The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR723677	Arsenite-oxidising bacterium NT-25 chromosome 1	4236310	231771	276296	4236310	transposase,integrase	Stx2-converting_phage(15.38%)	40	233005:233024	296518:296537
WP_152338533.1|231771_232962_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
233005:233024	attL	ATGGCGGACAGAGAGGGATT	NA	NA	NA	NA
WP_162197798.1|233399_234158_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_052641245.1|234291_235272_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_052641247.1|235333_235813_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_052641249.1|235815_237108_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_052641251.1|237133_237883_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_152338535.1|238566_241602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152338536.1|241834_242029_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052641258.1|242217_242832_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	33.3	2.1e-19
WP_052641260.1|242828_244487_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	47.0	1.2e-101
WP_052641263.1|244532_244880_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	62.6	9.8e-38
WP_052641265.1|244876_245287_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_052638837.1|246349_247144_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.9	2.8e-32
WP_052638836.1|247133_248654_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_052641267.1|249406_250084_-	RraA family protein	NA	NA	NA	NA	NA
WP_052641269.1|250093_251110_-	hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.7	3.1e-23
WP_052641271.1|251102_251954_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_052641273.1|251950_253156_-	CoA transferase	NA	NA	NA	NA	NA
WP_052641275.1|253164_254241_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.7	6.0e-25
WP_052641277.1|254233_255952_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_052641279.1|256010_257108_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_082077779.1|257112_257865_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152338537.1|258428_259583_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_152338538.1|260916_261993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052641291.1|262498_262765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052641293.1|263589_263982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052641295.1|264289_264655_-	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	46.2	2.7e-22
WP_052642412.1|264654_264846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052641296.1|265004_265730_-	SOS response-associated peptidase	NA	NA	NA	NA	NA
WP_052641306.1|266177_267224_+	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	60.8	3.9e-114
WP_052641308.1|267527_267905_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	40.2	3.6e-17
WP_052641310.1|267970_268261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052641312.1|268669_268969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052641314.1|268952_269219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052641316.1|269525_269984_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.1	1.2e-22
WP_152338539.1|270205_271437_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	66.9	1.3e-103
WP_052641318.1|271660_271864_-	CsbD family protein	NA	NA	NA	NA	NA
WP_156157148.1|272139_272289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082077781.1|272955_273729_-	recombinase family protein	NA	A0A1B1IWV2	uncultured_Mediterranean_phage	26.9	6.4e-05
WP_052641322.1|274361_276296_+	UvrD-helicase domain-containing protein	NA	A0A126DN25	Acinetobacter_phage	35.1	2.4e-69
296518:296537	attR	ATGGCGGACAGAGAGGGATT	NA	NA	NA	NA
>prophage 2
NZ_LR723677	Arsenite-oxidising bacterium NT-25 chromosome 1	4236310	1288655	1337690	4236310	portal,tail,capsid,head,protease,transposase	Hokovirus(10.0%)	57	NA	NA
WP_152338570.1|1288655_1289075_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052637546.1|1289064_1289865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052641854.1|1289868_1290291_-	SufE family protein	NA	NA	NA	NA	NA
WP_052637547.1|1290479_1290908_-	DUF5330 domain-containing protein	NA	NA	NA	NA	NA
WP_052637548.1|1291395_1292919_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.6	2.6e-26
WP_052637549.1|1292887_1293859_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_052637550.1|1293913_1294261_+	DUF1491 family protein	NA	NA	NA	NA	NA
WP_082077794.1|1294265_1295282_-	DUF2336 domain-containing protein	NA	NA	NA	NA	NA
WP_052637552.1|1295758_1295947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052637553.1|1295966_1296530_-	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_052637554.1|1296522_1297110_-	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_052637555.1|1297177_1299403_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_052637556.1|1299550_1300093_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_052637557.1|1300089_1301256_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_052637558.1|1301436_1302129_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052637559.1|1302091_1302751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052637560.1|1303103_1304120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052637561.1|1304223_1306578_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	31.3	3.7e-80
WP_052637562.1|1306590_1307013_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_052637563.1|1307067_1307265_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_052637564.1|1307331_1307736_-	response regulator	NA	NA	NA	NA	NA
WP_052637565.1|1308098_1308815_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_052637566.1|1308877_1309129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052637567.1|1309132_1309846_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_052637568.1|1310137_1310392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052637569.1|1310461_1310746_+	acylphosphatase	NA	NA	NA	NA	NA
WP_052637570.1|1310894_1311569_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052637571.1|1311575_1313363_-	flagellin	NA	NA	NA	NA	NA
WP_052637572.1|1313603_1314227_-	porin family protein	NA	NA	NA	NA	NA
WP_052637573.1|1314542_1316033_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.9	1.7e-49
WP_052637574.1|1316033_1316648_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_052637575.1|1316740_1318060_-	pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	62.9	1.1e-137
WP_052637576.1|1318283_1319189_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_052637577.1|1319369_1319852_+	VOC family protein	NA	NA	NA	NA	NA
WP_052637578.1|1319848_1320064_+	DUF4287 domain-containing protein	NA	NA	NA	NA	NA
WP_082077795.1|1320359_1320626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052637581.1|1320905_1321175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052637582.1|1321372_1323625_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	24.9	1.2e-35
WP_052637583.1|1323636_1324653_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_052637584.1|1324649_1325171_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_052637585.1|1325342_1325579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052637586.1|1325604_1326585_-	glutaminase A	NA	NA	NA	NA	NA
WP_082077631.1|1327574_1328972_+	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	42.0	1.6e-78
WP_156157123.1|1328973_1329114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052637588.1|1329269_1329902_+	chitinase	NA	R9U4A9	Rhizobium_phage	46.1	3.5e-41
WP_052637589.1|1329935_1330223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052637590.1|1330219_1330582_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_052637591.1|1330662_1331277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052637592.1|1331358_1332534_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	37.0	5.1e-62
WP_052637593.1|1332769_1333021_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_052637594.1|1333017_1333566_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_052637595.1|1333558_1334020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052637596.1|1334304_1334622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052637597.1|1334669_1335287_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	47.3	1.8e-29
WP_052637598.1|1335283_1336555_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	45.7	2.5e-83
WP_052637599.1|1336788_1337358_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_052637600.1|1337357_1337690_+|head	phage head closure protein	head	NA	NA	NA	NA
>prophage 3
NZ_LR723677	Arsenite-oxidising bacterium NT-25 chromosome 1	4236310	1820842	1842097	4236310	tail,plate,portal,terminase	Pseudoalteromonas_phage(20.0%)	22	NA	NA
WP_065814517.1|1820842_1822912_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JG09	uncultured_Caudovirales_phage	36.3	1.4e-94
WP_052638045.1|1822911_1823142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052638046.1|1823141_1824728_+|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	32.3	1.1e-56
WP_052638047.1|1824720_1826934_+	hypothetical protein	NA	A0A076G7Y9	Pseudoalteromonas_phage	32.3	9.0e-68
WP_052638048.1|1827014_1827344_+	DUF2190 family protein	NA	A0A076G9K1	Pseudoalteromonas_phage	46.7	6.1e-13
WP_052638049.1|1827399_1827633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052638050.1|1827645_1828110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052638051.1|1828106_1828865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052638052.1|1828866_1829460_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_052638053.1|1829472_1829823_+	hypothetical protein	NA	A0A291AUV3	Sinorhizobium_phage	55.0	2.5e-33
WP_052638054.1|1829843_1830074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052638055.1|1830073_1830496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052638056.1|1830514_1831402_+|plate	baseplate J/gp47 family protein	plate	K4HZB7	Acidithiobacillus_phage	36.2	4.7e-36
WP_052638057.1|1831401_1832676_+	hypothetical protein	NA	K4I1F8	Acidithiobacillus_phage	36.0	3.0e-23
WP_052638058.1|1832675_1833086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156157136.1|1833098_1833239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052638059.1|1833240_1835157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052638060.1|1835211_1838427_+	DUF4815 domain-containing protein	NA	A0A219VHA1	Ochrobactrum_phage	33.0	2.7e-158
WP_052638061.1|1838436_1839402_+	hypothetical protein	NA	L7TLW7	Rhizobium_phage	40.8	1.0e-20
WP_152338590.1|1839413_1839986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052638064.1|1840084_1841554_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A193GYC3	Enterobacter_phage	42.2	1.1e-69
WP_052638066.1|1841581_1842097_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
>prophage 4
NZ_LR723677	Arsenite-oxidising bacterium NT-25 chromosome 1	4236310	1949053	1957932	4236310	tRNA	uncultured_Mediterranean_phage(75.0%)	10	NA	NA
WP_052641947.1|1949053_1949860_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.4	8.1e-35
WP_052638202.1|1949846_1950566_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.0	1.7e-39
WP_052638203.1|1950616_1951726_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	27.1	5.1e-11
WP_052638204.1|1951756_1951963_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	56.9	1.1e-07
WP_052638205.1|1951995_1952667_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_052638206.1|1952663_1953488_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	40.7	1.2e-44
WP_052638207.1|1953542_1954826_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.8	1.7e-95
WP_052638208.1|1954825_1955602_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	31.7	3.5e-27
WP_052638209.1|1955598_1956252_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	NA	NA	NA	NA
WP_162197809.1|1956432_1957932_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV24	Clostridium_phage	31.7	3.6e-12
>prophage 5
NZ_LR723677	Arsenite-oxidising bacterium NT-25 chromosome 1	4236310	2163646	2173407	4236310		uncultured_Mediterranean_phage(66.67%)	8	NA	NA
WP_052641982.1|2163646_2164162_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	60.0	2.9e-46
WP_052638392.1|2164209_2164776_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	54.9	5.5e-46
WP_052638393.1|2164796_2165291_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	35.9	8.0e-25
WP_052638394.1|2165515_2165695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152338660.1|2165970_2168724_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.2	6.3e-95
WP_052638396.1|2169011_2169644_+	MarC family protein	NA	NA	NA	NA	NA
WP_052638397.1|2169684_2170233_-	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	76.3	1.4e-46
WP_052638398.1|2170485_2173407_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	61.2	0.0e+00
>prophage 1
NZ_LR723678	Arsenite-oxidising bacterium NT-25 plasmid 2	202844	3651	60318	202844	integrase,transposase	Ochrobactrum_phage(27.27%)	51	NA	NA
WP_082077861.1|3651_5232_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_152338680.1|5800_6688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052642888.1|7244_9161_+	ATP-binding protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	40.8	1.3e-22
WP_065814610.1|9153_9942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052642894.1|9989_10226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052642991.1|10969_12181_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	48.3	3.3e-96
WP_052642896.1|12359_12926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172974135.1|13315_14069_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	39.7	6.3e-13
WP_052642901.1|14869_15610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052642903.1|15781_16144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172974136.1|17565_18704_-|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	30.4	1.2e-18
WP_052642904.1|18758_20507_-	AAA family ATPase	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	39.3	2.2e-13
WP_052642905.1|20506_20887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052642906.1|20974_21868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052642907.1|23174_24380_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	64.5	4.6e-143
WP_052642909.1|24452_25448_+	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	40.7	1.9e-65
WP_052642912.1|25602_26817_+	replication initiation protein RepC	NA	NA	NA	NA	NA
WP_052642918.1|27203_27413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052642921.1|27604_28756_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_052642924.1|28745_29162_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_052642618.1|29161_29401_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_052642620.1|29587_30754_+	DUF1612 and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052642622.1|30814_31435_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_052642623.1|31409_32600_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_052642940.1|32583_33969_-	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_052642625.1|33958_34531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082077837.1|36813_37068_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_052642627.1|37064_37487_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_052642629.1|37800_38316_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_065814612.1|38450_39377_+	FecR family protein	NA	NA	NA	NA	NA
WP_082077838.1|39491_41816_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_052642633.1|41878_42196_+	DUF2218 domain-containing protein	NA	NA	NA	NA	NA
WP_052642637.1|42192_43101_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_082077857.1|43145_44078_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	35.9	7.9e-50
WP_052642640.1|44070_45012_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_052642642.1|45008_45767_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.7	3.7e-13
WP_065814607.1|45916_46636_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_082077858.1|46637_46985_-	DedA family protein	NA	NA	NA	NA	NA
WP_052642646.1|47074_48328_-	nickel/cobalt efflux transporter RcnA	NA	NA	NA	NA	NA
WP_052642648.1|48338_48614_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_082077839.1|49127_49859_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_052642652.1|49878_50550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052642654.1|50613_51216_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_052642952.1|51267_51888_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_052642655.1|51872_52340_+	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	35.9	1.8e-10
WP_052642657.1|52339_54484_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052642659.1|54499_55903_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	79.5	2.3e-37
WP_052642660.1|55905_56724_-	chromate resistance protein	NA	NA	NA	NA	NA
WP_052642662.1|57185_57875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052642664.1|57997_58540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077548607.1|58737_60318_-|transposase	ISL3-like element ISRsp8 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_LR723678	Arsenite-oxidising bacterium NT-25 plasmid 2	202844	69758	129439	202844	integrase,holin,transposase	Escherichia_phage(19.05%)	51	99038:99053	108297:108312
WP_052642687.1|69758_70472_-|transposase	IS6-like element ISRsp9 family transposase	transposase	A0A077SL39	Escherichia_phage	34.9	2.7e-18
WP_052642689.1|70737_71799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052642691.1|72108_72699_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_052642693.1|72967_73393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052642695.1|73467_74001_+	superoxide dismutase family protein	NA	A0A0E3Z7D4	Lambdina_fiscellaria_nucleopolyhedrovirus	36.4	4.4e-13
WP_172974137.1|74117_75359_+	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_052642697.1|75469_75820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162197814.1|76007_76685_+	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_052642700.1|76687_77194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152338683.1|77318_78434_+	FUSC family protein	NA	NA	NA	NA	NA
WP_082077841.1|78533_80060_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.6	1.1e-24
WP_052642705.1|80297_82913_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_052642707.1|83277_83886_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_052642709.1|83988_84702_-|transposase	IS6-like element ISRsp9 family transposase	transposase	A0A077SL39	Escherichia_phage	34.9	6.1e-18
WP_082077860.1|84646_85159_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.3	2.5e-13
WP_082077842.1|85287_85656_-	EamA family transporter	NA	NA	NA	NA	NA
WP_082077861.1|85782_87363_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_052642714.1|87547_89710_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_052642716.1|89809_90283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168624922.1|90681_90846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052642718.1|90990_92085_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	29.3	1.2e-25
WP_052642720.1|92203_92521_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_052642722.1|92944_93349_+	single-stranded DNA-binding protein	NA	C5IHK5	Burkholderia_virus	40.5	1.5e-16
WP_052642724.1|93418_93931_-	RES domain-containing protein	NA	NA	NA	NA	NA
WP_052642726.1|93930_94281_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_052642728.1|94431_95631_+	hypothetical protein	NA	A0A1V0DX75	Synechococcus_virus	41.7	1.5e-69
WP_052642730.1|95756_96197_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_052642732.1|96317_96833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052642734.1|96931_97423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052642963.1|97588_98698_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F6SJK8	Mycobacterium_phage	29.4	5.8e-07
WP_162197815.1|98721_100782_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
99038:99053	attL	ATGCCGCCCAACTCGC	NA	NA	NA	NA
WP_152338685.1|100957_101206_+	hypothetical protein	NA	U5J9H1	Bacillus_phage	49.2	6.0e-13
WP_052642738.1|101481_101901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082077844.1|101893_102199_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	45.1	5.3e-11
WP_052642740.1|102245_103253_-|integrase	site-specific integrase	integrase	A0A2L1IV36	Escherichia_phage	31.2	6.2e-08
WP_052642742.1|103249_104167_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WEV9	Clostridium_phage	26.2	3.4e-05
WP_052642966.1|104160_105252_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	30.4	3.9e-08
WP_052642744.1|105947_106637_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_052642745.1|106637_106901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052642747.1|107371_111826_+	strawberry notch family protein	NA	A0A076FMQ0	Aureococcus_anophage	24.0	4.5e-10
108297:108312	attR	GCGAGTTGGGCGGCAT	NA	NA	NA	NA
WP_052642749.1|111837_112869_+	toprim domain-containing protein	NA	K4NWL6	Pseudomonas_phage	32.4	2.4e-07
WP_052642969.1|113247_114183_+	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_052642751.1|114532_115390_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	27.4	1.7e-06
WP_052642753.1|115397_116336_+	sce7725 family protein	NA	NA	NA	NA	NA
WP_052642755.1|116340_117363_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_052642757.1|117451_117772_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_052642759.1|118572_119682_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	34.2	1.3e-06
WP_052642761.1|122811_123399_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.1	1.9e-25
WP_052642759.1|123479_124589_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	34.2	1.3e-06
WP_052642763.1|126580_127183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052642766.1|127840_129439_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	29.6	2.5e-59
