The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR738855	Corynebacterium rouxii strain FRC0190 chromosome 1	2451019	144950	204857	2451019	capsid,integrase,portal,tail,holin,protease,terminase	Corynebacterium_phage(51.72%)	66	147459:147480	207727:207748
WP_155871207.1|144950_145871_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_155871208.1|145860_146769_+	glycine/betaine ABC transporter	NA	NA	NA	NA	NA
WP_155871209.1|146788_147226_-	hypothetical protein	NA	NA	NA	NA	NA
147459:147480	attL	TTTGGCACGAACTACTCACTTG	NA	NA	NA	NA
WP_155871210.1|147495_150903_-	arabinosyltransferase	NA	NA	NA	NA	NA
WP_155874487.1|150895_152896_-	arabinofuranosyltransferase	NA	NA	NA	NA	NA
WP_155871211.1|153091_153853_-	decaprenylphospho-beta-D-erythro-pentofuranosid- 2-ulose 2-reductase	NA	NA	NA	NA	NA
WP_155871212.1|153872_155339_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_155871213.1|155455_155704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155874488.1|155732_156167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871214.1|156163_156712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014316167.1|156723_157143_+	GtrA family protein	NA	NA	NA	NA	NA
WP_155871215.1|157353_158133_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_155871216.1|158257_159175_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155874489.1|159348_160314_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_155871217.1|160433_161168_+	ATP-binding cassette domain-containing protein	NA	M1HYS6	Acanthocystis_turfacea_Chlorella_virus	26.5	8.5e-07
WP_071571486.1|161164_162064_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_155871218.1|162060_162912_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_155871219.1|162995_164003_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_014309050.1|164132_164912_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-09
WP_014307805.1|164931_165837_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_155871220.1|165927_167121_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_155871221.1|167117_168065_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_155871222.1|168413_169448_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	24.8	3.5e-14
WP_085666432.1|169978_170593_+	DUF433 domain-containing protein	NA	A0A1W6JRB2	Corynebacterium_phage	96.1	3.4e-110
WP_155874490.1|171046_172273_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JRD7	Corynebacterium_phage	96.3	1.9e-229
WP_155871223.1|172431_172707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155871224.1|172740_173223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155871225.1|173251_173674_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1W6JRC2	Corynebacterium_phage	86.8	8.5e-60
WP_155871226.1|173682_174183_-	hypothetical protein	NA	A0A1W6JRB0	Corynebacterium_phage	62.3	3.1e-45
WP_155871227.1|174302_174542_+	helix-turn-helix domain-containing protein	NA	A0A1W6JRC7	Corynebacterium_phage	88.5	1.4e-30
WP_044055149.1|175088_175469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155871228.1|175551_176370_+	phage antirepressor Ant	NA	A0A1W6JRI1	Corynebacterium_phage	89.4	5.2e-138
WP_155871229.1|176389_176590_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010934096.1|176741_176966_+	hypothetical protein	NA	A0A1W6JRD0	Corynebacterium_phage	44.4	6.4e-06
WP_166443132.1|176962_177109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871230.1|177098_177386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871231.1|177524_178226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871232.1|178661_179870_+	hypothetical protein	NA	A0A220NQT1	Corynebacterium_phage	65.1	1.0e-129
WP_155871233.1|179862_180450_+	hypothetical protein	NA	A0A1W6JRC6	Corynebacterium_phage	59.5	2.2e-58
WP_044055061.1|181070_181544_+	hypothetical protein	NA	A0A1C9EHY3	Gordonia_phage	49.6	4.5e-25
WP_155871234.1|181527_182595_+|terminase	terminase	terminase	A0A1C9EHW4	Gordonia_phage	57.4	1.9e-119
WP_155871235.1|182569_183181_+|terminase	terminase	terminase	A0A1C9EHV3	Gordonia_phage	58.4	2.1e-59
WP_155871236.1|183177_184506_+|portal	phage portal protein	portal	A0A222YZB0	Rhodococcus_phage	33.8	3.3e-57
WP_155871237.1|184522_186229_+	hypothetical protein	NA	A0A1C9EHV4	Gordonia_phage	34.8	7.2e-41
WP_166443181.1|186228_186537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871239.1|186613_187234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871240.1|187245_188235_+|capsid	phage capsid protein	capsid	G9FH86	Rhodococcus_phage	60.1	2.2e-106
WP_155871241.1|188243_188543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871242.1|188553_188964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871243.1|188957_189329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871244.1|189325_189646_+	hypothetical protein	NA	A0A1C9EHV8	Gordonia_phage	43.7	3.7e-15
WP_155871245.1|189642_190098_+	hypothetical protein	NA	A0A1C9EI09	Gordonia_phage	28.9	9.3e-12
WP_155871246.1|190107_190950_+	hypothetical protein	NA	A0A1W6JRH0	Corynebacterium_phage	51.2	8.3e-14
WP_155871247.1|191047_191401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871248.1|191436_191658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155871249.1|191860_197869_+|tail	phage tail tape measure protein	tail	A0A166XZ24	Gordonia_phage	57.0	4.3e-88
WP_155871250.1|197886_198669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871251.1|198669_199566_+	hypothetical protein	NA	Q37921	Corynephage	41.4	7.9e-55
WP_166443133.1|199558_200683_+	hypothetical protein	NA	Q37922	Corynephage	50.7	2.2e-86
WP_155871252.1|200682_201861_+	hypothetical protein	NA	A0A1W6JRF8	Corynebacterium_phage	53.7	1.5e-45
WP_155871253.1|202049_202292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155871254.1|202580_202733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155871255.1|202977_203805_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JRK9	Corynebacterium_phage	67.4	2.1e-70
WP_155871256.1|203797_204037_+|holin	holin	holin	A0A1W6JRG0	Corynebacterium_phage	84.6	3.7e-28
WP_155871257.1|204042_204507_+	hypothetical protein	NA	A0A1W6JRF4	Corynebacterium_phage	59.5	1.8e-42
WP_155871258.1|204503_204857_+	hypothetical protein	NA	A0A1W6JRH1	Corynebacterium_phage	47.9	1.2e-19
207727:207748	attR	TTTGGCACGAACTACTCACTTG	NA	NA	NA	NA
>prophage 2
NZ_LR738855	Corynebacterium rouxii strain FRC0190 chromosome 1	2451019	1265628	1298297	2451019	holin,protease,terminase	Corynebacterium_phage(63.64%)	33	NA	NA
WP_155872860.1|1265628_1265967_-	hypothetical protein	NA	A0A1W6JRH1	Corynebacterium_phage	54.1	2.0e-27
WP_155872862.1|1265963_1266428_-	hypothetical protein	NA	A0A1W6JRF4	Corynebacterium_phage	77.9	3.6e-59
WP_155872864.1|1266433_1266670_-|holin	holin	holin	A0A1W6JRG0	Corynebacterium_phage	94.9	3.2e-32
WP_155872866.1|1266669_1267407_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JRK9	Corynebacterium_phage	98.0	1.8e-145
WP_155872868.1|1267515_1267929_-	hypothetical protein	NA	A0A1W6JRH8	Corynebacterium_phage	95.8	5.3e-06
WP_155872870.1|1267973_1268849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155872872.1|1269037_1270216_-	hypothetical protein	NA	A0A1W6JRF8	Corynebacterium_phage	56.1	1.3e-52
WP_155872874.1|1270219_1271380_-	hypothetical protein	NA	A0A1P8D5M2	Corynebacterium_phage	35.1	4.2e-24
WP_155872876.1|1271376_1272222_-	hypothetical protein	NA	A0A1P8D5L4	Corynebacterium_phage	42.7	1.4e-53
WP_155872878.1|1272228_1273017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155872880.1|1273048_1278628_-	tape measure protein	NA	A0A2P1CIC9	Actinomyces_phage	42.3	2.4e-77
WP_155874547.1|1278647_1278971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155872882.1|1279012_1279303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155872884.1|1279396_1280311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155872886.1|1280313_1280700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155872888.1|1280696_1280975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155874548.1|1280971_1281205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155874549.1|1281285_1281723_-	hypothetical protein	NA	A0A1L6BZF5	Pasteurella_phage	39.0	3.9e-07
WP_155872890.1|1281740_1282064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155872892.1|1282079_1283009_-	hypothetical protein	NA	A0A142KAF2	Gordonia_phage	32.9	7.7e-37
WP_155872894.1|1283039_1283417_-	hypothetical protein	NA	A0A1P8D5K6	Corynebacterium_phage	33.9	2.2e-06
WP_166443154.1|1283432_1284821_-|protease	Clp protease ClpP	protease	A0A1L6BZF6	Pasteurella_phage	32.5	2.7e-46
WP_155872897.1|1286196_1287750_-	hypothetical protein	NA	A0A1P8D5K9	Corynebacterium_phage	46.3	3.5e-103
WP_155872899.1|1287753_1288056_-|terminase	terminase	terminase	A0A142KC07	Gordonia_phage	57.1	2.4e-08
WP_155872901.1|1288314_1289043_-	hypothetical protein	NA	A0A1B3B029	Gordonia_phage	34.7	9.6e-27
WP_155874550.1|1289228_1289813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155872903.1|1289857_1291213_-	DEAD/DEAH box helicase	NA	A0A1L6BZE2	Pasteurella_phage	66.5	1.5e-179
WP_088246196.1|1291193_1291475_-	VRR-NUC domain-containing protein	NA	A0A1L6BZE4	Pasteurella_phage	49.5	8.2e-19
WP_155872905.1|1291520_1291703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155872907.1|1291801_1294258_-	hypothetical protein	NA	A0A1W6JQ82	Corynebacterium_phage	58.0	3.3e-273
WP_155872909.1|1294276_1296262_-	DNA polymerase	NA	A0A1W6JQ98	Corynebacterium_phage	59.2	4.2e-226
WP_088246193.1|1296352_1296970_-	DUF2815 family protein	NA	A0A1W6JQ93	Corynebacterium_phage	49.7	1.5e-41
WP_166443190.1|1297100_1298297_-	DUF2800 domain-containing protein	NA	A0A1W6JQ97	Corynebacterium_phage	57.0	1.1e-125
>prophage 3
NZ_LR738855	Corynebacterium rouxii strain FRC0190 chromosome 1	2451019	1303288	1314829	2451019	integrase	Corynebacterium_phage(30.77%)	14	1302561:1302574	1310420:1310433
1302561:1302574	attL	TTTAGCTCTTGCCG	NA	NA	NA	NA
WP_155872936.1|1303288_1304119_-	hypothetical protein	NA	A0A159B6D5	Gordonia_phage	50.3	3.6e-30
WP_155872938.1|1304668_1305037_+	hypothetical protein	NA	A0A0K0N6E3	Gordonia_phage	34.3	5.2e-05
WP_155872940.1|1305049_1305427_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8D5N3	Corynebacterium_phage	53.7	2.1e-33
WP_155872942.1|1305423_1306524_+	restriction endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	34.9	2.1e-49
WP_155872944.1|1306772_1307792_+	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	44.0	8.3e-69
WP_155874551.1|1307865_1308156_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1W6JQ88	Corynebacterium_phage	51.6	4.5e-20
WP_155872946.1|1308415_1308562_+	hypothetical protein	NA	A0A1W6JRC4	Corynebacterium_phage	95.8	2.1e-18
WP_155872948.1|1308564_1308822_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	63.4	8.9e-20
WP_155872950.1|1308969_1310163_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9ZWV7	Corynephage	31.5	1.3e-44
WP_155872952.1|1310183_1311815_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	26.0	6.7e-36
1310420:1310433	attR	CGGCAAGAGCTAAA	NA	NA	NA	NA
WP_155872954.1|1311912_1312341_-	DUF59 domain-containing protein	NA	NA	NA	NA	NA
WP_155872956.1|1312337_1312787_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2P1CJL8	Mycobacterium_phage	43.6	9.8e-22
WP_155872958.1|1312790_1314071_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.4	1.1e-102
WP_003851563.1|1314070_1314829_-	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.7	8.2e-05
>prophage 4
NZ_LR738855	Corynebacterium rouxii strain FRC0190 chromosome 1	2451019	1827085	1945213	2451019	transposase,integrase,portal,tail,tRNA,protease,terminase	Gordonia_phage(19.35%)	105	1898046:1898060	1929228:1929242
WP_155873746.1|1827085_1829794_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	37.4	4.2e-136
WP_155873748.1|1829888_1830869_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_155873750.1|1831382_1832135_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155873751.1|1832170_1833463_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.6	1.8e-132
WP_155873753.1|1833607_1836133_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	30.8	2.4e-64
WP_003852475.1|1836224_1836854_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	44.0	3.6e-38
WP_003852476.1|1836871_1837471_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	46.7	3.3e-41
WP_155873755.1|1837634_1838981_-	trigger factor	NA	NA	NA	NA	NA
WP_155873757.1|1839859_1840096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873758.1|1840247_1841045_+	DUF1542 domain-containing protein	NA	NA	NA	NA	NA
WP_155873761.1|1841119_1841593_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_155873763.1|1841624_1842245_-	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
WP_155873765.1|1842365_1844984_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	27.5	3.4e-42
WP_155873767.1|1844960_1846124_-	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	31.8	1.0e-22
WP_155873769.1|1846322_1847339_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_155873772.1|1847350_1847743_+	globin	NA	NA	NA	NA	NA
WP_155873774.1|1847739_1848360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935345.1|1848369_1848813_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003852495.1|1848938_1850609_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	28.2	1.7e-47
WP_155873776.1|1850706_1851195_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_155873778.1|1851377_1853414_-	copper resistance protein	NA	NA	NA	NA	NA
WP_155873780.1|1853639_1855925_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_155873782.1|1855944_1856145_+	putative selenoprotein	NA	NA	NA	NA	NA
WP_155873784.1|1856176_1857382_-	MFS transporter	NA	NA	NA	NA	NA
WP_155873786.1|1857790_1858822_+	acryloyl-CoA reductase	NA	NA	NA	NA	NA
WP_155873788.1|1858880_1859681_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155873790.1|1859699_1860332_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	39.2	8.6e-24
WP_155873792.1|1860509_1861340_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_155873794.1|1861340_1862594_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_080561864.1|1862836_1863142_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155873795.1|1863253_1863448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873797.1|1864093_1864483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873799.1|1864479_1864752_+	HNH endonuclease	NA	G9FGW5	Rhodococcus_phage	62.5	1.8e-23
WP_155873801.1|1864876_1865314_+	hypothetical protein	NA	A0A2P1CBY2	Gordonia_phage	51.1	5.2e-28
WP_155873803.1|1865354_1866662_+|terminase	terminase	terminase	A0A2P1CBZ2	Gordonia_phage	40.4	1.9e-70
WP_014316998.1|1866661_1866853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873805.1|1866881_1867925_+|portal	phage portal protein	portal	G9FGU9	Rhodococcus_phage	44.2	2.3e-74
WP_155873807.1|1867921_1868590_+	glycoside hydrolase family 25	NA	A0A1W6JQH9	Corynebacterium_phage	60.8	5.6e-74
WP_155873809.1|1868710_1868980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873811.1|1868969_1870451_+	hypothetical protein	NA	G9FGV2	Rhodococcus_phage	34.5	5.8e-71
WP_155873813.1|1870454_1870766_+	hypothetical protein	NA	A0A2P1CBZ4	Gordonia_phage	47.1	4.7e-15
WP_155873815.1|1870770_1871121_+	hypothetical protein	NA	A0A221J6P6	Arthrobacter_phage	36.4	4.8e-08
WP_155873817.1|1871124_1871571_+	hypothetical protein	NA	A0A0K0MWW7	Gordonia_phage	41.0	2.7e-24
WP_155873819.1|1871570_1871969_+	HK97 gp10 family phage protein	NA	A0A2P1CBZ9	Gordonia_phage	46.7	1.3e-25
WP_155873821.1|1871965_1872241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873823.1|1872349_1874326_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_155873825.1|1874322_1875645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873827.1|1875647_1876226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873828.1|1876222_1877041_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2P1CCU8	Gordonia_phage	45.4	9.4e-55
WP_155873830.1|1878522_1878972_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_155873832.1|1878975_1879281_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003852591.1|1879293_1879569_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_155873834.1|1879657_1880131_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_155873835.1|1880131_1880776_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155873837.1|1880772_1881156_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_155873839.1|1881190_1890127_-	DUF1729 domain-containing protein	NA	NA	NA	NA	NA
WP_155873841.1|1890305_1890542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873843.1|1890623_1891520_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_155873847.1|1892019_1892394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873849.1|1892801_1893176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873851.1|1893203_1893560_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_155873853.1|1893598_1894216_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	39.2	1.6e-06
WP_155873855.1|1894212_1894938_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_166443166.1|1894948_1895716_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155873859.1|1895768_1896566_-	glutamate racemase	NA	NA	NA	NA	NA
WP_155873861.1|1896562_1897135_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_155873863.1|1897131_1898064_-	peptidase S58 family protein	NA	NA	NA	NA	NA
1898046:1898060	attL	CGTCGATAAGCCCGC	NA	NA	NA	NA
WP_155873865.1|1898063_1898600_-	DUF2017 family protein	NA	NA	NA	NA	NA
WP_155873867.1|1898616_1898958_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_155873869.1|1899019_1900333_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_155873871.1|1900364_1902332_+	DEAD/DEAH box helicase family protein	NA	A0A127AW80	Bacillus_phage	29.7	8.8e-67
WP_155873873.1|1902948_1904055_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_155873875.1|1904038_1904746_-	ACR protein	NA	NA	NA	NA	NA
WP_155873877.1|1904738_1906022_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_014318111.1|1906128_1907823_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_155873883.1|1908185_1909172_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	77.8	1.5e-139
WP_155873884.1|1909483_1909969_+	ferritin	NA	NA	NA	NA	NA
WP_155874574.1|1910018_1912166_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.6	1.0e-209
WP_155873885.1|1912226_1912652_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	H9NCC2	Sphingomonas_phage	34.8	1.8e-09
WP_010935390.1|1912745_1912979_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	54.5	2.9e-17
WP_155873891.1|1913281_1914154_+	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_003852698.1|1915740_1915863_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_155873892.1|1916016_1916850_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	56.2	6.6e-80
WP_155873893.1|1916846_1917284_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_155873895.1|1919702_1921862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155873897.1|1922076_1922340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166443167.1|1922401_1922719_+	hypothetical protein	NA	A0A1W6JQG4	Corynebacterium_phage	50.0	5.3e-14
WP_166443168.1|1922803_1923172_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JQG4	Corynebacterium_phage	48.2	8.6e-16
WP_155873904.1|1923345_1924080_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155874575.1|1924129_1924582_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_155873906.1|1924620_1926258_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_155873908.1|1926323_1926611_+	fluoride efflux transporter family protein	NA	NA	NA	NA	NA
WP_155873910.1|1926607_1926922_+	CrcB family protein	NA	NA	NA	NA	NA
WP_155873912.1|1926918_1929483_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
1929228:1929242	attR	CGTCGATAAGCCCGC	NA	NA	NA	NA
WP_155873914.1|1929482_1930232_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	26.5	2.2e-10
WP_155873916.1|1936407_1937664_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_155873918.1|1937702_1938278_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_155873920.1|1938330_1939176_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_155873922.1|1939857_1940793_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	52.6	7.4e-80
WP_155873924.1|1940900_1941467_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_166443124.1|1941780_1941969_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155873926.1|1942455_1942668_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155873928.1|1942807_1943368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873930.1|1943611_1944160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155873931.1|1944364_1945213_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
