The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR699009	Pluralibacter gergoviae isolate MGYG-HGUT-02520 chromosome 1	5408082	17865	66495	5408082	transposase,protease,integrase,tRNA	uncultured_Caudovirales_phage(23.08%)	54	33953:33968	62839:62854
WP_043082084.1|17865_18366_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_043082083.1|18460_19198_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_043082082.1|19218_19950_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_043082081.1|19972_20920_+	glutathione synthase	NA	NA	NA	NA	NA
WP_045287471.1|21018_21582_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_048254060.1|21581_21998_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_043082078.1|22034_22688_-	transcriptional regulator CsgD	NA	NA	NA	NA	NA
WP_048254059.1|23111_24092_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_048254058.1|24106_24811_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_043082075.1|24832_25399_+	YggT family protein	NA	NA	NA	NA	NA
WP_043082074.1|25395_25707_+	YggU family protein	NA	NA	NA	NA	NA
WP_048254057.1|25694_26282_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_048254056.1|26281_27421_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_045287464.1|27469_27817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048254055.1|27999_29046_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_048254054.1|29201_29921_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_043082068.1|29975_30302_-	YggL family protein	NA	NA	NA	NA	NA
WP_045287462.1|30301_31021_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_048254053.1|31165_32218_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_043082065.1|32243_32519_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_043086426.1|32552_33635_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_048254052.1|33671_35816_-	ornithine decarboxylase	NA	NA	NA	NA	NA
33953:33968	attL	CCTGCGGGTTCATCAC	NA	NA	NA	NA
WP_048254051.1|36225_36435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004115409.1|36790_37822_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_004115412.1|37881_39501_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_004115414.1|39567_41043_-	UvrD-helicase domain-containing protein	NA	A0A075DXT4	Acinetobacter_phage	31.5	2.6e-47
WP_106912748.1|41495_41780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032742914.1|41854_43288_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.5	1.1e-103
WP_048254050.1|43329_44529_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	39.1	1.1e-32
WP_077254457.1|44664_45261_-	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	26.6	2.8e-08
WP_053287147.1|45256_45484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053287146.1|45500_46226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032742913.1|46316_47249_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_025760314.1|47245_47764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025760313.1|47771_48737_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001515173.1|48919_49243_+	helix-turn-helix transcriptional regulator	NA	F8TVE5	EBPR_siphovirus	41.7	7.5e-08
WP_025760312.1|49245_50112_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000427623.1|50606_51611_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_031591996.1|52221_52575_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	49.1	6.9e-23
WP_031591995.1|52622_52985_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_031591994.1|53001_54753_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_031591992.1|54799_56089_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	3.5e-173
WP_031591991.1|56101_56527_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	6.1e-50
WP_088244011.1|56748_57729_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_001091224.1|58151_58925_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.7	1.3e-08
WP_008502228.1|58990_59692_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006687059.1|59757_60864_-	alkene reductase	NA	NA	NA	NA	NA
WP_008502229.1|61076_61406_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_048255352.1|61435_61774_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_008502230.1|61778_62360_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000108589.1|62501_63059_-	OsmC family protein	NA	NA	NA	NA	NA
62839:62854	attR	CCTGCGGGTTCATCAC	NA	NA	NA	NA
WP_031591547.1|63244_63829_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	35.5	1.3e-21
WP_064360549.1|64123_65332_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.8e-46
WP_080964546.1|65577_66495_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.1	2.7e-50
>prophage 2
NZ_LR699009	Pluralibacter gergoviae isolate MGYG-HGUT-02520 chromosome 1	5408082	215783	274340	5408082	tRNA,holin,transposase,integrase	Leptospira_phage(11.11%)	53	205387:205404	268085:268102
205387:205404	attL	GCAGGCTGACGTTGCTGC	NA	NA	NA	NA
WP_106912755.1|215783_216870_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	1.7e-43
WP_172626151.1|217195_219025_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_048255202.1|219017_220136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912756.1|220546_221708_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	2.4e-48
WP_073971302.1|221740_221884_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048253859.1|222269_226517_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_048253774.1|226529_227654_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_048253775.1|227851_229108_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	41.2	2.7e-85
WP_043086281.1|229566_230445_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_048253776.1|230434_231322_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_048253777.1|231332_232163_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_048253778.1|232156_233230_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.4e-26
WP_048253779.1|233222_234536_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048253781.1|234861_235497_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_048253783.1|235493_236963_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_048253784.1|237035_238055_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.6	2.1e-43
WP_048253785.1|238088_239741_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_043080795.1|239877_241377_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.8	1.1e-80
WP_043080796.1|241428_242511_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_048253788.1|242510_243611_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_043080798.1|243880_245392_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	1.2e-47
WP_043086282.1|245475_245919_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_043080799.1|245918_248774_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.5	4.2e-142
WP_043080800.1|248836_250036_-	DUF898 family protein	NA	NA	NA	NA	NA
WP_043080801.1|250226_250730_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048253789.1|250858_251899_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048253790.1|251939_252698_-|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
WP_080964537.1|252788_253286_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_043080803.1|253686_254100_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_048253792.1|254276_255281_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_043080805.1|255317_256454_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_043080806.1|256537_257038_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_043080807.1|257108_258107_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_043080808.1|258345_259308_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	33.3	2.1e-37
WP_043080809.1|259519_260764_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_045287343.1|260780_261335_-	YgjV family protein	NA	NA	NA	NA	NA
WP_048253793.1|261408_262896_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_106912757.1|262915_264325_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_043080813.1|264785_266081_+	MFS transporter	NA	NA	NA	NA	NA
WP_043080814.1|266198_266975_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_043080816.1|267289_267952_+	DedA family protein	NA	NA	NA	NA	NA
WP_043080817.1|267954_268338_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
268085:268102	attR	GCAGCAACGTCAGCCTGC	NA	NA	NA	NA
WP_043080818.1|268486_268855_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_043080820.1|268893_269196_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_043080821.1|269198_269597_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_043080822.1|269589_269889_+	YqjK-like family protein	NA	NA	NA	NA	NA
WP_043080824.1|270107_270500_+	DoxX family protein	NA	NA	NA	NA	NA
WP_043080825.1|270635_271622_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_048253796.1|271679_272576_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048253797.1|272679_273381_+	pirin family protein	NA	NA	NA	NA	NA
WP_098938361.1|273405_273576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043080828.1|273796_274021_+	YdcH family protein	NA	NA	NA	NA	NA
WP_048253798.1|274061_274340_-|transposase	IS66 family transposase zinc-finger binding domain-containing protein	transposase	NA	NA	NA	NA
>prophage 3
NZ_LR699009	Pluralibacter gergoviae isolate MGYG-HGUT-02520 chromosome 1	5408082	359834	425773	5408082	tail,capsid,tRNA,portal,integrase,transposase,head,protease,terminase	uncultured_Caudovirales_phage(47.62%)	70	357425:357441	432863:432879
357425:357441	attL	GACCGCCACGCCGCACG	NA	NA	NA	NA
WP_043080904.1|359834_360335_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	43.3	9.5e-26
WP_043080905.1|360339_360978_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829815.1|361289_361682_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|361697_362126_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_048253829.1|362416_363550_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_043080907.1|363744_364143_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_043080908.1|364240_365614_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	24.1	2.2e-16
WP_043080909.1|365703_366762_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_043080910.1|366822_367761_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_043080911.1|368176_368647_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_043080912.1|369012_369276_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_043080913.1|369417_369684_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_043080914.1|369732_370008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043080915.1|370098_372066_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_048253862.1|372071_373004_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_043080916.1|373011_373215_-	AaeX family protein	NA	NA	NA	NA	NA
WP_043080917.1|373346_374270_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_045288753.1|374304_375750_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_048253830.1|375821_379613_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_043080921.1|379638_381108_-	ribonuclease G	NA	NA	NA	NA	NA
WP_045288751.1|381097_381685_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_043080924.1|381699_382188_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_048253831.1|382187_383198_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_006818047.1|383266_384310_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_048253832.1|384604_386545_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_048253833.1|386765_387740_+	oxidoreductase	NA	NA	NA	NA	NA
WP_043080928.1|387817_388813_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_048253834.1|388813_389413_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_043080930.1|389648_390101_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_043080932.1|390123_390582_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_043080933.1|390592_391942_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_043080935.1|392039_392282_+	YhdT family protein	NA	NA	NA	NA	NA
WP_048253835.1|392271_393723_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_043080937.1|393735_394617_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_043080939.1|394984_395950_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|395975_396272_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_048253836.1|396739_396931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048253837.1|396933_398595_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	96.0	0.0e+00
WP_048253838.1|398578_398935_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	95.7	1.8e-58
WP_162268877.1|399063_399216_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	80.0	6.6e-15
WP_048253839.1|399208_399652_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.2	3.6e-77
WP_048253840.1|399651_399951_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	81.8	7.4e-42
WP_048253841.1|399943_400285_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	45.2	1.1e-20
WP_048253842.1|400281_401517_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	95.9	1.0e-233
WP_048253843.1|401518_402079_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	96.2	7.2e-99
WP_048253844.1|402130_403297_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.1	7.0e-205
WP_048253845.1|403567_404173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048253846.1|404187_404700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048253847.1|404746_405082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072065290.1|405093_405303_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	60.0	7.7e-14
WP_048253848.1|405606_407421_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.9	3.7e-128
WP_048253849.1|407417_407726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048253850.1|407718_407907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072065291.1|407899_408169_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	83.1	1.5e-38
WP_004150969.1|408797_409577_-	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_072065292.1|409587_409872_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_048253851.1|410053_410995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048253852.1|411087_412314_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	61.9	4.0e-150
WP_048253853.1|412583_413603_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_048253854.1|413614_414934_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_048253855.1|414958_415882_-	ribokinase	NA	NA	NA	NA	NA
WP_048253856.1|416202_416997_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043086297.1|417114_417288_+	DUF2556 family protein	NA	NA	NA	NA	NA
WP_048273208.1|417414_419463_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	37.1	9.0e-22
WP_043080943.1|419732_419954_+	membrane lipoprotein lipid attachment site-containing protein	NA	NA	NA	NA	NA
WP_043080944.1|420410_421436_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.1	1.7e-69
WP_048253858.1|421502_422684_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_043086298.1|422693_423797_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_043080946.1|423804_424563_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	1.7e-18
WP_023137339.1|424732_425773_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	87.6	6.7e-183
432863:432879	attR	CGTGCGGCGTGGCGGTC	NA	NA	NA	NA
>prophage 4
NZ_LR699009	Pluralibacter gergoviae isolate MGYG-HGUT-02520 chromosome 1	5408082	1578083	1669701	5408082	transposase,integrase	uncultured_Caudovirales_phage(33.33%)	70	1618267:1618282	1661366:1661381
WP_007897923.1|1578083_1579331_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007897920.1|1579317_1581084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|1581071_1583189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384060.1|1583192_1583621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032622084.1|1584946_1585255_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_106912790.1|1585350_1585557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096913407.1|1585679_1586880_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	82.2	4.3e-141
WP_071524141.1|1588027_1588480_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017384064.1|1588445_1589006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099975484.1|1590995_1591838_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007897903.1|1592132_1592792_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_022649401.1|1593894_1594221_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_017384068.1|1594652_1595786_+	glutathione-independent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012561110.1|1597679_1598516_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_012561111.1|1598580_1598979_-	VOC family protein	NA	NA	NA	NA	NA
WP_017384070.1|1599022_1600132_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.7	2.2e-30
WP_017384071.1|1600166_1600442_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_017384073.1|1601789_1602086_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063201667.1|1602944_1606220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140246.1|1606424_1606754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048253438.1|1607967_1608795_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	43.6	2.1e-62
WP_048253437.1|1608905_1610069_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_098938801.1|1610111_1610258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043081971.1|1610254_1611154_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_043081972.1|1611176_1611839_-	DedA family protein	NA	NA	NA	NA	NA
WP_043081973.1|1612165_1613362_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_043081975.1|1613552_1614284_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_043081976.1|1614290_1614716_+	TonB system transport protein ExbD	NA	NA	NA	NA	NA
WP_048253436.1|1614793_1615834_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_048253435.1|1616056_1617601_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	9.8e-13
WP_045287432.1|1617606_1618473_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
1618267:1618282	attL	GCCCAGCGCCAGCAGC	NA	NA	NA	NA
WP_048253434.1|1618559_1619102_-	thioredoxin	NA	NA	NA	NA	NA
WP_043081982.1|1619256_1621116_+	bifunctional glutathionylspermidine amidase/synthase	NA	NA	NA	NA	NA
WP_043081984.1|1621251_1621587_+	multidrug DMT transporter	NA	NA	NA	NA	NA
WP_048253433.1|1621613_1622246_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_048253432.1|1622242_1623976_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048253431.1|1623968_1625537_-	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_106912791.1|1625538_1626345_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_169804721.1|1626341_1627112_-	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_048253428.1|1627108_1628350_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_048253427.1|1628658_1629321_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043081992.1|1629385_1629595_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_048253426.1|1630013_1631678_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_053075574.1|1631693_1643360_+	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	40.9	2.1e-54
WP_146144428.1|1643359_1643908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912792.1|1644264_1645427_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.9	1.9e-48
WP_048255371.1|1646091_1646694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146144429.1|1647202_1647805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146144430.1|1647804_1648131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048255373.1|1648171_1648405_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_081214714.1|1648541_1650419_+	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_048255375.1|1650427_1650751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015344990.1|1650845_1652054_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.3	2.8e-47
WP_020899217.1|1652669_1653185_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	47.9	5.4e-24
WP_023202702.1|1653500_1654478_+|integrase	site-specific integrase	integrase	A0A166YH27	Gordonia_phage	33.1	9.6e-06
WP_006785987.1|1654477_1656604_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_006785988.1|1656733_1657033_-	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_165612122.1|1657110_1659639_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.4	2.2e-134
WP_006785990.1|1659820_1660279_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_006785991.1|1660541_1660895_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.3	2.2e-21
WP_006785992.1|1660991_1662275_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	75.1	2.9e-175
1661366:1661381	attR	GCTGCTGGCGCTGGGC	NA	NA	NA	NA
WP_006785993.1|1662324_1662753_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	6.2e-50
WP_006785995.1|1662809_1663532_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.3	4.8e-95
WP_006785996.1|1663528_1663864_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023202698.1|1663912_1665145_-	MFS transporter	NA	NA	NA	NA	NA
WP_020899215.1|1665141_1665669_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.1	7.2e-16
WP_006786000.1|1665767_1666667_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006786002.1|1666860_1667301_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_023202697.1|1667342_1668617_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.0	4.4e-144
WP_006786005.1|1668666_1669701_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.2	8.9e-111
>prophage 5
NZ_LR699009	Pluralibacter gergoviae isolate MGYG-HGUT-02520 chromosome 1	5408082	2080210	2092046	5408082	transposase	Escherichia_phage(22.22%)	14	NA	NA
WP_048255148.1|2080210_2080408_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	47.7	7.1e-09
WP_045288114.1|2080404_2080620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048255150.1|2080616_2080805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048255153.1|2081012_2081363_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	64.3	2.4e-36
WP_048255154.1|2081355_2081727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912806.1|2081713_2084155_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	39.2	3.6e-142
WP_048255158.1|2084477_2084924_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_048255159.1|2085099_2085261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048255161.1|2085274_2085736_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.8	1.5e-62
WP_048255163.1|2085729_2086407_+	hypothetical protein	NA	Q2A0B2	Sodalis_phage	66.9	4.7e-52
WP_048255164.1|2086406_2087726_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	42.8	1.2e-35
WP_172626170.1|2087722_2090443_+	lytic transglycosylase domain-containing protein	NA	B9UDL1	Salmonella_phage	53.4	5.0e-169
WP_015344990.1|2090490_2091699_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.3	2.8e-47
WP_072065289.1|2091821_2092046_-	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	58.1	1.2e-17
>prophage 6
NZ_LR699009	Pluralibacter gergoviae isolate MGYG-HGUT-02520 chromosome 1	5408082	2827532	2837136	5408082	protease,tRNA	Dickeya_phage(16.67%)	9	NA	NA
WP_106912828.1|2827532_2828648_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	40.7	1.9e-10
WP_048252364.1|2828644_2830585_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.6	1.5e-34
WP_043084851.1|2830652_2830877_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	1.4e-16
WP_043084849.1|2831216_2831537_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	1.6e-13
WP_043084847.1|2831567_2833844_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.1e-164
WP_001040187.1|2834157_2834376_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048252367.1|2834644_2835349_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048252368.1|2835844_2836099_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048252369.1|2836095_2837136_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	24.3	2.1e-14
>prophage 7
NZ_LR699009	Pluralibacter gergoviae isolate MGYG-HGUT-02520 chromosome 1	5408082	2922793	2992493	5408082	capsid,tail,portal,bacteriocin,integrase,head,protease,terminase,holin	Enterobacteria_phage(37.78%)	75	2936182:2936198	2947382:2947398
WP_048252408.1|2922793_2924551_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_043086677.1|2924721_2925174_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_048252738.1|2925234_2926293_-	porin OmpA	NA	NA	NA	NA	NA
WP_043084736.1|2926649_2927147_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_043084735.1|2927362_2928031_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_048252410.1|2927972_2930108_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_045287976.1|2930126_2930573_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_106912830.1|2930697_2932752_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.7	2.2e-15
WP_043084730.1|2932758_2933217_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_048252412.1|2933376_2933790_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_043086676.1|2933832_2934150_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_045287974.1|2934214_2935405_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_043086675.1|2935498_2935780_+	acylphosphatase	NA	NA	NA	NA	NA
WP_045287973.1|2935776_2936106_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
2936182:2936198	attL	TTAGCGCGGGCGCGAAT	NA	NA	NA	NA
WP_043084726.1|2936197_2936857_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.5e-47
WP_043084725.1|2937130_2938756_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_072064804.1|2939090_2940011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048278547.1|2940003_2940330_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_098940279.1|2940343_2940967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098940277.1|2940955_2941993_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	48.5	3.1e-79
WP_072064808.1|2941976_2942210_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_106912831.1|2942278_2944387_-	exonuclease	NA	S4TNL0	Salmonella_phage	44.6	5.0e-100
WP_098940273.1|2944526_2944859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172626157.1|2945028_2945307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048286774.1|2945444_2945831_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	51.6	9.0e-32
WP_072065392.1|2945967_2946207_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	62.0	4.9e-20
WP_098940271.1|2946194_2946755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127626277.1|2946804_2947923_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	44.7	1.9e-45
2947382:2947398	attR	TTAGCGCGGGCGCGAAT	NA	NA	NA	NA
WP_127626276.1|2947834_2948380_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	73.5	6.0e-66
WP_098940267.1|2948393_2948825_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_098940265.1|2948827_2949151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912832.1|2949205_2950033_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	75.9	3.1e-106
WP_098940261.1|2950541_2950874_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	49.1	3.1e-25
WP_043086671.1|2951499_2951733_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	70.1	2.9e-25
WP_043084705.1|2951776_2952019_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	65.2	5.8e-21
WP_098940942.1|2952361_2952739_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	64.8	1.4e-45
WP_098940257.1|2952738_2953776_+	DUF968 domain-containing protein	NA	A0A0P0ZD76	Stx2-converting_phage	53.3	5.6e-105
WP_098940255.1|2953788_2954388_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	64.0	1.9e-73
WP_052682745.1|2954970_2955357_+	helix-turn-helix transcriptional regulator	NA	D0R0F8	Streptococcus_phage	34.7	8.2e-09
WP_043084700.1|2956002_2956251_+|holin	class II holin family protein	holin	A0A127KNH9	Pseudomonas_phage	36.7	3.2e-06
WP_045290447.1|2956252_2956786_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	83.0	3.4e-82
WP_106912833.1|2956993_2957332_+	Rz1 lytic protein	NA	Q8SBD8	Shigella_phage	74.5	5.2e-36
WP_048272917.1|2957786_2958125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098940251.1|2958111_2958531_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	58.7	5.0e-36
WP_106912834.1|2958783_2959290_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	48.1	1.3e-33
WP_106912835.1|2959261_2961184_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	89.2	0.0e+00
WP_048272924.1|2961183_2961390_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	92.5	6.0e-27
WP_106912836.1|2961386_2962979_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	89.4	1.8e-283
WP_106912837.1|2962959_2964297_+	S49 family peptidase	NA	O64320	Escherichia_phage	76.3	5.4e-177
WP_106912838.1|2964306_2964639_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	77.3	1.5e-43
WP_048281069.1|2964717_2965743_+|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	91.2	2.4e-177
WP_106912839.1|2965794_2966181_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	45.0	5.6e-18
WP_106912840.1|2966192_2966546_+|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	62.4	9.6e-41
WP_080966862.1|2966554_2967136_+|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	70.1	3.1e-68
WP_048281072.1|2967132_2967531_+|tail	tail protein	tail	K7P7G5	Enterobacteria_phage	72.0	7.8e-55
WP_106912841.1|2967538_2968282_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	81.8	2.2e-111
WP_106912842.1|2968293_2968716_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	50.7	9.2e-30
WP_106912843.1|2968736_2969051_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	76.0	1.5e-40
WP_106912844.1|2969034_2972244_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	47.0	4.9e-216
WP_106912845.1|2972248_2972596_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	66.1	4.9e-37
WP_106912846.1|2972592_2973348_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	83.7	1.0e-127
WP_106912847.1|2973349_2974060_+	C40 family peptidase	NA	K7P6F5	Enterobacteria_phage	86.0	2.9e-129
WP_106912848.1|2974094_2974511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106912849.1|2974557_2975157_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	65.3	1.5e-62
WP_106912850.1|2975210_2983598_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	59.1	0.0e+00
WP_172626158.1|2983656_2984691_+|tail	tail fiber domain-containing protein	tail	A0A0D4D9I5	Escherichia_phage	32.1	3.3e-20
WP_106912852.1|2984685_2984946_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_155409054.1|2984983_2985157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106913027.1|2985396_2985816_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	9.4e-35
WP_106912853.1|2985815_2987081_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	78.9	4.8e-199
WP_139625923.1|2987852_2988101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053075541.1|2988433_2989669_+	hypothetical protein	NA	A0A1Z1LYP4	Serratia_phage	41.1	1.8e-09
WP_048252415.1|2989682_2990216_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	34.7	1.2e-07
WP_053075542.1|2990557_2992246_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_072065252.1|2992238_2992493_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 8
NZ_LR699009	Pluralibacter gergoviae isolate MGYG-HGUT-02520 chromosome 1	5408082	3308130	3314975	5408082	integrase,tRNA	Escherichia_phage(66.67%)	9	3297728:3297742	3317961:3317975
3297728:3297742	attL	GCTGCGCCAGCGCGC	NA	NA	NA	NA
WP_048252561.1|3308130_3309270_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	2.6e-10
WP_043084276.1|3309468_3310452_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_155407593.1|3310717_3310864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048252562.1|3310914_3311850_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.9	1.2e-141
WP_048252563.1|3311899_3313138_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	70.0	3.2e-171
WP_043084270.1|3313140_3313356_-	excisionase family protein	NA	A0A0U2RY08	Escherichia_phage	67.6	3.9e-21
WP_043084268.1|3313417_3313621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080732726.1|3313679_3314144_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	60.0	7.4e-41
WP_080964490.1|3314528_3314975_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	55.6	4.8e-45
3317961:3317975	attR	GCGCGCTGGCGCAGC	NA	NA	NA	NA
>prophage 9
NZ_LR699009	Pluralibacter gergoviae isolate MGYG-HGUT-02520 chromosome 1	5408082	3761171	3802185	5408082	transposase,plate	uncultured_virus(14.29%)	33	NA	NA
WP_048255363.1|3761171_3761621_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_048255367.1|3762336_3763545_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.2	7.9e-50
WP_146144443.1|3763743_3764355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053074694.1|3764460_3764709_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_053075269.1|3765050_3765824_-	immunity 52 family protein	NA	NA	NA	NA	NA
WP_106912869.1|3765820_3766573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106912870.1|3766572_3766917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172626160.1|3766910_3767414_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_064360644.1|3768872_3769565_-	immunity 52 family protein	NA	NA	NA	NA	NA
WP_073971316.1|3769577_3770243_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	34.1	5.3e-08
WP_048255354.1|3770235_3770589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146144444.1|3770610_3771120_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_048255295.1|3773442_3773967_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_048255299.1|3774001_3775084_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_048255301.1|3775047_3776817_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_048255303.1|3778530_3778896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048255306.1|3779168_3782543_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_048255309.1|3782535_3783744_-	membrane protein	NA	NA	NA	NA	NA
WP_072051361.1|3783746_3784010_-	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	48.0	7.5e-06
WP_048255307.1|3784072_3784474_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_146144445.1|3784572_3785097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146144446.1|3786162_3786993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172626161.1|3787000_3787336_-	hypothetical protein	NA	A0A1J0MFB0	Staphylococcus_phage	69.7	3.9e-07
WP_032216024.1|3787317_3788298_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
WP_146144447.1|3788338_3791113_-	glucosaminidase domain-containing protein	NA	A0EX80	Staphylococcus_virus	38.2	4.1e-17
WP_048255341.1|3791113_3791584_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_048255343.1|3791915_3794273_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_048255344.1|3794303_3795128_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_106912872.1|3795182_3797810_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.3	5.1e-94
WP_043083724.1|3797973_3798465_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_064360885.1|3798470_3800141_-	OmpA family protein	NA	NA	NA	NA	NA
WP_048255380.1|3800140_3800839_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_048255382.1|3800835_3802185_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 10
NZ_LR699009	Pluralibacter gergoviae isolate MGYG-HGUT-02520 chromosome 1	5408082	4452357	4464990	5408082		Enterobacteria_phage(33.33%)	9	NA	NA
WP_106912956.1|4452357_4453239_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.1	9.6e-106
WP_106912957.1|4453295_4454195_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.6	4.7e-31
WP_106913041.1|4454194_4455280_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.2	1.2e-97
WP_048285298.1|4455685_4457056_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.3	3.9e-29
WP_106912958.1|4457078_4458494_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.1	1.3e-51
WP_106912959.1|4459219_4460626_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	5.6e-39
WP_106912960.1|4460859_4462026_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	4.5e-111
WP_106912961.1|4462181_4463552_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.1	5.6e-28
WP_106912962.1|4463574_4464990_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.7	3.1e-53
>prophage 11
NZ_LR699009	Pluralibacter gergoviae isolate MGYG-HGUT-02520 chromosome 1	5408082	4993172	5043975	5408082	tail,plate,tRNA	Escherichia_phage(30.3%)	54	NA	NA
WP_045287232.1|4993172_4993910_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_043082485.1|4994041_4995376_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.1	7.4e-41
WP_043082484.1|4995424_4995808_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	1.6e-33
WP_043082483.1|4996120_4996810_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	5.5e-56
WP_043082481.1|4996849_4997896_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_086498968.1|4997892_4998045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043082480.1|4998103_4998529_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	38.4	6.6e-12
WP_048254436.1|4998599_4999298_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_043082478.1|4999328_5001971_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_048254434.1|5002088_5003444_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_043082476.1|5003474_5003798_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_045287238.1|5003798_5005097_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.5	1.4e-41
WP_043082474.1|5010862_5013436_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.1	3.8e-126
WP_048253268.1|5013565_5014297_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_043082472.1|5014293_5015274_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_043082471.1|5015406_5016150_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_043082470.1|5016421_5016763_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_106913046.1|5016885_5016933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048253269.1|5017030_5018191_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_048253270.1|5018187_5019060_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_043082467.1|5019258_5020380_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_043082466.1|5020389_5021460_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0B6VT43	Edwardsiella_phage	51.8	1.3e-91
WP_048253271.1|5021669_5023019_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_048253272.1|5023075_5023501_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_048253273.1|5023869_5025081_+	oxalate decarboxylase family bicupin	NA	NA	NA	NA	NA
WP_043082462.1|5025130_5025979_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	58.6	1.3e-91
WP_048253274.1|5026207_5026546_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	46.8	1.3e-21
WP_043082460.1|5026613_5026826_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_048253275.1|5026825_5027050_+	TraR/DksA C4-type zinc finger protein	NA	Q6K1F5	Salmonella_virus	60.6	3.0e-16
WP_048253416.1|5027049_5029002_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	57.8	4.2e-218
WP_043082458.1|5029136_5029319_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	76.7	6.3e-20
WP_048253276.1|5029474_5029678_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	70.1	2.2e-21
WP_043082456.1|5029668_5029875_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	65.6	2.8e-16
WP_048253277.1|5029871_5030381_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	68.0	7.6e-63
WP_048253278.1|5030377_5030803_+	hypothetical protein	NA	O80310	Escherichia_phage	46.0	1.1e-22
WP_048253279.1|5030777_5030915_+	hypothetical protein	NA	A0A0F7LCN5	Escherichia_phage	71.1	6.8e-11
WP_048253280.1|5030898_5031366_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	51.6	9.2e-39
WP_048253281.1|5031443_5032079_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	72.5	9.7e-84
WP_043082450.1|5032075_5032423_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	71.3	5.2e-39
WP_048253282.1|5032426_5033335_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	77.2	1.5e-125
WP_048253417.1|5033327_5033858_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	76.1	2.1e-79
WP_080965688.1|5033869_5035561_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	48.9	9.1e-129
WP_072065271.1|5035573_5035990_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	48.6	1.1e-27
WP_048253283.1|5036301_5037492_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	82.5	3.9e-195
WP_043082447.1|5037504_5038023_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	90.1	2.0e-87
WP_048253284.1|5038081_5038363_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	71.3	9.7e-28
WP_072065272.1|5038395_5038515_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	82.1	4.1e-12
WP_053075571.1|5038507_5040157_+	hypothetical protein	NA	Q6K1G6	Salmonella_virus	31.6	1.2e-21
WP_053075572.1|5040176_5040626_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	57.0	5.9e-43
WP_053075573.1|5040625_5041792_+	hypothetical protein	NA	A0A218M4J7	Erwinia_phage	46.2	2.7e-87
WP_048253285.1|5041878_5042067_+	ogr/Delta-like zinc finger family protein	NA	Q37973	Salmonella_virus	76.4	8.5e-20
WP_043082441.1|5042119_5042617_-	SHOCT domain-containing protein	NA	A0A1D9C9Q4	Salinivibrio_phage	54.8	3.2e-42
WP_043086447.1|5042818_5043166_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_043082440.1|5043207_5043975_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 12
NZ_LR699009	Pluralibacter gergoviae isolate MGYG-HGUT-02520 chromosome 1	5408082	5318307	5372293	5408082	tRNA,transposase,holin,integrase	Vibrio_phage(10.53%)	50	5349080:5349102	5369106:5369128
WP_043082150.1|5318307_5320305_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.3	2.6e-21
WP_048254118.1|5320442_5321525_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_086499150.1|5321703_5322273_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_048254097.1|5322276_5322915_+	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_048254096.1|5322983_5323976_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048254117.1|5323972_5324860_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043082146.1|5325075_5326560_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_048254095.1|5326569_5327181_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_043082144.1|5327177_5327897_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_048254094.1|5327947_5331055_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	61.0	0.0e+00
WP_048254093.1|5331258_5332323_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	48.7	2.1e-75
WP_048254092.1|5332328_5332679_-	VOC family protein	NA	NA	NA	NA	NA
WP_048254091.1|5332868_5333351_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.7	7.3e-23
WP_048254090.1|5333392_5333932_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048254089.1|5334047_5335115_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_048254088.1|5335213_5336116_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023137339.1|5336435_5337476_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	87.6	6.7e-183
WP_043082133.1|5337664_5338015_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_072065305.1|5338008_5338473_-	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	34.4	2.2e-08
WP_008815334.1|5339280_5339745_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048254087.1|5339984_5340482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008815336.1|5340531_5341380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008815337.1|5341393_5341954_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.6	1.4e-22
WP_139554733.1|5342163_5342529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048254085.1|5343723_5344296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053075600.1|5344398_5344950_+	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	35.0	6.6e-20
WP_048254084.1|5345303_5345630_+	NIPSNAP family containing protein	NA	NA	NA	NA	NA
WP_063613488.1|5345717_5346875_-	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_048254083.1|5347037_5348990_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	24.5	1.7e-09
5349080:5349102	attL	TGGAGCGGGCGAAGGGAATCGAA	NA	NA	NA	NA
WP_016154338.1|5349404_5349695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016154339.1|5349913_5351035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072065304.1|5351136_5351547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096913407.1|5351620_5352822_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	82.2	4.3e-141
WP_048254082.1|5353210_5353774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048254081.1|5354388_5355030_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	35.3	5.7e-31
WP_072065302.1|5355022_5356642_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_106913010.1|5357004_5357364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045350890.1|5357356_5357899_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_052686670.1|5357942_5358128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045350892.1|5358382_5358841_-	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	35.6	2.3e-18
WP_045350894.1|5359579_5360191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045350896.1|5360747_5361887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106913048.1|5362279_5365054_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.4	1.1e-296
WP_106913012.1|5365066_5365693_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.2	1.0e-24
WP_106913013.1|5365689_5366118_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	54.0	3.9e-28
WP_048241341.1|5366117_5366315_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	45.3	3.0e-07
WP_049120599.1|5367726_5368941_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.9	5.0e-145
WP_048254079.1|5369261_5369966_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A075BS18	Microcystis_phage	29.6	1.6e-07
5369106:5369128	attR	TGGAGCGGGCGAAGGGAATCGAA	NA	NA	NA	NA
WP_043082131.1|5370185_5370719_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_043082130.1|5370775_5372293_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	1.1e-85
