|4333477_4333654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001157771.1|4333771_4333942_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	3.9e-24
WP_000217667.1|4333938_4334439_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.0e-91
WP_000557701.1|4334502_4334727_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_001277958.1|4334726_4335029_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_001113263.1|4335028_4335253_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_000027667.1|4335249_4335525_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_021512553.1|4335514_4337809_+	replication endonuclease	NA	M1SV59	Escherichia_phage	97.2	0.0e+00
WP_000742296.1|4338005_4339181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001469928.1|4339183_4340140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123601.1|4340147_4341131_-	DNA (cytosine-5-)-methyltransferase	NA	Q7Y4B5	Escherichia_virus	63.3	3.4e-120
WP_021512554.1|4341526_4342561_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	1.8e-199
WP_021512555.1|4342560_4344333_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085946.1|4344506_4345361_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	97.2	7.6e-132
WP_021512556.1|4345419_4346493_+|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	98.9	4.3e-201
WP_021512557.1|4346496_4347234_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	98.0	3.7e-127
WP_021512558.1|4347333_4347843_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_000846399.1|4347842_4348046_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|4348049_4348331_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|4348330_4348828_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_021512559.1|4348842_4349268_+	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	97.9	4.5e-61
WP_021512560.1|4349255_4349681_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	96.5	4.7e-66
WP_001440152.1|4349652_4349826_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917186.1|4349788_4350256_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_001001767.1|4350248_4350701_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	2.4e-76
WP_021512561.1|4350767_4351403_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	5.5e-111
WP_000127173.1|4351399_4351747_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_064770412.1|4351751_4352660_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	2.2e-161
WP_001285352.1|4352652_4353264_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_161476282.1|4353260_4354916_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	50.0	2.6e-120
WP_016235447.1|4354915_4355518_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	85.5	2.7e-91
WP_021512564.1|4355794_4356985_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_021512565.1|4356997_4357516_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	1.9e-93
WP_001031303.1|4357572_4357848_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4357880_4358000_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_016235449.1|4357992_4360440_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	92.9	0.0e+00
WP_016235450.1|4360454_4360934_+|tail	phage tail protein	tail	O64315	Escherichia_phage	97.5	1.3e-83
WP_021512566.1|4360933_4362097_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	1.6e-204
WP_000468308.1|4362178_4362397_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_021512567.1|4362632_4363535_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4362508:4362554	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4363715_4364678_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758730.1|4364997_4365987_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000709001.1|4366093_4366849_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4366903_4367671_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802217.1|4367778_4368378_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|4368478_4368919_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4369130_4369430_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|4369456_4369885_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796344.1|4369889_4370636_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4370732_4371743_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_032249974.1|4371913_4373422_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4373444_4374290_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4374714_4374960_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4375044_4375530_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|4375622_4376549_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|4376615_4377947_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208235.1|4377956_4378487_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 11
NZ_LR740776	Escherichia coli strain BEN2908 isolate 1 day old chicken chromosome APEC2908	5061728	4984214	5032222	5061728	protease,portal,terminase,holin,tail,integrase	Enterobacteria_phage(46.94%)	59	4976906:4976921	5039146:5039161
4976906:4976921	attL	GCGGCGAAAGCGGTGA	NA	NA	NA	NA
WP_001218288.1|4984214_4985438_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.3	4.0e-235
WP_000040219.1|4985723_4986443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206807.1|4986919_4987540_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	90.3	5.9e-110
WP_001242715.1|4987539_4987902_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	7.5e-65
WP_000008185.1|4987892_4988429_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	1.4e-99
WP_161476304.1|4989444_4989807_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	2.5e-60
WP_000848749.1|4990475_4991150_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
WP_000649477.1|4991240_4991441_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521504.1|4991484_4992036_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	99.5	2.2e-100
WP_161476305.1|4992032_4992869_+	ash family protein	NA	Q8SBF3	Shigella_phage	89.9	7.2e-135
WP_000933941.1|4992861_4993098_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.4	1.3e-38
WP_000061487.1|4993094_4993913_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	87.8	6.2e-123
WP_000055034.1|4993915_4994404_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	1.4e-85
WP_000210132.1|4994403_4994730_+	LexA repressor	NA	U5P451	Shigella_phage	96.3	1.1e-51
WP_000767093.1|4994726_4995116_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	2.1e-68
WP_001061398.1|4995135_4995933_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	9.8e-150
WP_016230662.1|4995940_4996930_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	4.3e-195
WP_001047084.1|4996943_4997696_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.4	1.1e-131
WP_016230663.1|4997967_4998057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087756.1|4998111_4998324_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066482.1|4998624_4998840_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000839581.1|4999592_4999808_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000189904.1|4999812_5000364_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	50.6	4.2e-35
WP_001306174.1|5000311_5000572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101173.1|5000685_5001219_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001071776.1|5001215_5001713_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|5002076_5002289_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|5002299_5002488_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|5002635_5002791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|5002963_5003137_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|5003432_5003639_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000349509.1|5004191_5004683_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934113.1|5004682_5006785_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
WP_001072975.1|5006781_5006994_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985947.1|5006993_5008502_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
WP_001136588.1|5008446_5010474_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097041.1|5010560_5010884_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001283153.1|5010876_5011152_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677127.1|5011163_5011742_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	3.6e-101
WP_001079398.1|5011738_5012140_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211132.1|5012150_5012894_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001341514.1|5012954_5013341_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_001161009.1|5013349_5013679_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372024.1|5013650_5016716_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447251.1|5016715_5017045_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_000741589.1|5018392_5019040_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_161476307.1|5019100_5022496_+	DUF1983 domain-containing protein	NA	A0A0K2FI38	Escherichia_phage	89.7	0.0e+00
WP_001233090.1|5022563_5023163_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_000741761.1|5023227_5025606_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	75.9	7.4e-185
WP_000654139.1|5025605_5025887_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	3.1e-18
WP_000235978.1|5025896_5026601_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
WP_000355601.1|5026611_5026905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086522.1|5027132_5027723_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|5028039_5028273_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_001372053.1|5028341_5028455_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|5028881_5029130_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202563.1|5029349_5030936_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|5031328_5031934_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5032060_5032222_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
5039146:5039161	attR	GCGGCGAAAGCGGTGA	NA	NA	NA	NA
