The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR739068	Pseudomonas aeruginosa strain PcyII-29 isolate PcyII-29 chromosome PcyII-29	6621209	642225	694860	6621209	tRNA,tail,plate	Pseudomonas_phage(24.0%)	55	NA	NA
WP_003099590.1|642225_643251_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	1.4e-108
WP_003085061.1|643329_643899_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|643982_644336_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|644326_644869_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|644841_646074_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_003099582.1|646117_646624_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|646717_648271_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|648267_649539_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|649639_651562_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|651840_652173_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003099572.1|652216_653068_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2R4ALP3	Aeromonas_phage	44.2	2.4e-08
WP_003085085.1|653067_653448_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|653484_654291_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003099567.1|654406_655393_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|655389_656682_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003099560.1|656662_659434_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003099554.1|659560_660577_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003099549.1|660573_661248_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|661249_662008_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003099546.1|662008_663070_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_003099544.1|663221_665615_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|665660_666293_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|666421_667456_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|667689_668799_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|668854_669901_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003099537.1|670014_671262_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|671367_672198_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|672321_672996_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|672995_673814_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|673886_675365_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003085128.1|675552_675867_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_003085129.1|675966_676737_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.0	6.1e-72
WP_003085132.1|677194_677395_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003085135.1|677442_677802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|678164_678614_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|678635_679151_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003085141.1|679147_679705_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003085143.1|679857_680184_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085151.1|680180_681068_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003137385.1|681060_681594_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_003101626.1|681595_683704_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	52.1	2.5e-224
WP_003085172.1|683712_684153_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_003101628.1|684195_685356_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.6	7.8e-188
WP_003085175.1|685368_685872_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|685886_686231_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003101633.1|686400_688638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085182.1|688647_689520_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|689494_689701_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003101637.1|689758_690748_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	2.2e-106
WP_003085188.1|690780_691410_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	3.2e-87
WP_003101639.1|691406_691769_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	1.9e-15
WP_003118919.1|691765_692023_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003101640.1|692370_692976_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|692977_694027_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|694023_694860_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_LR739068	Pseudomonas aeruginosa strain PcyII-29 isolate PcyII-29 chromosome PcyII-29	6621209	875594	918206	6621209	capsid,portal,integrase,terminase,protease,tRNA,tail,head,holin	Pseudomonas_phage(91.23%)	59	869566:869581	901043:901058
869566:869581	attL	CTGCTGGCGCGCGGCG	NA	NA	NA	NA
WP_003129398.1|875594_876644_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	53.7	1.3e-101
WP_031640221.1|876643_876886_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	60.3	1.1e-16
WP_034002387.1|876869_877646_-	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	88.6	6.7e-111
WP_023092496.1|877642_877834_-	hypothetical protein	NA	A0A1W6JTB8	Pseudomonas_phage	98.4	1.2e-29
WP_023092499.1|879498_879930_-	hypothetical protein	NA	A0A0U1T4M5	Pseudomonas_phage	90.0	6.0e-61
WP_034002389.1|879926_880373_-	hypothetical protein	NA	Q6JIG5	Burkholderia_virus	70.3	6.2e-53
WP_034002391.1|880369_882280_-	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	94.7	4.1e-287
WP_023092501.1|882276_882705_-	hypothetical protein	NA	A0A291AUJ5	Sinorhizobium_phage	40.9	1.3e-12
WP_003129627.1|882749_883586_-	prohibitin family protein	NA	A0A0A0YRT7	Pseudomonas_phage	99.6	2.9e-128
WP_023121762.1|883582_883837_-	hypothetical protein	NA	A0A0A0YUF2	Pseudomonas_phage	96.4	9.4e-38
WP_023085534.1|883936_884170_-	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	96.1	2.1e-36
WP_033987591.1|884172_884553_-	response regulator transcription factor	NA	A0A1W6JTA9	Pseudomonas_phage	62.0	3.7e-30
WP_078451236.1|884668_885439_-	helix-turn-helix transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	51.9	2.2e-61
WP_031691380.1|886348_886660_+	hypothetical protein	NA	A0A0A0YUF6	Pseudomonas_phage	93.2	1.8e-46
WP_034053192.1|886656_886944_+	hypothetical protein	NA	A0A0A0YQ33	Pseudomonas_phage	98.9	1.3e-43
WP_023085532.1|886940_887249_+	hypothetical protein	NA	A0A0A0YWH5	Pseudomonas_phage	75.5	1.2e-34
WP_023085531.1|887245_887524_+	hypothetical protein	NA	A0A0A0YR77	Pseudomonas_phage	81.5	8.4e-32
WP_003119035.1|887516_887750_+	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	94.8	8.3e-33
WP_023083808.1|887746_888547_+	Rha family transcriptional regulator	NA	A0A1W6JTB2	Pseudomonas_phage	84.6	6.9e-119
WP_023083807.1|888543_888774_+	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	97.4	1.7e-38
WP_052150899.1|888770_889793_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	54.4	1.3e-42
WP_003159056.1|889776_890616_+	ATP-binding protein	NA	A0A1W6JTD8	Pseudomonas_phage	52.2	1.2e-70
WP_003159057.1|890612_892004_+	AAA family ATPase	NA	A0A1W6JTB3	Pseudomonas_phage	86.5	3.1e-231
WP_003159059.1|892000_893278_+|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	46.3	1.6e-101
WP_003159060.1|893292_893577_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	87.5	4.0e-37
WP_003159061.1|893573_894131_+	hypothetical protein	NA	A0A0A0YRV6	Pseudomonas_phage	80.7	1.7e-60
WP_071534974.1|894325_894865_+	DUF4124 domain-containing protein	NA	A0A1B0Z2K9	Pseudomonas_phage	83.8	1.3e-76
WP_003119044.1|895133_895469_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	100.0	2.2e-58
WP_034053194.1|895465_896083_+	glycoside hydrolase family 19 protein	NA	A0A0U4JP23	Pseudomonas_phage	93.7	4.7e-107
WP_171947066.1|896100_896532_+	hypothetical protein	NA	A0A0U4JX95	Pseudomonas_phage	89.2	2.5e-51
WP_023981182.1|896668_897073_+	HNH endonuclease	NA	A0A0U4B0J6	Pseudomonas_phage	52.7	3.7e-28
WP_014602593.1|897154_897637_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	74.4	1.4e-61
WP_034053197.1|897640_899368_+|terminase	terminase large subunit	terminase	A0A2D1GNU5	Pseudomonas_phage	76.3	1.2e-269
WP_023092517.1|899367_900591_+|portal	phage portal protein	portal	A0A2D1GNU4	Pseudomonas_phage	81.0	1.9e-189
WP_023092518.1|900568_901222_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2D1GNL2	Pseudomonas_phage	82.6	2.6e-100
901043:901058	attR	CTGCTGGCGCGCGGCG	NA	NA	NA	NA
WP_023092519.1|901232_902435_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	76.8	9.9e-178
WP_034053198.1|902480_902759_+	hypothetical protein	NA	A0A2D1GNQ9	Pseudomonas_phage	41.6	2.5e-15
WP_034053200.1|902751_903072_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2D1GNK0	Pseudomonas_phage	55.2	2.6e-29
WP_023093247.1|903094_903277_+	hypothetical protein	NA	A0A0U4K5G7	Pseudomonas_phage	55.9	3.1e-11
WP_034053203.1|903286_903838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034053205.1|903834_904428_+	hypothetical protein	NA	A0A0U4J906	Pseudomonas_phage	97.5	1.8e-100
WP_023092524.1|904440_904878_+	hypothetical protein	NA	A0A0U4IBQ1	Pseudomonas_phage	95.9	2.0e-72
WP_034053207.1|904901_905687_+	hypothetical protein	NA	A0A0U4ISK2	Pseudomonas_phage	96.9	6.7e-143
WP_023092526.1|905742_906108_+	hypothetical protein	NA	A0A0U4KLC4	Pseudomonas_phage	98.3	3.1e-58
WP_003098505.1|906152_906302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034053208.1|906291_908433_+	tape measure protein	NA	A0A0U3TH20	Pseudomonas_phage	98.9	0.0e+00
WP_003098501.1|908442_908946_+	hypothetical protein	NA	A0A0U4IIK1	Pseudomonas_phage	100.0	1.8e-93
WP_079382100.1|908947_910651_+	hypothetical protein	NA	A0A0U4JP39	Pseudomonas_phage	94.0	7.9e-306
WP_034008369.1|910653_911064_+	hypothetical protein	NA	A0A1W6JT78	Pseudomonas_phage	100.0	9.1e-59
WP_023092530.1|911063_911609_+	hypothetical protein	NA	A0A1W6JT85	Pseudomonas_phage	100.0	1.7e-100
WP_023092531.1|911619_912024_+	hypothetical protein	NA	A0A0U4B0P9	Pseudomonas_phage	98.5	7.6e-66
WP_023092532.1|912020_913679_+	hypothetical protein	NA	A0A0A0YRR5	Pseudomonas_phage	95.6	0.0e+00
WP_003159081.1|913699_914287_+	hypothetical protein	NA	A0A1B0Z051	Pseudomonas_phage	94.9	1.5e-102
WP_003159082.1|914279_914471_+	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	98.4	3.5e-29
WP_034008367.1|914475_915036_+	hypothetical protein	NA	A0A0U4JIY3	Pseudomonas_phage	98.4	7.2e-99
WP_023083623.1|915036_915318_+	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	95.7	7.4e-44
WP_003124028.1|916242_916542_+	hypothetical protein	NA	A0A1B0YZW1	Pseudomonas_phage	98.0	3.7e-49
WP_034053211.1|916538_916772_+	hypothetical protein	NA	A0A0S3UFY6	Pseudomonas_phage	97.3	4.4e-34
WP_003105684.1|916967_918206_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2C9CX69	Yersinia_phage	33.3	7.8e-53
>prophage 3
NZ_LR739068	Pseudomonas aeruginosa strain PcyII-29 isolate PcyII-29 chromosome PcyII-29	6621209	1470220	1479249	6621209		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1470220_1470856_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|1470901_1471795_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1471899_1472904_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1473330_1473654_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113873.1|1473720_1476288_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003098486.1|1476413_1477421_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1477568_1478075_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1478208_1479249_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 4
NZ_LR739068	Pseudomonas aeruginosa strain PcyII-29 isolate PcyII-29 chromosome PcyII-29	6621209	2584934	2591828	6621209	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003097631.1|2584934_2586215_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003097630.1|2586216_2587614_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2587618_2588593_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|2588680_2589664_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003119979.1|2589660_2589996_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003090391.1|2589992_2590298_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2590297_2590657_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003097619.1|2590653_2591049_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	4.5e-47
WP_003090386.1|2591159_2591828_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 5
NZ_LR739068	Pseudomonas aeruginosa strain PcyII-29 isolate PcyII-29 chromosome PcyII-29	6621209	2648904	2704137	6621209	integrase,tail,terminase,holin	Pseudomonas_phage(60.38%)	69	2652730:2652789	2704366:2704457
WP_020750450.1|2648904_2651790_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.6	1.9e-33
WP_003099002.1|2651880_2652414_+	hypothetical protein	NA	NA	NA	NA	NA
2652730:2652789	attL	CGGATTGCAAATCCGTGAACGCCGGTTCGATTCCGACCTCAGCCTCCAACAGGAAAGCCC	NA	NA	NA	NA
WP_031639986.1|2652875_2653940_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	58.4	5.2e-114
WP_003158549.1|2653941_2654175_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	50.7	5.6e-13
WP_003099004.1|2654231_2654618_-	hypothetical protein	NA	L7TJJ9	Pseudomonas_virus	99.2	1.0e-64
WP_003099016.1|2656032_2656362_+	hypothetical protein	NA	A0A1W6JTA1	Pseudomonas_phage	71.3	3.8e-39
WP_033871465.1|2656436_2656931_-	DUF550 domain-containing protein	NA	A0A2K8HR09	Pseudomonas_phage	92.7	5.1e-88
WP_108116075.1|2657304_2657406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099020.1|2657496_2657991_-	hypothetical protein	NA	A0A2K8HVL6	Pseudomonas_phage	93.8	2.7e-73
WP_003099023.1|2657987_2659985_-	DNA cytosine methyltransferase	NA	A0A140IES2	Pseudomonas_phage	91.1	0.0e+00
WP_124171382.1|2660100_2660427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003099025.1|2660594_2662340_-	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	94.1	1.6e-298
WP_003099027.1|2662343_2663333_-	cell division protein FtsK	NA	H2BD47	Pseudomonas_phage	61.1	7.5e-91
WP_003099029.1|2663345_2663546_-	hypothetical protein	NA	J7I437	Pseudomonas_phage	98.5	2.5e-30
WP_003099031.1|2663552_2664440_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.6	2.4e-104
WP_003099033.1|2664452_2665361_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	72.0	1.6e-124
WP_003099035.1|2665371_2665581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099037.1|2665577_2665799_-	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_003099039.1|2665782_2665935_-	hypothetical protein	NA	A0A2K8HR67	Pseudomonas_phage	93.8	1.5e-11
WP_003099041.1|2666514_2666886_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	100.0	8.5e-64
WP_071538254.1|2667062_2667701_+	acetyltransferase	NA	NA	NA	NA	NA
WP_020750452.1|2667803_2668016_-	hypothetical protein	NA	L7TKR9	Pseudomonas_virus	97.1	5.8e-33
WP_003099044.1|2668071_2668314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099046.1|2668351_2668555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099049.1|2668554_2668746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099051.1|2668936_2669143_-	hypothetical protein	NA	A0A0U4IJ22	Pseudomonas_phage	95.6	8.7e-34
WP_003103353.1|2669153_2669456_-	hypothetical protein	NA	A0A0U4B0I0	Pseudomonas_phage	98.0	6.3e-49
WP_003103354.1|2669805_2670681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003103356.1|2670677_2671559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078451497.1|2671536_2672091_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003103358.1|2672200_2672404_+	Cro/Cl family transcriptional regulator	NA	A0A0U1UNM4	Pseudomonas_phage	61.7	6.4e-13
WP_003103361.1|2672643_2673135_-	hypothetical protein	NA	J7HXA3	Pseudomonas_phage	95.7	7.5e-84
WP_003103363.1|2673238_2673811_+	hypothetical protein	NA	J7I4J9	Pseudomonas_phage	100.0	5.5e-102
WP_003103373.1|2674747_2675356_+	hypothetical protein	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	43.9	3.4e-41
WP_003103374.1|2675348_2675792_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	98.6	1.4e-76
WP_003103375.1|2675820_2676690_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	87.2	2.9e-147
WP_003103376.1|2676845_2677145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003103377.1|2677252_2677633_+	hypothetical protein	NA	H2BDJ3	Pseudomonas_virus	67.5	4.8e-38
WP_003103378.1|2677607_2677955_+|holin	phage holin family protein	holin	Q9MC42	Pseudomonas_phage	61.3	1.9e-25
WP_003103379.1|2678021_2678477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003103380.1|2678534_2679134_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	61.9	3.3e-49
WP_020750445.1|2679117_2680413_+|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.2	2.4e-145
WP_003103384.1|2680415_2681771_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	45.8	8.1e-96
WP_003103386.1|2681767_2682847_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	97.8	2.0e-201
WP_003103389.1|2682975_2683719_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	75.5	2.2e-87
WP_003103391.1|2683728_2684700_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	64.7	9.3e-110
WP_003103393.1|2684741_2685227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003103395.1|2685210_2685675_+	hypothetical protein	NA	H9EB35	Vibrio_phage	39.3	5.2e-10
WP_003103397.1|2685674_2686064_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	55.0	2.8e-33
WP_003103399.1|2686067_2686742_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.0	1.3e-115
WP_003103401.1|2686738_2687149_+	DUF4128 domain-containing protein	NA	A0A1B0VMI0	Pseudomonas_phage	44.1	3.0e-25
WP_003103403.1|2687216_2687870_+|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.8	4.5e-60
WP_003103406.1|2687879_2688260_+|tail	phage tail assembly chaperone	tail	A0A2H4IYQ5	uncultured_Caudovirales_phage	51.2	7.0e-29
WP_003103408.1|2688322_2688586_+	DUF1799 domain-containing protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	46.0	3.6e-16
WP_003103414.1|2688582_2691774_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	41.1	2.2e-155
WP_003103417.1|2691779_2692118_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	98.2	1.5e-59
WP_003158546.1|2692114_2692864_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	98.0	4.7e-146
WP_003103422.1|2692866_2693625_+	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	97.2	5.7e-147
WP_003158545.1|2694146_2694731_+|tail	tail assembly protein	tail	A0A0S2SYS2	Pseudomonas_phage	96.9	1.1e-100
WP_020750444.1|2695066_2695759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003106739.1|2695818_2699379_+	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	75.7	0.0e+00
WP_071536682.1|2699375_2699660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003106740.1|2700549_2701317_+	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	51.4	7.9e-56
WP_003106743.1|2701359_2701989_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	95.2	2.7e-110
WP_020750441.1|2701985_2702354_+	hypothetical protein	NA	H2BDD6	Pseudomonas_virus	78.7	2.0e-41
WP_003102452.1|2702350_2702614_+	hypothetical protein	NA	A0A0U4B0B7	Pseudomonas_phage	97.7	3.7e-37
WP_003102455.1|2702649_2702916_+	hypothetical protein	NA	L7TP56	Pseudomonas_virus	98.9	1.8e-44
WP_003102456.1|2702897_2703584_-	SOS response-associated peptidase	NA	A0A2K8I970	Pseudomonas_phage	87.7	1.0e-118
WP_003102458.1|2703621_2704137_-	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	94.7	5.8e-95
2704366:2704457	attR	CGGATTGCAAATCCGTGAACGCCGGTTCGATTCCGACCTCAGCCTCCAACAGGAAAGCCCCGTAGCTCAACGAGTTACGGGGCTTTTTTCTT	NA	NA	NA	NA
>prophage 6
NZ_LR739068	Pseudomonas aeruginosa strain PcyII-29 isolate PcyII-29 chromosome PcyII-29	6621209	2973076	3011539	6621209	tail,plate	Planktothrix_phage(33.33%)	32	NA	NA
WP_003103608.1|2973076_2974360_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_003103610.1|2974382_2975729_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_020750571.1|2975944_2977579_+	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_020989355.1|2977627_2979052_-	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_003103616.1|2979057_2981049_-	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	39.3	5.3e-35
WP_003089547.1|2981048_2982224_-	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_003158770.1|2982324_2983320_-	FecR family protein	NA	NA	NA	NA	NA
WP_003103620.1|2983483_2983963_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003103622.1|2984095_2985427_+	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_003103624.1|2985549_2987838_+	acylase	NA	NA	NA	NA	NA
WP_003124571.1|2988383_2989304_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003104946.1|2989400_2990552_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003089526.1|2990618_2990861_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003104944.1|2991155_2991392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089521.1|2991657_2992128_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003104941.1|2992124_2994440_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003104937.1|2994856_2996062_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003104935.1|2996262_2996904_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003089513.1|2997180_2997576_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003104933.1|2997598_2998135_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_003104932.1|2998145_3000152_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.3	1.7e-41
WP_003104930.1|3000151_3000340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003122693.1|3000499_3001072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003104929.1|3001093_3003643_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	1.2e-76
WP_003104928.1|3003644_3004661_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_003104926.1|3004624_3006418_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003122696.1|3006401_3006827_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003089495.1|3006839_3007337_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003089494.1|3007410_3008895_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003089493.1|3008917_3009463_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003104701.1|3009671_3010148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020750612.1|3010207_3011539_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 7
NZ_LR739068	Pseudomonas aeruginosa strain PcyII-29 isolate PcyII-29 chromosome PcyII-29	6621209	3181042	3210932	6621209	integrase,plate,transposase,tail	uncultured_Caudovirales_phage(30.77%)	28	3200790:3200808	3218695:3218713
WP_003100881.1|3181042_3184009_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_001247892.1|3184167_3184458_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003100872.1|3184454_3184841_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003465043.1|3185077_3185434_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|3185688_3186015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|3186011_3186512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100853.1|3186508_3186880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|3186873_3187431_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003117254.1|3187761_3188565_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.4	9.9e-33
WP_003117256.1|3189089_3190154_+	hypothetical protein	NA	A0A2H4J9E6	uncultured_Caudovirales_phage	72.8	8.2e-152
WP_003117257.1|3190171_3190696_+|plate	phage baseplate assembly protein	plate	A0A2H4JFE0	uncultured_Caudovirales_phage	67.2	7.8e-63
WP_003117258.1|3190762_3191113_+	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	67.2	4.2e-36
WP_170952975.1|3191126_3192185_+|plate	baseplate J/gp47 family protein	plate	A0A2H4JC98	uncultured_Caudovirales_phage	42.0	1.7e-69
WP_003117260.1|3192181_3192757_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	39.0	3.1e-28
WP_023121563.1|3192756_3193968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170952977.1|3194054_3194513_+|tail	phage tail protein	tail	Q9ZXK5	Pseudomonas_virus	46.7	1.3e-21
WP_003117263.1|3194517_3195819_-	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A1V0SJA4	Klosneuvirus	24.4	1.7e-13
WP_003117264.1|3195972_3196899_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003117265.1|3197152_3198973_+	DUF1302 domain-containing protein	NA	NA	NA	NA	NA
WP_003117266.1|3198975_3200322_+	DUF1329 domain-containing protein	NA	NA	NA	NA	NA
WP_003117267.1|3200383_3201775_+	DUF1254 domain-containing protein	NA	M1I2Z8	Paramecium_bursaria_Chlorella_virus	32.2	5.1e-53
3200790:3200808	attL	CGGCCGAGCGCTACCTGAT	NA	NA	NA	NA
WP_023121564.1|3201925_3202972_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003117269.1|3203115_3203376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003117270.1|3203435_3204686_-	chromate resistance efflux protein ChrA	NA	NA	NA	NA	NA
WP_003117271.1|3204856_3205801_-	chromate resistance protein	NA	NA	NA	NA	NA
WP_003117272.1|3206076_3206637_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	95.2	3.1e-57
WP_003117273.1|3206640_3209607_+|transposase	Tn3-like element ISPa40 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	92.6	0.0e+00
WP_003111050.1|3209960_3210932_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3218695:3218713	attR	ATCAGGTAGCGCTCGGCCG	NA	NA	NA	NA
>prophage 8
NZ_LR739068	Pseudomonas aeruginosa strain PcyII-29 isolate PcyII-29 chromosome PcyII-29	6621209	4895784	4980251	6621209	capsid,portal,plate,terminase,protease,integrase,tRNA,lysis,tail,head,holin	Pseudomonas_virus(70.45%)	98	4943696:4943742	4980418:4980464
WP_003085581.1|4895784_4896189_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_003101979.1|4896287_4897040_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085577.1|4897171_4897744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003123029.1|4897848_4898589_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1B0XTP2	Freshwater_phage	26.4	6.4e-10
WP_003085573.1|4898585_4899554_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003101974.1|4899642_4900389_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003101972.1|4900381_4901083_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003085566.1|4901143_4902061_-	GTPase Era	NA	NA	NA	NA	NA
WP_003085565.1|4902053_4902743_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.4	7.2e-24
WP_003085562.1|4902739_4903117_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_003101969.1|4903285_4904140_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003101967.1|4904145_4905945_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	38.5	1.1e-20
WP_003101964.1|4906094_4907519_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.0	3.4e-28
WP_003101962.1|4907558_4908014_-	SoxR reducing system RseC family protein	NA	NA	NA	NA	NA
WP_003101960.1|4908010_4908961_-	sigma factor AlgU regulatory protein MucB	NA	NA	NA	NA	NA
WP_003101958.1|4908969_4909554_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_003085543.1|4909585_4910167_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_003101954.1|4910575_4912192_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003101950.1|4912160_4912613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085532.1|4912596_4912851_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_003101947.1|4913123_4914068_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003085528.1|4914168_4915005_+	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	36.6	2.5e-26
WP_003101943.1|4915013_4916396_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003085524.1|4916388_4917060_-	response regulator	NA	NA	NA	NA	NA
WP_003101939.1|4917270_4918554_+	OprD family porin	NA	NA	NA	NA	NA
WP_003085519.1|4918583_4919567_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003101933.1|4919615_4920086_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_003116509.1|4920096_4921614_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_003106435.1|4921606_4922644_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_003106436.1|4922770_4923466_-	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	45.2	1.0e-49
WP_003106439.1|4923565_4924387_-	VanW family protein	NA	NA	NA	NA	NA
WP_003106441.1|4924443_4925325_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003106449.1|4925457_4926966_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003085499.1|4926977_4928141_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003085498.1|4928206_4929025_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003106451.1|4929083_4930187_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003116513.1|4930298_4931195_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003085490.1|4931251_4931896_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_003098346.1|4932011_4932653_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003098348.1|4932687_4934664_-	alkyl/aryl-sulfatase	NA	M1I0S7	Paramecium_bursaria_Chlorella_virus	44.8	3.1e-160
WP_003098349.1|4934766_4935681_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003098351.1|4935684_4935873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085479.1|4935995_4936241_-	DUF1145 domain-containing protein	NA	NA	NA	NA	NA
WP_003098353.1|4936356_4936806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098355.1|4936901_4937081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098356.1|4937313_4938390_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_003098357.1|4938386_4939202_+	DUF4824 family protein	NA	NA	NA	NA	NA
WP_020989334.1|4939222_4939495_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_003098362.1|4939494_4940187_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_003098363.1|4940322_4941366_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003085453.1|4941445_4942183_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_003098365.1|4942634_4943537_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
4943696:4943742	attL	GCTTCCCAAGCTCATGACGAGGGTTCGATTCCCTTCGCCCGCTCCAG	NA	NA	NA	NA
WP_003098368.1|4944529_4945255_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_162836249.1|4945263_4945422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098370.1|4945492_4946548_-|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	96.0	1.0e-194
WP_031299630.1|4946547_4948308_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	100.0	0.0e+00
WP_003098374.1|4948463_4949285_+|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	96.0	1.2e-129
WP_003098375.1|4949320_4950337_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.1	8.6e-191
WP_003098376.1|4950342_4951044_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	97.9	6.9e-123
WP_003098377.1|4951147_4951609_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	99.3	2.8e-80
WP_003098378.1|4951608_4951821_+|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	94.1	4.9e-32
WP_003098379.1|4951845_4952199_+	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_003098380.1|4952200_4952473_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	97.8	2.6e-38
WP_003098381.1|4952469_4953276_+	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	97.4	5.4e-148
WP_003098382.1|4953272_4953734_+|lysis	LysB family phage lysis regulatory protein	lysis	Q9ZXL5	Pseudomonas_virus	97.4	8.1e-72
WP_003098383.1|4953811_4954348_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.3	1.4e-94
WP_020750417.1|4954340_4954799_+	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	90.0	1.6e-67
WP_003098385.1|4954868_4955441_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	90.5	7.9e-93
WP_003098386.1|4955437_4955782_+	GPW/gp25 family protein	NA	Q9ZXK9	Pseudomonas_virus	97.4	1.4e-55
WP_003098387.1|4955778_4956696_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	87.8	8.4e-145
WP_003098388.1|4956692_4957310_+|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	75.3	7.7e-86
WP_003098390.1|4959133_4959568_+|tail	tail fiber assembly protein	tail	Q9ZXK5	Pseudomonas_virus	50.7	1.5e-30
WP_003098391.1|4959668_4960844_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	99.0	3.5e-220
WP_003098392.1|4960900_4961416_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	95.9	3.9e-91
WP_003098393.1|4961470_4961800_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	93.6	2.2e-47
WP_003098394.1|4961808_4961928_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_023127624.1|4961917_4964677_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	92.2	0.0e+00
WP_003098399.1|4964681_4965122_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	99.3	1.8e-76
WP_003098400.1|4965118_4966384_+	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	97.9	1.9e-235
WP_020750418.1|4966411_4967593_-	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	31.3	3.9e-54
WP_020750419.1|4967576_4968668_-	nucleoid-associated protein	NA	A0A291AUQ0	Sinorhizobium_phage	43.3	1.2e-68
WP_128568923.1|4968795_4969203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098404.1|4969251_4969716_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_100209530.1|4969752_4970184_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020750421.1|4970249_4970480_+	phage-associated protein, BcepMu gp16 family	NA	NA	NA	NA	NA
WP_003098407.1|4970509_4970980_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	96.2	6.8e-74
WP_003098408.1|4970976_4971270_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	99.0	1.1e-50
WP_003098409.1|4971266_4971617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098410.1|4971688_4971922_+	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	100.0	7.8e-39
WP_162290916.1|4971918_4974639_+	toprim domain-containing protein	NA	Q9ZXI8	Pseudomonas_virus	99.1	0.0e+00
WP_003098413.1|4974683_4974956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098415.1|4975015_4975369_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	97.4	3.8e-61
WP_003098417.1|4975380_4975587_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	100.0	7.3e-33
WP_003098418.1|4975890_4977801_+	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	88.3	2.1e-259
WP_003098420.1|4978104_4978281_+	hypothetical protein	NA	Q38017	Pseudomonas_virus	70.6	5.5e-05
WP_003098421.1|4978277_4978646_+	ASCH domain-containing protein	NA	A0A291AUQ6	Sinorhizobium_phage	50.4	3.6e-30
WP_003098423.1|4978838_4979042_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_003098425.1|4979048_4980251_-|integrase	integrase family protein	integrase	A0A248SL35	Klebsiella_phage	30.9	3.8e-36
4980418:4980464	attR	GCTTCCCAAGCTCATGACGAGGGTTCGATTCCCTTCGCCCGCTCCAG	NA	NA	NA	NA
