The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR698992	Laribacter hongkongensis isolate MGYG-HGUT-02398 chromosome 1	3424272	878170	948972	3424272	terminase,transposase,capsid,head,portal,tail,integrase	Acidithiobacillus_phage(38.1%)	81	875219:875234	909966:909981
875219:875234	attL	CAAGGTCTGCATCCTT	NA	NA	NA	NA
WP_088861895.1|878170_879388_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	54.4	1.3e-116
WP_088861896.1|879850_880090_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088860256.1|880073_880445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860257.1|880612_880894_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	39.7	1.6e-09
WP_001389365.1|880958_881723_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_063840321.1|882245_882800_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_043876060.1|882974_883307_+	quaternary ammonium compound efflux SMR transporter QacF	NA	E5E3Y9	Acinetobacter_phage	34.3	2.7e-08
WP_001261740.1|883380_884172_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|884335_884683_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259026.1|884676_885648_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_000214125.1|885864_887079_+	chloramphenicol/florfenicol efflux MFS transporter FloR2	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
WP_000163574.1|887285_887912_-	tetracycline resistance transcriptional repressor TetR(G)	NA	NA	NA	NA	NA
WP_001257840.1|888015_889191_+	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
WP_001253717.1|889211_890003_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001747814.1|890094_891627_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001749986.1|892679_893132_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_032084013.1|893267_893741_+	trimethoprim-resistant dihydrofolate reductase DfrA32	NA	A0A1B2IBQ4	Erwinia_phage	33.1	6.5e-16
WP_032084014.1|893933_895154_+	EreA family erythromycin esterase	NA	NA	NA	NA	NA
WP_000679427.1|895337_895685_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|895678_896518_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|896645_897146_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|897652_898417_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_010792470.1|898664_899654_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003090697.1|899650_899887_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003090698.1|899883_900249_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_088860258.1|900897_901710_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.9	3.4e-33
WP_088860259.1|901699_903214_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_000732290.1|904534_904810_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294666.1|904825_905176_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000414383.1|905247_905682_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_088860260.1|906130_907456_+	McrC family protein	NA	NA	NA	NA	NA
WP_088860261.1|907483_909277_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_088860262.1|909263_909512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860263.1|909480_910461_-	hypothetical protein	NA	NA	NA	NA	NA
909966:909981	attR	CAAGGTCTGCATCCTT	NA	NA	NA	NA
WP_088860264.1|910457_910739_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_088860265.1|910942_911410_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	78.2	1.0e-61
WP_088860266.1|911406_911883_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	93.0	3.5e-78
WP_088860267.1|911879_912191_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	70.2	2.2e-25
WP_172622946.1|912285_914577_-|tail	phage tail protein	tail	A5A3R1	Burkholderia_phage	36.3	4.0e-127
WP_088860268.1|914573_914990_-	C40 family peptidase	NA	A5A3R0	Burkholderia_phage	33.6	2.0e-16
WP_088860269.1|914986_915529_-	DUF1833 family protein	NA	A0A0B5A6T7	Achromobacter_phage	51.4	2.3e-41
WP_088860270.1|915528_917175_-	hypothetical protein	NA	E5ERA2	Bathycoccus_sp._RCC1105_virus	35.4	2.3e-28
WP_088860271.1|917217_918876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860272.1|918872_919511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860273.1|919526_920021_-	hypothetical protein	NA	B5WZT5	Pseudomonas_phage	42.6	5.0e-19
WP_088860274.1|920017_922639_-	hypothetical protein	NA	A0A0U2BXT9	Paracoccus_phage	32.7	6.7e-30
WP_088860275.1|922675_922891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860276.1|922974_923325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860277.1|923345_924284_-	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	50.0	2.8e-79
WP_147640088.1|924331_924763_-	acyl-CoA transferase	NA	G8DH50	Emiliania_huxleyi_virus	41.8	4.8e-26
WP_088860279.1|924759_925422_-	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	42.9	1.2e-39
WP_147640090.1|925429_925738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860281.1|925746_926769_-|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	58.2	7.5e-110
WP_088860282.1|926846_927224_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	51.2	1.4e-26
WP_088860283.1|927227_928496_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	41.1	3.1e-65
WP_088860284.1|928492_930031_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	56.7	7.2e-149
WP_088860285.1|930030_930240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860286.1|930239_932213_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	77.4	5.7e-308
WP_088860287.1|932215_932809_-	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	61.4	2.7e-51
WP_088860288.1|932969_933179_+	hypothetical protein	NA	A0A1X9I6B9	Streptococcus_phage	48.2	3.7e-08
WP_088860289.1|933189_933669_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	60.6	7.7e-25
WP_088860290.1|933683_934043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860291.1|934146_934512_+	hypothetical protein	NA	K4ICP1	Acidithiobacillus_phage	80.0	2.5e-52
WP_088860292.1|934475_934724_-	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	72.7	5.0e-20
WP_088860293.1|934720_936007_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	80.0	2.0e-197
WP_088860294.1|935999_937406_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	58.6	2.0e-158
WP_088860295.1|937845_938235_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_088860296.1|938227_938437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860297.1|938438_938912_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	77.1	6.6e-61
WP_088860298.1|939052_941347_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	71.7	0.0e+00
WP_088860299.1|941339_941936_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7RW72	Vibrio_phage	63.8	7.7e-06
WP_088860301.1|942137_942872_-	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	75.1	7.2e-107
WP_088860302.1|942868_943369_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	76.4	4.8e-70
WP_088861898.1|943365_944223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860303.1|944234_944861_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	70.2	4.5e-81
WP_088860304.1|944866_945715_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	68.1	2.5e-103
WP_088861899.1|945711_946194_-	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	52.3	5.0e-40
WP_088860305.1|946204_946516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860306.1|946673_947150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860307.1|947146_948514_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	60.7	7.6e-150
WP_088860308.1|948510_948972_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	57.2	6.1e-35
>prophage 2
NZ_LR698992	Laribacter hongkongensis isolate MGYG-HGUT-02398 chromosome 1	3424272	966085	1001265	3424272	terminase,capsid,head,portal	Acidithiobacillus_phage(35.29%)	44	NA	NA
WP_088860319.1|966085_966586_-	hypothetical protein	NA	A4PE37	Ralstonia_virus	50.6	1.5e-26
WP_088860320.1|966582_967092_-	lysozyme	NA	A0A1I9L2C4	Xanthomonas_phage	38.5	2.0e-18
WP_088860321.1|967088_967316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860322.1|967312_967615_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	65.3	1.2e-26
WP_088860323.1|967678_968032_-	DUF2793 domain-containing protein	NA	A0A2H4GY35	Pseudomonas_phage	59.0	7.4e-33
WP_088860324.1|968047_970270_-	hypothetical protein	NA	A0A1L2C8W7	Pseudomonas_phage	45.2	1.9e-174
WP_087778747.1|970266_970506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009521773.1|970502_970733_-	hypothetical protein	NA	A0A0S0N2N8	Pseudomonas_phage	50.7	7.2e-13
WP_088860325.1|970742_971546_-	phage BR0599 family protein	NA	A0A2D2W238	Stenotrophomonas_phage	39.3	1.2e-51
WP_088860326.1|971542_973225_-	hypothetical protein	NA	A0A0N9ERB2	Pseudomonas_phage	32.8	2.7e-56
WP_088860327.1|973225_974368_-	hypothetical protein	NA	A0A0S0MVP2	Pseudomonas_phage	28.0	7.5e-18
WP_088860328.1|974377_975349_-	hypothetical protein	NA	I6NTN2	Burkholderia_phage	27.7	5.0e-23
WP_088860329.1|975351_978546_-	tape measure protein	NA	A0A125RNI9	Pseudomonas_phage	28.8	2.6e-39
WP_088860330.1|978549_979197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860331.1|979386_979776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053243730.1|979786_980539_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	49.6	1.0e-55
WP_172622947.1|980541_980715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053243729.1|980721_981147_-	hypothetical protein	NA	D6PGA7	uncultured_phage	31.9	3.3e-11
WP_009521784.1|981158_981443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053243728.1|981442_982453_-|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	67.0	4.2e-113
WP_088860332.1|982455_982836_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	51.2	1.9e-26
WP_088860333.1|982837_984073_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	43.0	1.4e-65
WP_088860334.1|984082_985594_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	56.7	2.0e-151
WP_009521789.1|985593_985800_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	91.2	9.6e-25
WP_088861901.1|985807_987778_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	90.5	0.0e+00
WP_088860335.1|987780_988308_-	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	96.6	4.1e-88
WP_088860336.1|988414_988684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860337.1|988766_989294_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	96.9	1.8e-27
WP_088860338.1|989395_989755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860339.1|989853_990222_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	88.5	3.1e-58
WP_088860340.1|990185_991457_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	93.4	4.3e-232
WP_088861902.1|991453_992875_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	60.3	3.3e-164
WP_088860341.1|993191_993620_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_088860342.1|993612_993816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860343.1|993817_994282_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	71.1	1.9e-57
WP_088860344.1|994422_996702_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	64.7	1.1e-291
WP_088860345.1|996698_996953_-	hypothetical protein	NA	K4I1D6	Acidithiobacillus_phage	73.4	6.7e-20
WP_088860346.1|996949_997687_-	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	77.0	1.9e-110
WP_088860347.1|997683_998172_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	78.6	1.1e-71
WP_088860348.1|998168_999023_-	hypothetical protein	NA	A0A0S2SYC0	Pseudomonas_phage	45.8	5.2e-24
WP_088860349.1|999033_999666_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	72.1	2.2e-80
WP_088860350.1|999671_1000511_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	70.5	3.0e-109
WP_088860351.1|1000507_1000990_-	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	64.5	1.1e-52
WP_088860352.1|1001001_1001265_-	helix-turn-helix domain-containing protein	NA	K4I3X3	Acidithiobacillus_phage	77.0	8.2e-29
>prophage 3
NZ_LR698992	Laribacter hongkongensis isolate MGYG-HGUT-02398 chromosome 1	3424272	1005534	1013222	3424272		Acidithiobacillus_phage(83.33%)	10	NA	NA
WP_088860356.1|1005534_1005729_+	hypothetical protein	NA	K4HZ94	Acidithiobacillus_phage	73.0	1.7e-15
WP_088860357.1|1005725_1006178_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	84.1	6.5e-66
WP_088860358.1|1006174_1007563_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	86.2	7.0e-228
WP_088860359.1|1007562_1007934_+	site-specific recombinase resolvase	NA	K4HZX2	Acidithiobacillus_phage	70.0	5.9e-41
WP_088860360.1|1007930_1008410_+	LacI family transcriptional regulator	NA	K4I1C7	Acidithiobacillus_phage	47.4	5.2e-29
WP_088860361.1|1009113_1009776_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_147640094.1|1009970_1010447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860363.1|1010640_1010871_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_088860364.1|1010867_1011146_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_088860365.1|1011272_1013222_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	43.4	5.9e-63
>prophage 4
NZ_LR698992	Laribacter hongkongensis isolate MGYG-HGUT-02398 chromosome 1	3424272	1265620	1357325	3424272	protease,terminase,transposase,capsid,head,tail,integrase,tRNA,plate	uncultured_Caudovirales_phage(22.45%)	99	1265445:1265464	1317358:1317377
1265445:1265464	attL	TGTTCTGGCGGAGAGAGGGG	NA	NA	NA	NA
WP_088860514.1|1265620_1266865_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	30.0	3.6e-42
WP_088860515.1|1266827_1267568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860516.1|1267601_1268693_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_088860517.1|1268840_1269047_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_088861916.1|1269702_1269813_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161493492.1|1270555_1273450_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_088860519.1|1273679_1274633_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	41.9	1.1e-54
WP_088860520.1|1274749_1275115_+	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_088860521.1|1275249_1276233_+	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	38.4	7.1e-49
WP_088861874.1|1277094_1277493_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J5G9	uncultured_Caudovirales_phage	33.7	5.6e-05
WP_088860522.1|1277655_1278219_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_088860523.1|1278299_1278746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860524.1|1278819_1279080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088861917.1|1279159_1279777_+	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_088860525.1|1280082_1280832_-	helix-turn-helix transcriptional regulator	NA	A0SML1	Pseudomonas_virus	35.1	6.0e-32
WP_088860526.1|1281018_1281321_+	helix-turn-helix domain-containing protein	NA	F6MII4	Haemophilus_phage	63.9	7.5e-18
WP_088860527.1|1281382_1281856_+	hypothetical protein	NA	Q6QID6	Burkholderia_phage	36.6	2.6e-17
WP_161493493.1|1281900_1284021_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	F6MII5	Haemophilus_phage	40.4	4.8e-111
WP_088860529.1|1284078_1284822_+	ATP-binding protein	NA	A0A0A1IVZ3	Pseudomonas_phage	54.6	1.9e-62
WP_088860530.1|1284835_1285474_+	hypothetical protein	NA	A0A1B0T6M0	Pelagibaca_phage	40.9	9.0e-29
WP_088860531.1|1285460_1285793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860532.1|1285789_1286092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860533.1|1286088_1286409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860534.1|1286405_1286969_+	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	48.1	1.9e-30
WP_088860535.1|1286965_1287586_+	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	63.0	5.1e-69
WP_147640119.1|1287692_1288202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860537.1|1288272_1288965_+	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	45.5	2.7e-39
WP_088860538.1|1289023_1289419_+	regulatory protein GemA	NA	A0A0M5MRZ7	Ralstonia_phage	60.8	8.9e-35
WP_088861918.1|1289429_1289852_+	DNA transposition protein	NA	A0A0A1IWZ1	Pseudomonas_phage	36.7	5.6e-19
WP_147640121.1|1289864_1290515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860540.1|1290601_1291123_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	53.1	3.3e-45
WP_088860541.1|1291128_1291356_+	hypothetical protein	NA	A0A0M4UKB4	Ralstonia_phage	54.1	1.0e-11
WP_161493494.1|1291352_1291931_+	hypothetical protein	NA	A4JWP5	Burkholderia_virus	41.4	3.2e-25
WP_088860543.1|1291923_1292154_+	TraR/DksA C4-type zinc finger protein	NA	A0A0M4UVB2	Ralstonia_phage	48.3	3.8e-06
WP_088860544.1|1292150_1292393_+	DUF2746 domain-containing protein	NA	NA	NA	NA	NA
WP_088860545.1|1292405_1292627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860546.1|1292626_1293127_+	DUF1804 family protein	NA	A0A1C6ZDN3	Pseudomonas_phage	68.7	1.4e-56
WP_088860547.1|1293127_1293412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860548.1|1293432_1295052_+|terminase	phage terminase large subunit	terminase	H1ZZE1	Pseudomonas_virus	67.9	9.4e-224
WP_088860549.1|1295057_1296650_+	DUF935 domain-containing protein	NA	L7P7P3	Pseudomonas_phage	55.0	5.2e-158
WP_088860550.1|1296642_1297917_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	47.2	6.1e-69
WP_088860551.1|1298016_1298502_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	38.0	4.3e-15
WP_088860552.1|1298718_1299792_+|protease	phage protease	protease	A0A0M5N0Q6	Ralstonia_phage	44.4	1.7e-64
WP_088860553.1|1299795_1300200_+	hypothetical protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	60.5	3.4e-34
WP_088861769.1|1300211_1301120_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	71.2	2.8e-124
WP_088860554.1|1301122_1301347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860555.1|1301349_1301766_+	DUF1320 family protein	NA	B7SDP4	Haemophilus_phage	42.1	1.0e-20
WP_088860556.1|1301765_1302434_+	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	37.9	8.8e-19
WP_088860557.1|1302430_1302637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860558.1|1302639_1304061_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	45.0	6.5e-96
WP_088860559.1|1304077_1304464_+	hypothetical protein	NA	A0A2H4J3Y5	uncultured_Caudovirales_phage	61.6	3.5e-36
WP_088860560.1|1304474_1304846_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_088860561.1|1304850_1305234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161493495.1|1305534_1305732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161493496.1|1305756_1307487_+|tail	phage tail tape measure protein	tail	B5TAA4	Burkholderia_phage	32.8	4.6e-51
WP_088860563.1|1307486_1308767_+	DNA circularization protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	28.7	2.5e-38
WP_088860564.1|1308750_1309863_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	44.9	2.1e-89
WP_088860565.1|1309846_1310455_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	44.0	4.7e-35
WP_147640123.1|1310620_1311058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860567.1|1311115_1311469_+	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	60.0	1.0e-29
WP_172622950.1|1311468_1312533_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	47.6	1.4e-79
WP_088860568.1|1312529_1313108_+	DUF2313 domain-containing protein	NA	A0A2H4J9D6	uncultured_Caudovirales_phage	37.0	6.3e-21
WP_088860569.1|1313104_1314253_+	hypothetical protein	NA	A0A0M3LRW6	Mannheimia_phage	45.9	8.4e-09
WP_088861920.1|1314540_1315011_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_088860570.1|1315153_1315339_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	62.2	2.7e-10
WP_172622951.1|1315313_1315463_+	hypothetical protein	NA	A4JWM0	Burkholderia_virus	56.5	2.2e-10
WP_088860571.1|1315459_1316587_+	ABC transporter ATP-binding protein	NA	A4JWM1	Burkholderia_virus	75.0	3.1e-165
WP_088860572.1|1316574_1317198_+|tRNA	methionyl-tRNA formyltransferase	tRNA	A4JWM2	Burkholderia_virus	60.4	2.0e-65
WP_012696660.1|1317751_1318717_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1317358:1317377	attR	TGTTCTGGCGGAGAGAGGGG	NA	NA	NA	NA
WP_012696661.1|1318724_1319543_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012696662.1|1319554_1320346_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	4.8e-32
WP_161493497.1|1320444_1322265_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_088861921.1|1322267_1322630_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
WP_088860574.1|1322622_1323960_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_088860575.1|1324180_1324969_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	3.6e-19
WP_088860576.1|1324961_1325933_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_161493498.1|1325933_1326722_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_088861922.1|1326714_1327761_-	hemin-degrading factor	NA	NA	NA	NA	NA
WP_088860578.1|1327895_1330070_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_012696672.1|1330126_1330288_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_088860579.1|1330459_1331818_+	heme anaerobic degradation radical SAM methyltransferase ChuW/HutW	NA	NA	NA	NA	NA
WP_088860580.1|1331814_1332345_+	heme utilization cystosolic carrier protein HutX	NA	NA	NA	NA	NA
WP_088860581.1|1332329_1332956_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_012696677.1|1333043_1333724_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_088860582.1|1333737_1334640_+	4-deoxy-4-formamido-L-arabinose- phosphoundecaprenol deformylase	NA	NA	NA	NA	NA
WP_088860583.1|1334770_1336735_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.7	2.8e-20
WP_088860584.1|1336721_1340372_-	exodeoxyribonuclease V subunit beta	NA	A0A068EQC7	Bacillus_phage	21.9	1.0e-07
WP_101929043.1|1340368_1343848_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_088860585.1|1344321_1345320_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_012696684.1|1345352_1346396_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_088860586.1|1346504_1347275_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_012696686.1|1347276_1347660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860587.1|1348479_1350144_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_012696689.1|1350179_1351055_-	NAD kinase	NA	NA	NA	NA	NA
WP_088860588.1|1351102_1352584_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.6	1.3e-17
WP_088860589.1|1352883_1353858_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_027824508.1|1353907_1354555_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_088860590.1|1354679_1355708_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_101929058.1|1355888_1357325_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.5	4.5e-20
>prophage 5
NZ_LR698992	Laribacter hongkongensis isolate MGYG-HGUT-02398 chromosome 1	3424272	1387773	1492420	3424272	terminase,holin,transposase,capsid,head,tail,integrase,tRNA,plate	Burkholderia_phage(16.28%)	100	1412734:1412758	1449973:1449997
WP_088860612.1|1387773_1388550_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_088860613.1|1388558_1389194_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_012696728.1|1389180_1390380_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_088860614.1|1390387_1391182_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_012696730.1|1391247_1392117_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_088860615.1|1392249_1393779_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_147640127.1|1393967_1394180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860616.1|1394244_1396413_+	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	27.5	5.2e-20
WP_012696734.1|1396409_1397873_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_088860617.1|1397874_1398471_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_172623000.1|1398959_1400633_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_027824491.1|1400632_1400944_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_088860619.1|1401296_1402196_+	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	42.4	5.7e-53
WP_088860620.1|1402393_1403842_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.8	7.6e-100
WP_161493500.1|1404298_1405153_+	phosphoesterase	NA	A0A2K9L3N0	Tupanvirus	33.6	2.2e-38
WP_101929044.1|1405207_1405471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860622.1|1405542_1407462_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.4	3.1e-64
WP_027824486.1|1407507_1408107_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_088860623.1|1408130_1409726_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.1	1.9e-96
WP_012696747.1|1409901_1411545_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_088860624.1|1411597_1412515_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
1412734:1412758	attL	CAAAGCCCTGATTATTCAGGGCTTT	NA	NA	NA	NA
WP_161493501.1|1412929_1413496_-	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_088860626.1|1413608_1414043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147640129.1|1414143_1414455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147640058.1|1414474_1414807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861874.1|1414940_1415339_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J5G9	uncultured_Caudovirales_phage	33.7	5.6e-05
WP_088860521.1|1416200_1417184_-	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	38.4	7.1e-49
WP_088860628.1|1417318_1417678_-	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_088860629.1|1417794_1418748_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	41.8	3.8e-55
WP_147640130.1|1419671_1420115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161493502.1|1420313_1420883_-	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_088860631.1|1420867_1421575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860632.1|1421750_1421927_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_147640132.1|1421985_1422393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161493503.1|1422401_1422560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860634.1|1423785_1424520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860635.1|1424529_1427517_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	40.9	9.2e-209
WP_088860636.1|1427516_1428701_-	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	39.4	3.0e-25
WP_088860637.1|1428690_1430367_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	22.2	3.7e-13
WP_088860638.1|1430363_1432268_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_172622952.1|1432264_1433776_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	57.7	8.7e-139
WP_088860639.1|1433775_1434153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860640.1|1434149_1435652_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	55.7	1.0e-147
WP_088860641.1|1436059_1436368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147640136.1|1436283_1436691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172623001.1|1436699_1437209_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_172622953.1|1443539_1445273_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	31.8	8.4e-45
WP_088860644.1|1445768_1446449_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_088860645.1|1446990_1447173_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_147640138.1|1447618_1448536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860647.1|1448571_1449783_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	37.6	2.0e-53
WP_147640140.1|1450432_1451746_+	hypothetical protein	NA	NA	NA	NA	NA
1449973:1449997	attR	CAAAGCCCTGATTATTCAGGGCTTT	NA	NA	NA	NA
WP_088860648.1|1454149_1455916_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	61.6	1.9e-214
WP_088860649.1|1456063_1456882_+|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	49.5	2.5e-60
WP_088860650.1|1456894_1457914_+|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	63.2	5.5e-121
WP_088860651.1|1457913_1458582_+|terminase	terminase endonuclease subunit	terminase	A4JWP8	Burkholderia_virus	55.7	1.9e-53
WP_088860652.1|1458669_1459146_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	52.3	2.0e-33
WP_172622954.1|1459145_1459352_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	61.8	4.3e-17
WP_088860654.1|1459354_1459726_+|holin	phage holin family protein	holin	A0A1S5NRL1	Burkholderia_phage	50.4	1.5e-20
WP_088860655.1|1459725_1460049_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_088860656.1|1460039_1460843_+	DUF3380 domain-containing protein	NA	E5E3R7	Burkholderia_phage	54.7	1.3e-72
WP_088860657.1|1460839_1461307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147640143.1|1461324_1461576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860659.1|1461562_1461769_+	TraR/DksA C4-type zinc finger protein	NA	A0A0M3LS11	Mannheimia_phage	54.5	3.9e-10
WP_088860660.1|1461765_1462194_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	44.0	9.3e-22
WP_088860661.1|1462180_1462618_+	phage virion morphogenesis protein	NA	E5FFH6	Burkholderia_phage	52.7	9.8e-35
WP_088860662.1|1462690_1463356_+|plate	phage baseplate assembly protein V	plate	E5E3R1	Burkholderia_phage	47.5	1.2e-47
WP_088860663.1|1463352_1463709_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	57.1	6.6e-21
WP_088860664.1|1463710_1464619_+|plate	baseplate J/gp47 family protein	plate	F1BUP3	Erwinia_phage	54.8	2.8e-76
WP_088860665.1|1464611_1465229_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	60.9	2.2e-64
WP_088860666.1|1466890_1467361_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_088860668.1|1467610_1468375_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	65.7	2.2e-98
WP_147640145.1|1468333_1468642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861924.1|1468638_1468866_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088860669.1|1469154_1470327_+|tail	phage tail sheath protein	tail	A4PE49	Ralstonia_virus	72.8	5.7e-162
WP_088860670.1|1470368_1470878_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	46.2	5.5e-37
WP_088860671.1|1470929_1471220_+|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	67.9	7.4e-23
WP_088860672.1|1471228_1471345_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_088860673.1|1471341_1473873_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	36.5	1.0e-107
WP_088860674.1|1473890_1474319_+|tail	phage tail protein	tail	A0A1S5NTH4	Burkholderia_phage	59.7	3.4e-40
WP_088861925.1|1474399_1475521_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	48.7	2.4e-93
WP_088860675.1|1475536_1476046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147640147.1|1476018_1477116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860677.1|1477152_1477476_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088860678.1|1477543_1477735_+	hypothetical protein	NA	K4NZX7	Burkholderia_phage	45.8	3.5e-05
WP_088860679.1|1478243_1478519_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_088860680.1|1478597_1479194_+	hypothetical protein	NA	A0A2H4J936	uncultured_Caudovirales_phage	53.5	2.0e-54
WP_172622944.1|1479210_1480345_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.5	5.1e-83
WP_088860681.1|1480762_1481143_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_088860682.1|1481315_1483226_+	nitrous-oxide reductase	NA	NA	NA	NA	NA
WP_088860683.1|1483407_1483830_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_147640148.1|1483865_1484297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088860684.1|1484498_1486685_+	regulatory protein NosR	NA	NA	NA	NA	NA
WP_088861926.1|1486783_1487968_+	nitrous oxide reductase family maturation protein NosD	NA	NA	NA	NA	NA
WP_088860685.1|1487951_1488887_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.0	7.0e-30
WP_088860686.1|1488886_1489711_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_088860687.1|1489707_1490214_+	nitrous oxide reductase accessory protein NosL	NA	NA	NA	NA	NA
WP_088860688.1|1490217_1490862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161493506.1|1490976_1491120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860689.1|1491299_1492420_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	2.0e-47
>prophage 6
NZ_LR698992	Laribacter hongkongensis isolate MGYG-HGUT-02398 chromosome 1	3424272	2760621	2901233	3424272	holin,terminase,transposase,capsid,head,portal,tail,integrase	Acidithiobacillus_phage(37.5%)	162	2760350:2760390	2783620:2783660
2760350:2760390	attL	GCACGCTACCGCCATGCCGTTTCACGATCAGCAAGCGCGGC	NA	NA	NA	NA
WP_088861415.1|2760621_2761068_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_088861416.1|2762855_2763191_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088861417.1|2763187_2763751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861418.1|2763762_2763987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147640246.1|2764012_2765080_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_088861420.1|2765084_2767046_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_088861421.1|2767165_2767726_-	sugar transferase	NA	NA	NA	NA	NA
WP_088861422.1|2767722_2768670_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_088861423.1|2768674_2769805_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	46.4	5.2e-104
WP_088862005.1|2769797_2770811_-	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	35.3	1.3e-42
WP_088861424.1|2770822_2771674_-	SDR family oxidoreductase	NA	A0A2L2DJC0	Acanthamoeba_polyphaga_mimivirus	31.2	2.0e-31
WP_088861425.1|2771670_2772900_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_172622976.1|2772896_2773733_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_147640248.1|2774021_2775380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161493561.1|2775376_2776561_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_088861428.1|2776605_2778117_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_088861429.1|2778117_2778813_-	acetyltransferase	NA	NA	NA	NA	NA
WP_088861430.1|2778805_2779915_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	C7U074	Ostreococcus_tauri_virus	25.3	1.1e-21
WP_172622977.1|2779911_2781135_-	methyltransferase domain-containing protein	NA	A0A1V0SJ68	Klosneuvirus	29.2	3.4e-32
WP_088862006.1|2781131_2781683_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	40.0	4.0e-25
WP_172622978.1|2781679_2782759_-	CDP-glucose 4,6-dehydratase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	32.4	2.6e-20
WP_088861433.1|2782755_2783529_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_088861434.1|2783780_2784278_-	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
2783620:2783660	attR	GCACGCTACCGCCATGCCGTTTCACGATCAGCAAGCGCGGC	NA	NA	NA	NA
WP_088862007.1|2784350_2785364_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_088861435.1|2785417_2786317_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_088862008.1|2786411_2787920_-	recombinase family protein	NA	H7BUV7	unidentified_phage	26.0	2.1e-07
WP_088862009.1|2788104_2788824_-	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
WP_088861436.1|2789253_2789682_-|holin	holin family protein	holin	R4JN18	Pseudoalteromonas_phage	40.8	5.7e-19
WP_019484518.1|2789678_2789969_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	48.8	7.0e-13
WP_172622979.1|2789980_2792293_-|tail	phage tail protein	tail	A5A3R1	Burkholderia_phage	35.6	8.9e-127
WP_088861437.1|2792289_2792706_-	C40 family peptidase	NA	A0A0B4ZZC7	Achromobacter_phage	40.2	2.4e-14
WP_088861438.1|2792702_2793245_-	DUF1833 family protein	NA	A0A0B5A6T7	Achromobacter_phage	51.4	1.5e-40
WP_088861439.1|2793253_2794900_-	hypothetical protein	NA	E5ERA2	Bathycoccus_sp._RCC1105_virus	35.1	8.8e-28
WP_088861440.1|2794939_2796616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861441.1|2796612_2797251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861442.1|2797295_2797775_-	hypothetical protein	NA	B5WZT5	Pseudomonas_phage	42.6	7.0e-18
WP_147640249.1|2797771_2800405_-	hypothetical protein	NA	A0A0U2BXT9	Paracoccus_phage	30.7	1.4e-27
WP_088861444.1|2800504_2800786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088861445.1|2800785_2801190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088861447.1|2801467_2801683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861448.1|2801766_2802117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861449.1|2802137_2803076_-	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	49.7	1.6e-79
WP_088861450.1|2803100_2803532_-	acyl-CoA transferase	NA	G8DH50	Emiliania_huxleyi_virus	38.7	4.5e-24
WP_088861451.1|2803528_2804191_-	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	44.3	2.1e-41
WP_088861452.1|2804187_2804496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861453.1|2804500_2805514_-|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	63.0	2.3e-119
WP_088861454.1|2805614_2805992_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	49.6	7.9e-25
WP_088861455.1|2806019_2807264_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	39.5	2.1e-61
WP_088861456.1|2807260_2808799_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	56.7	9.4e-149
WP_088861457.1|2808798_2809020_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	56.1	1.9e-10
WP_088861458.1|2809007_2810981_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	77.6	5.9e-305
WP_088861459.1|2810983_2811565_-	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	64.2	2.1e-53
WP_088862011.1|2811724_2812000_+	hypothetical protein	NA	A0A1X9I6B9	Streptococcus_phage	47.4	4.9e-08
WP_088861460.1|2812007_2812556_+	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	50.6	8.5e-28
WP_172623010.1|2812579_2812930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088861462.1|2813035_2813299_+	hypothetical protein	NA	K4HZA7	Acidithiobacillus_phage	67.1	3.2e-17
WP_088862012.1|2813391_2813766_+	hypothetical protein	NA	K4ICP1	Acidithiobacillus_phage	77.7	5.1e-48
WP_088861463.1|2813729_2813978_-	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	75.0	3.6e-18
WP_088861464.1|2813974_2815267_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	79.7	1.2e-197
WP_088861465.1|2815259_2815709_-	DUF882 domain-containing protein	NA	C7BGD8	Burkholderia_phage	44.9	4.2e-25
WP_088861466.1|2815695_2817120_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	64.2	2.5e-172
WP_011886405.1|2817550_2817943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861467.1|2817935_2818145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011886407.1|2818146_2818620_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	71.9	8.6e-61
WP_088861468.1|2818762_2821075_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	64.3	1.4e-292
WP_088861469.1|2821067_2821412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861470.1|2821408_2822191_-	PD-(D/E)XK nuclease family protein	NA	K4HZA0	Acidithiobacillus_phage	59.6	6.2e-80
WP_088861471.1|2822190_2822637_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	42.3	5.9e-19
WP_088861472.1|2822633_2824316_-	DEAD/DEAH box helicase	NA	A0A0A1CM43	Vibrio_phage	27.1	5.1e-39
WP_088861473.1|2824328_2824949_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	57.1	1.1e-60
WP_088861474.1|2824963_2825767_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	64.3	3.3e-97
WP_088861475.1|2825768_2826053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861476.1|2826058_2826541_-	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	45.6	4.4e-28
WP_011886417.1|2826537_2826750_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088861477.1|2826917_2827124_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_088862013.1|2827249_2827537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161493562.1|2827563_2828070_-	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_088861479.1|2828079_2829264_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_088861480.1|2829386_2829848_-	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	32.8	6.1e-11
WP_088861481.1|2829844_2831293_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	56.1	4.6e-137
WP_088861482.1|2831289_2831760_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	48.6	6.4e-32
WP_088861483.1|2832154_2833111_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_056929737.1|2833107_2833434_-	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	40.0	2.7e-05
WP_088861484.1|2833701_2834937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088861485.1|2834929_2835904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043291593.1|2835960_2836185_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_088862014.1|2836842_2837718_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_088861486.1|2837733_2839485_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_020228555.1|2839481_2841056_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.2	5.5e-104
WP_088861487.1|2841058_2842333_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	23.4	1.5e-06
WP_088861488.1|2842329_2845353_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.7	4.7e-19
WP_088861489.1|2845422_2846145_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_088861490.1|2846144_2846414_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_088861491.1|2846430_2847735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088861492.1|2847737_2848079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088861493.1|2848071_2848302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088861494.1|2849334_2849658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749986.1|2850628_2851081_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_001749985.1|2851213_2851687_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	J9Q7T1	Salmonella_phage	33.3	2.4e-10
WP_001749984.1|2851867_2852713_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
WP_000679427.1|2852829_2853177_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259032.1|2853170_2854010_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000018330.1|2854354_2855170_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.9	4.3e-161
WP_001389365.1|2855494_2856259_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000844627.1|2856356_2856599_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|2856630_2857281_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|2857386_2858586_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001389365.1|2858714_2859479_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_088861496.1|2861555_2862098_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	79.3	2.5e-64
WP_088861497.1|2862094_2862571_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	87.8	6.2e-75
WP_088861498.1|2862567_2862873_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	67.4	1.4e-24
WP_088861499.1|2862940_2863291_-	DUF2793 domain-containing protein	NA	A0A1X9IAR6	Xanthomonas_phage	61.2	7.6e-38
WP_088861500.1|2863294_2863891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861501.1|2863902_2866176_-|tail	phage tail protein	tail	A0A0S0MX47	Pseudomonas_phage	38.9	1.0e-130
WP_172622980.1|2866175_2866391_-	hypothetical protein	NA	A0A2D0W982	Bordetella_phage	55.7	1.4e-10
WP_009521704.1|2866387_2866615_-	hypothetical protein	NA	A0A2D0W9G1	Bordetella_phage	71.1	1.5e-10
WP_088861502.1|2866633_2867422_-	phage BR0599 family protein	NA	A0A0S0MV27	Pseudomonas_phage	32.7	1.8e-26
WP_088861503.1|2867427_2869011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861504.1|2869007_2870066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861505.1|2870085_2872791_-|tail	phage tail protein	tail	A0A0U2BXT9	Paracoccus_phage	34.8	2.7e-26
WP_088861506.1|2872790_2873432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172622981.1|2873437_2873596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861507.1|2873622_2874024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056931665.1|2874023_2874776_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	49.2	2.7e-56
WP_088861508.1|2874778_2874982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861509.1|2874986_2875412_-	hypothetical protein	NA	F4YCS3	Synechococcus_phage	31.7	1.3e-10
WP_088861510.1|2875422_2875701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020200538.1|2875700_2876723_-|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	62.7	8.0e-120
WP_088861511.1|2876796_2877174_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	51.2	1.9e-26
WP_088861512.1|2877177_2878485_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	45.4	1.6e-64
WP_088861513.1|2878486_2880019_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.4	9.1e-152
WP_009521720.1|2880021_2880243_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	4.1e-13
WP_088861514.1|2880242_2880635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861515.1|2880634_2881126_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	49.4	8.5e-27
WP_088861516.1|2881143_2883105_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	90.4	0.0e+00
WP_088861517.1|2883104_2883641_-	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	86.5	8.0e-79
WP_055451284.1|2883758_2883956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088861518.1|2884050_2884614_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	77.1	2.8e-34
WP_088861519.1|2884743_2885103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088861520.1|2885200_2885563_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	89.2	1.2e-59
WP_088861521.1|2885562_2885787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088861522.1|2885746_2886982_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	89.8	5.5e-216
WP_088861523.1|2886978_2888391_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	62.0	2.0e-169
WP_088862016.1|2888719_2889106_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_088861524.1|2889098_2889302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861525.1|2889303_2889768_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	71.1	5.1e-58
WP_088861526.1|2889893_2892185_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	64.3	1.1e-291
WP_024958067.1|2892177_2892405_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088861527.1|2892401_2893139_-	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	73.0	2.8e-106
WP_088861528.1|2893135_2893624_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	80.5	2.0e-73
WP_088861529.1|2893633_2894263_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	70.8	8.4e-80
WP_172622982.1|2894268_2895129_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	71.1	4.8e-110
WP_088861531.1|2895128_2895887_-	hypothetical protein	NA	K4I1D2	Acidithiobacillus_phage	68.1	2.3e-87
WP_088862017.1|2895889_2896171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861532.1|2896176_2896653_-	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	64.6	1.3e-53
WP_020200569.1|2896664_2896928_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088861533.1|2897102_2897567_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	37.3	1.4e-15
WP_088861534.1|2897563_2898976_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	59.8	4.0e-138
WP_088861535.1|2898972_2899446_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	51.4	1.1e-34
WP_081201542.1|2899442_2899658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861536.1|2899751_2900354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088862018.1|2900384_2901233_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	34.0	2.4e-05
>prophage 7
NZ_LR698992	Laribacter hongkongensis isolate MGYG-HGUT-02398 chromosome 1	3424272	3115963	3122694	3424272		Escherichia_phage(33.33%)	6	NA	NA
WP_088861653.1|3115963_3116512_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	55.5	2.6e-45
WP_088861654.1|3116566_3117436_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.4	1.4e-96
WP_088861655.1|3117448_3118333_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.0	2.9e-25
WP_088861656.1|3118329_3119397_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.6	1.3e-85
WP_088861657.1|3119405_3121235_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A0A1J0F994	Only_Syngen_Nebraska_virus	43.9	2.3e-133
WP_088861658.1|3121329_3122694_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	32.6	2.5e-28
>prophage 8
NZ_LR698992	Laribacter hongkongensis isolate MGYG-HGUT-02398 chromosome 1	3424272	3268739	3333649	3424272	protease,terminase,capsid,transposase,head,tail,tRNA,plate	uncultured_Caudovirales_phage(25.0%)	80	NA	NA
WP_088861731.1|3268739_3269657_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	33.9	2.0e-05
WP_027823160.1|3270083_3270842_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_088861732.1|3270922_3271147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861733.1|3271402_3272611_+	ammonium transporter	NA	NA	NA	NA	NA
WP_088862036.1|3272873_3273248_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_088861734.1|3273393_3274161_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_161493577.1|3274373_3274808_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_172623015.1|3274991_3275978_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012698600.1|3275990_3276821_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_088861737.1|3276834_3277743_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_088861738.1|3277757_3278825_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	3.1e-26
WP_161493578.1|3278925_3280527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172623016.1|3280537_3281260_-	endonuclease	NA	NA	NA	NA	NA
WP_088861741.1|3281497_3281932_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_088861742.1|3282069_3283401_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_088861743.1|3283397_3284087_+	response regulator	NA	NA	NA	NA	NA
WP_027823169.1|3284515_3285277_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_012698612.1|3285380_3285890_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_088861744.1|3285928_3287221_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_088861745.1|3287223_3288102_-	TonB C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012698615.1|3288101_3288512_-	protein TolR	NA	NA	NA	NA	NA
WP_088861746.1|3288668_3289157_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_012698617.1|3289174_3289606_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_088861747.1|3289668_3290046_-	VacJ	NA	NA	NA	NA	NA
WP_147640256.1|3290072_3290873_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_088861749.1|3290926_3294268_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_012698620.1|3294402_3294864_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	37.6	1.9e-20
WP_088861750.1|3294929_3295223_+	YggU family protein	NA	NA	NA	NA	NA
WP_027823175.1|3295250_3295715_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_088861751.1|3295713_3296058_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_088861752.1|3296032_3297862_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_088861753.1|3298723_3299209_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_088861754.1|3299871_3300450_-	DUF2313 domain-containing protein	NA	A0A2H4J9D6	uncultured_Caudovirales_phage	35.9	4.1e-20
WP_088861755.1|3300446_3301511_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	46.7	3.8e-80
WP_088861756.1|3301510_3301864_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	62.6	1.8e-31
WP_088861757.1|3301937_3302804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861758.1|3302863_3303466_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	43.3	4.3e-33
WP_088861759.1|3303449_3304562_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	47.0	3.9e-88
WP_088861760.1|3304545_3305835_-	DNA circularization protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	27.3	2.1e-32
WP_147640257.1|3305834_3307937_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	42.4	2.0e-72
WP_088861762.1|3308060_3308444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088860560.1|3308448_3308820_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_088861763.1|3308830_3309217_-	hypothetical protein	NA	A0A2H4J3Y5	uncultured_Caudovirales_phage	62.4	3.5e-36
WP_088861764.1|3309233_3310655_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	44.8	1.0e-96
WP_088861765.1|3310657_3310864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861766.1|3310860_3311529_-	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	38.7	8.8e-19
WP_088861767.1|3311528_3311945_-	DUF1320 family protein	NA	B7SDP4	Haemophilus_phage	41.4	5.0e-20
WP_088861768.1|3311947_3312172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861769.1|3312174_3313083_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	71.2	2.8e-124
WP_088861770.1|3313094_3313499_-	hypothetical protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	60.5	1.5e-34
WP_088861771.1|3313502_3314573_-|protease	phage protease	protease	A0A0M5N0Q6	Ralstonia_phage	42.4	5.5e-63
WP_088861772.1|3314789_3315275_-	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	38.0	2.8e-14
WP_088861773.1|3315377_3316658_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	47.6	1.1e-70
WP_088861774.1|3316650_3318243_-	DUF935 domain-containing protein	NA	L7P7P3	Pseudomonas_phage	55.3	1.0e-158
WP_088861775.1|3318248_3319874_-|terminase	phage terminase large subunit	terminase	H1ZZE1	Pseudomonas_virus	66.0	2.4e-211
WP_147640258.1|3319895_3320396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088861776.1|3320392_3320893_-	DUF1804 family protein	NA	A0A1C6ZDN3	Pseudomonas_phage	69.3	1.0e-56
WP_088860545.1|3320892_3321114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861777.1|3321126_3321369_-	DUF2746 domain-containing protein	NA	NA	NA	NA	NA
WP_088861778.1|3321365_3321596_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_161493579.1|3321588_3322155_-	hypothetical protein	NA	Q6QIC6	Burkholderia_phage	43.4	1.7e-26
WP_088861780.1|3322151_3322379_-	hypothetical protein	NA	A0A0M4UKB4	Ralstonia_phage	54.8	3.5e-12
WP_088861781.1|3322384_3322906_-	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	53.1	1.2e-44
WP_147640259.1|3322984_3323521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088862037.1|3323548_3323971_-	DNA transposition protein	NA	A0A0A1IWZ1	Pseudomonas_phage	36.7	3.3e-19
WP_088861783.1|3323981_3324377_-	regulatory protein GemA	NA	A0A0M5MRZ7	Ralstonia_phage	60.0	2.0e-34
WP_088861784.1|3324435_3325128_-	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	46.6	9.4e-40
WP_088861785.1|3325198_3325714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147640260.1|3325736_3325916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861786.1|3325917_3326160_-	hypothetical protein	NA	A0A2I7R260	Vibrio_phage	46.4	2.9e-12
WP_088862038.1|3326161_3326782_-	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	63.0	2.3e-69
WP_088861787.1|3327339_3327660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861788.1|3327656_3327956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861789.1|3327952_3328285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088861790.1|3328271_3328910_-	hypothetical protein	NA	A0A1B0T6M0	Pelagibaca_phage	40.9	9.0e-29
WP_088860529.1|3328922_3329666_-	ATP-binding protein	NA	A0A0A1IVZ3	Pseudomonas_phage	54.6	1.9e-62
WP_088861791.1|3329723_3331883_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	F6MII5	Haemophilus_phage	40.0	9.3e-110
WP_088861792.1|3331879_3332353_-	hypothetical protein	NA	Q6QID6	Burkholderia_phage	36.6	3.4e-17
WP_088861793.1|3332414_3332717_-	helix-turn-helix domain-containing protein	NA	F6MII4	Haemophilus_phage	60.2	1.5e-18
WP_088861794.1|3332884_3333649_+	phage repressor protein C	NA	A0A2H4J7C3	uncultured_Caudovirales_phage	37.1	1.0e-34
