The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR699014	Citrobacter werkmanii isolate MGYG-HGUT-02535 chromosome 1	4885099	90133	97801	4885099		Thermobifida_phage(16.67%)	10	NA	NA
WP_096755499.1|90133_90988_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_096755500.1|91033_91525_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025078.1|91608_91896_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_096755501.1|91918_93352_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_040234138.1|93398_94124_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.4e-22
WP_096755502.1|94130_94685_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_096755503.1|94653_95229_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_096755504.1|95225_95792_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	3.2e-54
WP_096755505.1|95823_96810_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	2.5e-38
WP_096755506.1|96823_97801_-	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	22.8	1.5e-06
>prophage 2
NZ_LR699014	Citrobacter werkmanii isolate MGYG-HGUT-02535 chromosome 1	4885099	363092	421603	4885099	transposase	Bacillus_phage(25.0%)	52	NA	NA
WP_096755719.1|363092_364239_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.9e-146
WP_038633721.1|364448_364880_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_001548141.1|365130_366606_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	29.7	1.8e-27
WP_000697970.1|366598_367279_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	4.6e-31
WP_048242262.1|367468_368854_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246155.1|368881_369235_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000157620.1|369348_370641_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_032620969.1|370651_373798_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_000758228.1|373884_374325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023331515.1|374451_376899_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	34.9	7.6e-84
WP_000843494.1|376939_377137_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|377170_377908_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_001023257.1|378196_378646_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|378880_380698_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001378118.1|380703_381594_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|381633_382014_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_039187506.1|382018_382948_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|383002_383683_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_006785898.1|383679_385080_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_038633679.1|385295_385730_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004393990.1|386216_386825_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022652304.1|386821_387973_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_022652303.1|387969_389175_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_022652302.1|389176_389887_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.7e-31
WP_080975551.1|389915_390485_+	cytochrome C	NA	NA	NA	NA	NA
WP_001137910.1|390644_390965_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_000626969.1|390939_391401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241611.1|391561_391999_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_072259269.1|392113_392590_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	31.7	3.1e-18
WP_040115257.1|392881_393232_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045332352.1|393392_395051_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042998085.1|395296_395761_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_000019445.1|395961_396942_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_096755720.1|397242_398112_+	DMT family transporter	NA	NA	NA	NA	NA
WP_096755721.1|398245_399469_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004729618.1|399654_400428_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.0	7.3e-09
WP_096755722.1|400493_401195_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006687059.1|401260_402367_-	alkene reductase	NA	NA	NA	NA	NA
WP_002431133.1|402580_402910_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000888080.1|402939_403278_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000210409.1|403282_403864_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000108589.1|404005_404563_-	OsmC family protein	NA	NA	NA	NA	NA
WP_012695450.1|404748_405333_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	35.5	9.7e-22
WP_096755723.1|405492_408477_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.1	1.5e-304
WP_042201166.1|409652_410882_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_023327680.1|411033_411738_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.0e-138
WP_050489007.1|411941_412544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075849335.1|412777_413929_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035897353.1|414056_414638_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_048213832.1|415877_417050_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	94.6	1.3e-219
WP_048213831.1|417049_417847_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.7	1.5e-137
WP_096755725.1|420526_421603_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_LR699014	Citrobacter werkmanii isolate MGYG-HGUT-02535 chromosome 1	4885099	428582	484648	4885099	protease,integrase,tRNA,transposase	Macacine_betaherpesvirus(16.67%)	48	436526:436542	467515:467531
WP_088569337.1|428582_429694_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	6.4e-06
WP_047359077.1|430470_431394_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_003029587.1|431559_433077_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000345204.1|433214_434585_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_096755726.1|434584_435985_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.1	2.0e-20
WP_003029591.1|436014_437019_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
436526:436542	attL	CGGAACTGATTTCCCGC	NA	NA	NA	NA
WP_096755727.1|438250_438535_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096755728.1|438531_439386_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.4	1.1e-79
WP_094168643.1|439891_440347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040232055.1|440406_440910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040232056.1|440945_442514_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_044268532.1|442564_443740_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047358974.1|443768_444494_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	5.3e-17
WP_040232062.1|444493_446461_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_044268527.1|446457_447423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094168642.1|447470_450185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096755729.1|450184_453253_-	virulence factor SrfB	NA	NA	NA	NA	NA
WP_047358976.1|453270_454716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047363972.1|454765_455911_-	tellurite resistance domain protein	NA	NA	NA	NA	NA
WP_023288353.1|455959_456442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040232073.1|456521_457259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040232075.1|458553_460038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040232076.1|460009_461071_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_040232077.1|461277_462531_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.1	8.9e-81
WP_096755730.1|462907_463615_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_096755731.1|464083_466219_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_096755732.1|466287_467616_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
467515:467531	attR	GCGGGAAATCAGTTCCG	NA	NA	NA	NA
WP_096755733.1|467733_468990_-	nucleoside permease	NA	NA	NA	NA	NA
WP_135911431.1|469202_470288_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	1.0e-11
WP_003027126.1|470374_470644_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_096755735.1|470671_471724_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_096755736.1|471884_472604_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_096755737.1|472603_472930_+	YggL family protein	NA	NA	NA	NA	NA
WP_096755738.1|472979_473699_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_096755739.1|473887_474934_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_096755740.1|475058_476195_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_096755741.1|476187_476781_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_003027101.1|476788_477079_-	YggU family protein	NA	NA	NA	NA	NA
WP_096755742.1|477075_477642_-	YggT family protein	NA	NA	NA	NA	NA
WP_096755743.1|477660_478365_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_096755744.1|478382_479363_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_096755745.1|479372_479789_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_096755746.1|479788_480352_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_096755747.1|480527_481475_-	glutathione synthase	NA	NA	NA	NA	NA
WP_096755748.1|481487_482219_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_096755749.1|482293_483001_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_096755750.1|483238_484114_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_096755751.1|484126_484648_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_LR699014	Citrobacter werkmanii isolate MGYG-HGUT-02535 chromosome 1	4885099	867308	974194	4885099	portal,tRNA,tail,head,integrase,lysis,plate,transposase,terminase,capsid	Salmonella_phage(69.09%)	105	900457:900506	935253:935302
WP_000537152.1|867308_867593_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077581086.1|867589_868444_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.5	2.7e-81
WP_096756042.1|868517_869417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096756043.1|869413_869833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096756044.1|870606_871746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096756045.1|872196_872655_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096756046.1|872780_874250_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_096756047.1|874409_875264_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096756048.1|875556_877062_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_096756049.1|877073_878999_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	22.4	4.1e-24
WP_096756050.1|879339_880326_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_096756051.1|880364_881294_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_096756052.1|881470_883018_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.3	8.6e-09
WP_096756053.1|883029_884058_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_096756054.1|884068_885202_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_096756055.1|885214_887119_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_096756056.1|887133_888024_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_096756057.1|888033_888852_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_137398868.1|889731_890841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098169.1|893691_894012_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_096756059.1|894008_894236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096756060.1|894232_894790_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.2	1.1e-33
WP_023339334.1|894786_895053_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	72.7	6.8e-31
WP_096756061.1|895613_896351_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.0	1.6e-69
WP_004185270.1|896347_896593_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_096756062.1|896610_897177_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	2.5e-59
WP_096756064.1|897702_899046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096756065.1|899077_900277_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	2.0e-106
900457:900506	attL	TTATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_096759343.1|900630_901782_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	45.8	2.2e-94
WP_096756066.1|901825_902842_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	96.4	8.3e-194
WP_096756067.1|902843_903476_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	70.0	4.1e-82
WP_000102106.1|903592_903835_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000460858.1|903867_904377_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	100.0	1.6e-89
WP_000956168.1|904384_904585_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	100.0	3.2e-33
WP_000963480.1|904548_904890_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	100.0	2.1e-56
WP_001244238.1|904957_905191_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	98.7	2.9e-33
WP_057067400.1|905190_905418_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	1.5e-34
WP_023217828.1|905414_905711_+	DUF3850 domain-containing protein	NA	A0A1S6KVH3	Escherichia_phage	48.6	5.1e-11
WP_096756068.1|905707_906562_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	87.3	2.6e-140
WP_096756069.1|906558_907557_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	55.7	3.2e-97
WP_096759344.1|907574_909953_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.2	0.0e+00
WP_001154444.1|910111_910300_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_019077494.1|910311_910545_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	90.9	1.1e-32
WP_040233359.1|910903_911710_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_052463784.1|911727_912369_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040233360.1|912379_913219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172625552.1|913267_914308_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.4	1.1e-182
WP_096756071.1|914307_916074_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	95.6	0.0e+00
WP_096756072.1|916216_917050_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.2e-121
WP_096756073.1|917066_918131_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	1.3e-194
WP_058215530.1|918134_918785_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	99.1	4.1e-114
WP_096756074.1|918878_919343_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	6.0e-83
WP_001397651.1|919342_919546_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	8.5e-34
WP_001397650.1|919549_919765_+	membrane protein	NA	E5G6N0	Salmonella_phage	97.2	8.5e-32
WP_096756075.1|919745_920258_+	lysozyme	NA	E5G6N1	Salmonella_phage	78.7	1.3e-73
WP_040233376.1|920259_920634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096756076.1|920630_921059_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	93.6	3.4e-64
WP_040233380.1|921154_921586_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	93.0	1.9e-70
WP_040233382.1|921578_922025_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	87.7	1.2e-64
WP_040233386.1|922093_922672_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	95.8	1.1e-105
WP_040233387.1|922668_923028_+	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	95.8	2.3e-58
WP_040233388.1|923014_923923_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	93.4	5.6e-149
WP_096756077.1|923915_924521_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	96.5	1.2e-112
WP_096756078.1|925695_925899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138140543.1|925895_926267_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	41.8	8.1e-14
WP_096759345.1|926681_927074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096756080.1|927126_927684_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	85.2	2.5e-83
WP_096756081.1|927786_928959_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.3	8.9e-208
WP_096756082.1|928968_929484_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	96.5	2.5e-90
WP_040234052.1|929538_929841_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	95.0	4.0e-43
WP_032300013.1|929855_929978_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	89.7	1.7e-13
WP_096756083.1|929967_932763_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	84.8	0.0e+00
WP_040234055.1|932759_933245_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	84.4	1.7e-64
WP_040234056.1|933241_934339_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	6.4e-176
WP_023184674.1|934405_934624_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	76.4	7.5e-28
WP_096756084.1|934650_935133_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	30.7	1.4e-13
WP_096759346.1|935691_936855_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
935253:935302	attR	TTATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_096756085.1|936862_939049_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.4	7.6e-19
WP_096756086.1|939045_940455_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_096756087.1|940548_951747_-	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_096759347.1|952328_952811_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_137398869.1|952953_953409_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_096759348.1|953398_953689_+	RnfH family protein	NA	NA	NA	NA	NA
WP_096756089.1|953743_954088_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_096756090.1|954237_955899_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_096756091.1|955984_956863_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_096756092.1|956984_957578_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_135911576.1|957627_958920_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_096756093.1|958938_959730_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_096756094.1|959895_961257_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003031228.1|961508_961757_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_096756095.1|961775_962324_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_096756096.1|962368_963148_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|963300_963648_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_096759351.1|963840_964194_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_096756097.1|964257_965619_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_096756098.1|965623_966106_-	OmpA family protein	NA	NA	NA	NA	NA
WP_096756099.1|966118_967345_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.6	6.4e-07
WP_096756100.1|967337_967856_-	YfiR family protein	NA	NA	NA	NA	NA
WP_096756101.1|968014_968389_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_096756102.1|968604_969675_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	1.2e-89
WP_096756103.1|969685_970807_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_096756104.1|970854_972015_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_096756105.1|972266_972605_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_096756106.1|972865_974194_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_LR699014	Citrobacter werkmanii isolate MGYG-HGUT-02535 chromosome 1	4885099	1183707	1242137	4885099	integrase,tRNA,tail,transposase	Escherichia_phage(27.78%)	59	1193066:1193081	1236660:1236675
WP_096756264.1|1183707_1185123_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_096756265.1|1185179_1185572_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_096756266.1|1185573_1185936_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_096756267.1|1186496_1187699_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_096756268.1|1188043_1189282_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_096756269.1|1189323_1190316_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_096756270.1|1190329_1191856_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.6	1.8e-06
WP_096756271.1|1191929_1192892_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096756272.1|1192932_1194141_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
1193066:1193081	attL	GCCAGCGCCCCGGTAA	NA	NA	NA	NA
WP_096756273.1|1194438_1194777_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_096756274.1|1194905_1195904_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_096756275.1|1196093_1197746_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_096756276.1|1197746_1198982_-	ion channel protein	NA	NA	NA	NA	NA
WP_096756277.1|1199186_1200152_+	glucokinase	NA	NA	NA	NA	NA
WP_096756278.1|1200343_1200670_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_096756279.1|1200690_1201938_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_096756280.1|1201955_1203038_+	aminopeptidase	NA	NA	NA	NA	NA
WP_096756281.1|1203037_1204078_+	aminopeptidase	NA	NA	NA	NA	NA
WP_096756282.1|1204101_1206597_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_096756283.1|1206652_1207657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096756284.1|1207731_1208586_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_096756285.1|1208610_1209345_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.8	3.2e-14
WP_096759361.1|1209359_1211057_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_096756286.1|1211444_1212683_+	alanine transaminase	NA	NA	NA	NA	NA
WP_010723117.1|1212750_1212822_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_096756287.1|1213164_1213779_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_096756288.1|1213819_1214740_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.3	1.3e-76
WP_096756289.1|1215179_1215422_+	YfdY family protein	NA	NA	NA	NA	NA
WP_096756290.1|1215536_1216928_-	phosphoglycerate transporter PgtP	NA	NA	NA	NA	NA
WP_135912847.1|1217319_1218543_+	phosphoglycerate transport regulator PgtC	NA	NA	NA	NA	NA
WP_096756291.1|1220125_1220743_-	recombination protein NinG	NA	A0A1W6JNX3	Morganella_phage	59.3	1.2e-43
WP_096756292.1|1220739_1221711_-	toprim domain-containing protein	NA	A0A1B5FPA8	Escherichia_phage	61.9	1.9e-107
WP_096756293.1|1221707_1223237_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	67.6	7.8e-204
WP_096756294.1|1223229_1223505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096756296.1|1223986_1224493_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	65.8	2.5e-58
WP_096756297.1|1224521_1224719_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	50.8	3.5e-08
WP_096756298.1|1224829_1225468_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	40.6	3.8e-35
WP_096756299.1|1225911_1226103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096756300.1|1226750_1227824_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	38.2	1.5e-52
WP_162875782.1|1228072_1228225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005081.1|1228237_1228597_+	hypothetical protein	NA	I6NMK2	Burkholderia_virus	35.6	9.3e-07
WP_096756301.1|1228640_1229309_+	DUF2303 family protein	NA	NA	NA	NA	NA
WP_170975200.1|1229598_1229784_+	DNA-binding protein	NA	A0A2R2Z2X2	Escherichia_phage	57.9	1.5e-13
WP_096756302.1|1229803_1230799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096756303.1|1230849_1232022_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.1	2.6e-199
WP_096756304.1|1232401_1232941_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_096756305.1|1232992_1234240_-	two-component system response regulator PgtA	NA	NA	NA	NA	NA
WP_096756306.1|1234556_1234922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096756307.1|1234926_1235286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096756308.1|1235282_1235828_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_096756309.1|1235831_1236023_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_096756310.1|1236019_1237522_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	43.5	1.1e-104
1236660:1236675	attR	TTACCGGGGCGCTGGC	NA	NA	NA	NA
WP_096756311.1|1237525_1237897_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_096756312.1|1237898_1238177_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_096756313.1|1239117_1239528_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	40.9	3.0e-17
WP_096756314.1|1239524_1239866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096759363.1|1239894_1240542_+	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	83.6	1.7e-83
WP_096756315.1|1240496_1240739_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	4.4e-29
WP_000019445.1|1241156_1242137_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 6
NZ_LR699014	Citrobacter werkmanii isolate MGYG-HGUT-02535 chromosome 1	4885099	1533151	1541618	4885099	tRNA,protease	Planktothrix_phage(16.67%)	7	NA	NA
WP_096756562.1|1533151_1535098_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.2	4.8e-41
WP_096756563.1|1535182_1535407_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	2.8e-17
WP_003036810.1|1535729_1536050_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_096756564.1|1536079_1538356_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.1e-164
WP_096756565.1|1538602_1539964_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	1.1e-204
WP_096756566.1|1540084_1540816_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_096756567.1|1540895_1541618_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	1.1e-30
>prophage 7
NZ_LR699014	Citrobacter werkmanii isolate MGYG-HGUT-02535 chromosome 1	4885099	1584921	1592987	4885099		Enterobacteria_phage(28.57%)	8	NA	NA
WP_096756598.1|1584921_1586316_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.5	3.7e-19
WP_096756599.1|1586480_1587371_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	39.2	5.6e-45
WP_096756600.1|1588101_1588869_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_096756601.1|1588868_1589609_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	26.9	4.9e-10
WP_096756602.1|1589641_1590697_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.6	7.7e-102
WP_096756603.1|1590698_1591562_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	65.6	2.2e-107
WP_096756604.1|1591558_1592434_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D8EQE2	Escherichia_phage	33.3	1.0e-27
WP_096756605.1|1592438_1592987_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.0	3.9e-41
>prophage 8
NZ_LR699014	Citrobacter werkmanii isolate MGYG-HGUT-02535 chromosome 1	4885099	1861497	1907872	4885099	holin,tail,integrase,lysis,plate,terminase	Enterobacteria_phage(32.69%)	64	1862178:1862196	1914892:1914910
WP_096756842.1|1861497_1862304_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	1.8e-13
1862178:1862196	attL	GCGTCTGGCGCTCACGCAG	NA	NA	NA	NA
WP_096756843.1|1862305_1863298_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	25.8	1.4e-07
WP_096756844.1|1863297_1864188_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_052463782.1|1864322_1865552_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.4	3.0e-121
WP_096756846.1|1865770_1866013_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	89.7	3.0e-33
WP_096756847.1|1866052_1867165_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	93.5	1.8e-194
WP_096756848.1|1867176_1869939_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7P6V4	Enterobacteria_phage	65.0	0.0e+00
WP_057064861.1|1870079_1870241_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	90.6	2.9e-21
WP_016156718.1|1870252_1870459_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	98.5	1.6e-32
WP_172625561.1|1870800_1871007_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	2.5e-17
WP_096756849.1|1871038_1871419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016156715.1|1871502_1871934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096759385.1|1872084_1872807_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	55.6	1.7e-71
WP_096756850.1|1872875_1873103_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	52.1	2.0e-15
WP_016156712.1|1873133_1873673_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	84.9	9.5e-80
WP_096759386.1|1873837_1874674_+	Pyocin large subunit	NA	T1SA92	Salmonella_phage	57.7	5.4e-82
WP_096756851.1|1874676_1875015_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	46.7	1.8e-15
WP_096756852.1|1875493_1875805_+	hypothetical protein	NA	A0A1P8DTU9	Salmonella_phage	63.4	4.5e-34
WP_096756853.1|1875801_1876122_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_096759387.1|1876132_1876645_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	74.9	1.4e-72
WP_172625553.1|1876641_1877232_+	Lar family restriction alleviation protein	NA	A0A1B1W272	Salmonella_phage	56.1	3.1e-15
WP_096756854.1|1877442_1877646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096756855.1|1877642_1878671_-	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	95.3	4.6e-184
WP_096756856.1|1878982_1879909_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.9	1.2e-53
WP_172625549.1|1879972_1880110_+	hypothetical protein	NA	K7PJT8	Enterobacteria_phage	92.7	1.3e-14
WP_096756857.1|1880156_1880480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096756858.1|1880790_1881390_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	97.0	1.7e-106
WP_096756859.1|1881389_1881596_+	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	78.8	7.9e-27
WP_096756860.1|1881598_1882210_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	74.9	5.7e-81
WP_096756861.1|1882206_1882347_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	93.2	2.2e-17
WP_096756862.1|1882343_1883153_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	70.3	1.2e-110
WP_060683741.1|1883349_1883760_-	hypothetical protein	NA	K7P7K4	Enterobacteria_phage	96.3	3.3e-69
WP_071701194.1|1884109_1884598_+	HNH endonuclease	NA	A0A2P0PA94	Pectobacterium_phage	46.4	2.4e-18
WP_001568784.1|1884642_1884921_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_096756863.1|1884892_1885441_+	lysozyme	NA	K7PM52	Enterobacteria_phage	96.2	2.9e-100
WP_096756864.1|1885437_1885899_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	64.5	4.0e-47
WP_096759389.1|1885931_1886336_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_096756865.1|1886396_1886867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096756866.1|1886921_1887920_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	46.6	4.1e-44
WP_096756867.1|1887885_1889304_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	41.1	6.1e-86
WP_096756868.1|1889303_1890626_+	DUF1073 domain-containing protein	NA	L7TRA1	Rhizobium_phage	24.6	1.7e-21
WP_096756869.1|1890603_1891455_+	hypothetical protein	NA	Q7Y5U5	Haemophilus_phage	32.1	9.2e-29
WP_096756870.1|1891458_1892604_+	DUF2213 domain-containing protein	NA	A0A2H4J159	uncultured_Caudovirales_phage	33.5	6.0e-15
WP_096756871.1|1892606_1893098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096756872.1|1893101_1894070_+	DUF2184 domain-containing protein	NA	NA	NA	NA	NA
WP_096756873.1|1894084_1894447_+	DUF4054 domain-containing protein	NA	L7TRB1	Rhizobium_phage	31.8	5.5e-07
WP_096756874.1|1894467_1895040_+	hypothetical protein	NA	A0A2P9HXJ3	Yersinia_phage	40.4	3.2e-25
WP_019076903.1|1895036_1895393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096756875.1|1895389_1895878_+	hypothetical protein	NA	A0A2I7RBL3	Vibrio_phage	57.5	2.3e-40
WP_096756876.1|1895878_1897381_+	DUF3383 family protein	NA	A0A2I7QS67	Vibrio_phage	59.2	8.9e-160
WP_096756877.1|1897391_1897823_+	hypothetical protein	NA	A0A2P9HXY3	Yersinia_phage	55.2	7.4e-35
WP_096756878.1|1897831_1898260_+	hypothetical protein	NA	A0A2P9HXM8	Yersinia_phage	46.5	1.3e-23
WP_172625554.1|1898268_1898427_+	hypothetical protein	NA	A0A2P9HXJ0	Yersinia_phage	64.0	3.0e-10
WP_096756879.1|1898413_1900000_+	hypothetical protein	NA	A0A2P9HXI8	Yersinia_phage	38.2	3.6e-87
WP_096756880.1|1899999_1900785_+	hypothetical protein	NA	A0A2P9HXI6	Yersinia_phage	41.4	1.4e-47
WP_096756881.1|1900786_1901122_+	hypothetical protein	NA	A0A2I7RBP0	Vibrio_phage	56.4	3.9e-31
WP_085348087.1|1901121_1902072_+	hypothetical protein	NA	A0A2P9HXK2	Yersinia_phage	45.8	3.5e-69
WP_019076895.1|1902072_1902435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096756882.1|1902456_1903074_+	hypothetical protein	NA	A0A2I7QS79	Vibrio_phage	49.3	1.1e-52
WP_096756883.1|1903070_1903451_+	hypothetical protein	NA	A0A2H5BFY4	Vibrio_phage	59.3	9.4e-26
WP_096756884.1|1903434_1904616_+|plate	baseplate J/gp47 family protein	plate	A0A2I7QS90	Vibrio_phage	46.9	2.5e-101
WP_047593696.1|1904612_1905335_+	DUF2612 domain-containing protein	NA	A0A2P9HXZ0	Yersinia_phage	52.3	3.8e-68
WP_096759390.1|1906458_1906887_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	76.3	1.6e-26
WP_096756885.1|1907314_1907872_+	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	84.6	2.5e-83
1914892:1914910	attR	GCGTCTGGCGCTCACGCAG	NA	NA	NA	NA
>prophage 9
NZ_LR699014	Citrobacter werkmanii isolate MGYG-HGUT-02535 chromosome 1	4885099	2325427	2332208	4885099		Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_096757245.1|2325427_2326207_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.0	3.6e-11
WP_096757246.1|2326203_2327646_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	39.5	5.9e-52
WP_096757247.1|2327707_2328421_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_096757248.1|2328739_2329204_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	4.5e-14
WP_096757249.1|2329281_2330031_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	25.0	2.4e-09
WP_096757250.1|2330030_2330582_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_096757251.1|2330648_2331629_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.4	3.7e-13
WP_003030571.1|2331908_2332208_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
>prophage 10
NZ_LR699014	Citrobacter werkmanii isolate MGYG-HGUT-02535 chromosome 1	4885099	2407224	2490773	4885099	tRNA,portal,holin,tail,head,integrase,plate,terminase,capsid	Salmonella_phage(17.78%)	95	2399305:2399319	2486846:2486860
2399305:2399319	attL	TTCCACTCGATACCG	NA	NA	NA	NA
WP_096757321.1|2407224_2407728_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_016152803.1|2407872_2408319_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_115258701.1|2408275_2409094_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096757322.1|2409193_2410381_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_096757323.1|2410418_2411126_-	CTP synthase	NA	NA	NA	NA	NA
WP_096757324.1|2411324_2411672_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_096757325.1|2411679_2411928_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_096757326.1|2412114_2413140_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	28.1	1.3e-13
WP_096757327.1|2413187_2413286_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099530266.1|2413288_2413363_+	protein YoaJ	NA	NA	NA	NA	NA
WP_096757328.1|2413412_2413661_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_096757329.1|2414019_2416167_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_096757330.1|2416221_2416866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096757331.1|2417074_2417257_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_096757332.1|2417260_2417623_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_096759415.1|2417798_2418437_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_096757333.1|2418673_2419300_+	hydrolase	NA	NA	NA	NA	NA
WP_096757334.1|2419357_2420008_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_096757335.1|2420065_2420656_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_096757336.1|2420639_2421434_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_096757337.1|2421427_2422240_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_096759416.1|2422229_2423204_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_096757338.1|2423203_2424790_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096757339.1|2425225_2427313_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_096757340.1|2427659_2428043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096757341.1|2428619_2428952_+	fimbrial protein	NA	NA	NA	NA	NA
WP_096757342.1|2429151_2430372_+	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_096757343.1|2433558_2433963_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	44.4	6.3e-28
WP_096757344.1|2434135_2434288_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	1.5e-19
WP_096757345.1|2437577_2438249_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	62.9	2.5e-69
WP_096757346.1|2438399_2439242_+	helix-turn-helix transcriptional regulator	NA	D0R0F8	Streptococcus_phage	28.6	7.0e-05
WP_096757347.1|2439238_2439790_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.0	1.7e-47
WP_096757350.1|2441936_2442149_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.3e-23
WP_096757351.1|2442694_2444515_+	DUF4209 domain-containing protein	NA	Q2P9X5	Enterobacteria_phage	20.5	5.6e-15
WP_096757352.1|2444893_2445565_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	3.1e-80
WP_096757353.1|2445557_2446826_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.6	3.9e-201
WP_096757354.1|2446828_2447248_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	7.2e-35
WP_096757355.1|2447325_2447568_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	80.5	2.0e-29
WP_096759418.1|2447614_2448169_-	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	85.0	5.5e-83
WP_096757356.1|2448591_2449002_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	52.9	1.4e-30
WP_096759419.1|2448973_2449402_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	80.3	4.6e-29
WP_096757357.1|2450092_2450686_-	YmfQ family protein	NA	NA	NA	NA	NA
WP_096757358.1|2450682_2451825_-|plate	baseplate J/gp47 family protein	plate	R9TN81	Rhizobium_phage	24.3	2.5e-13
WP_096757359.1|2451826_2452264_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	49.5	1.2e-16
WP_172625556.1|2452260_2452845_-|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	31.2	3.7e-05
WP_096757360.1|2452841_2453927_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	34.1	1.2e-46
WP_096757361.1|2453923_2455324_-	DNA circularization protein	NA	NA	NA	NA	NA
WP_096757362.1|2455384_2455768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096757363.1|2455877_2457692_-	lytic transglycosylase domain-containing protein	NA	A0A0H4TH10	Yersinia_phage	43.1	1.8e-13
WP_096757364.1|2457833_2458112_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_096756311.1|2458113_2458485_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_096757365.1|2458488_2459991_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	43.3	1.1e-104
WP_096757366.1|2459987_2460179_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_096757367.1|2460182_2460728_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_096757368.1|2460724_2461084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096757369.1|2461088_2461466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096757370.1|2461467_2462517_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	2.8e-51
WP_096757371.1|2462621_2463020_-|head	head decoration protein	head	NA	NA	NA	NA
WP_096757372.1|2463019_2463610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096757373.1|2463611_2464481_-	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	39.0	1.9e-50
WP_096757374.1|2464477_2466115_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	6.6e-92
WP_096757375.1|2466114_2466378_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_096757376.1|2466386_2468510_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	36.7	1.3e-100
WP_096757377.1|2468451_2469015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096757378.1|2469339_2469624_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_096757379.1|2469791_2470430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096757381.1|2470901_2471174_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.7	3.6e-19
WP_096757382.1|2471170_2471713_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	69.8	8.6e-73
WP_096757383.1|2471712_2471994_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.5	4.4e-20
WP_003833974.1|2471980_2472367_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	92.2	4.7e-57
WP_138140546.1|2472909_2473191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096757385.1|2473246_2473609_-	DUF1133 family protein	NA	U5P0A5	Shigella_phage	87.5	1.3e-56
WP_096757386.1|2473623_2474673_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	59.3	9.0e-119
WP_096757387.1|2474688_2475519_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	72.1	1.9e-103
WP_096757388.1|2475605_2476004_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	89.3	6.1e-60
WP_096759421.1|2476000_2476894_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	92.9	9.3e-165
WP_096757389.1|2476893_2477760_-	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	81.7	4.5e-39
WP_003034732.1|2477749_2477929_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	3.0e-14
WP_045445262.1|2478101_2478653_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	53.5	7.0e-46
WP_096757390.1|2478681_2478879_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	73.8	1.2e-19
WP_096759422.1|2478978_2479635_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	66.5	1.1e-85
WP_096757391.1|2479969_2480161_-	hypothetical protein	NA	S5FM78	Shigella_phage	92.1	8.9e-25
WP_096757392.1|2480961_2481879_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.4	1.4e-104
WP_061381733.1|2481987_2482527_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.3	1.0e-65
WP_164742462.1|2482514_2482691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096757393.1|2482687_2482942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088583037.1|2483499_2484255_+	hypothetical protein	NA	H6WRY1	Salmonella_phage	96.8	3.3e-147
WP_096757394.1|2484265_2484568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048241187.1|2484609_2484846_+	excisionase	NA	NA	NA	NA	NA
WP_096757395.1|2484835_2485978_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	81.7	1.1e-175
WP_096757396.1|2486091_2487342_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
2486846:2486860	attR	TTCCACTCGATACCG	NA	NA	NA	NA
WP_096757397.1|2487544_2488168_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_096757398.1|2488211_2489141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096757399.1|2489151_2489613_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_096757400.1|2489666_2490773_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 11
NZ_LR699014	Citrobacter werkmanii isolate MGYG-HGUT-02535 chromosome 1	4885099	2628185	2635660	4885099	transposase	Burkholderia_phage(28.57%)	8	NA	NA
WP_096757526.1|2628185_2628653_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	45.6	3.2e-31
WP_096757527.1|2628633_2630064_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.2	4.7e-102
WP_096757528.1|2630137_2630833_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.8	4.7e-07
WP_096757529.1|2631232_2632408_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.4	3.7e-105
WP_077581086.1|2632910_2633765_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.5	2.7e-81
WP_000537152.1|2633761_2634046_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_096757530.1|2634401_2634614_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	1.7e-24
WP_096757531.1|2635441_2635660_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	61.8	1.4e-18
>prophage 12
NZ_LR699014	Citrobacter werkmanii isolate MGYG-HGUT-02535 chromosome 1	4885099	3443155	3456023	4885099	integrase,capsid	Enterobacteria_phage(90.0%)	15	3438716:3438732	3464183:3464199
3438716:3438732	attL	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_096758174.1|3443155_3444268_+	agmatine deiminase family protein	NA	M1HH76	Paramecium_bursaria_Chlorella_virus	35.6	3.1e-53
WP_096758175.1|3444509_3445046_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_096758176.1|3445465_3447799_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.8	0.0e+00
WP_016151192.1|3447813_3448134_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_096759467.1|3448130_3448358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096758177.1|3448462_3448912_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	68.1	9.7e-46
WP_096758178.1|3448904_3449204_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	56.6	1.0e-22
WP_096758179.1|3449196_3449757_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	68.5	2.2e-31
WP_096758180.1|3449753_3450020_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	63.6	2.3e-23
WP_096758181.1|3450573_3451377_+|capsid	capsid protein	capsid	Q7M2A2	Enterobacteria_phage	26.4	3.1e-10
WP_096758182.1|3451373_3451616_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	1.4e-19
WP_096758183.1|3451632_3452208_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	49.7	2.8e-37
WP_096758184.1|3452876_3453524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096758185.1|3453516_3454848_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_096758186.1|3454844_3456023_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.6	3.8e-142
3464183:3464199	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
