The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	149531	221117	2058319	tRNA,protease,transposase	Bacillus_virus(23.53%)	55	NA	NA
WP_023062061.1|149531_152315_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.9	8.9e-89
WP_003627651.1|152314_152518_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_012211705.1|152537_153107_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003627649.1|153109_153418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211706.1|153435_154131_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_023190853.1|154132_155290_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	35.6	1.8e-27
WP_065866337.1|155337_155679_+	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_012211708.1|155686_156814_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_012211710.1|156907_157567_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012211711.1|157566_158211_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012211712.1|158210_160562_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	27.0	2.1e-59
WP_041810698.1|161604_163284_-	ribonuclease J	NA	NA	NA	NA	NA
WP_003627933.1|163290_163512_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_003628072.1|163862_164417_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.7	3.6e-10
WP_003628073.1|164669_166514_+	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	41.5	3.6e-22
WP_023190858.1|166609_167791_+	cell division protein FtsW	NA	NA	NA	NA	NA
WP_012211716.1|167787_168132_+	YlbG family protein	NA	NA	NA	NA	NA
WP_012211717.1|168128_168677_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003627939.1|168679_169174_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	36.2	9.7e-23
WP_012211718.1|169157_170192_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_012211719.1|170269_170965_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023190860.1|170933_173222_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	31.0	8.2e-24
WP_003627943.1|173218_174205_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_014919008.1|174265_174523_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003628079.1|174721_174991_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_023190861.1|175147_176920_+	ribonuclease J	NA	NA	NA	NA	NA
WP_012211722.1|176922_177756_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012211723.1|177945_179136_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	27.3	2.3e-30
WP_012211724.1|179286_180645_+	trigger factor	NA	NA	NA	NA	NA
WP_065866338.1|180775_182050_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.4	8.7e-132
WP_012211726.1|182039_182630_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_065866339.1|182594_184331_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.7e-88
WP_065866340.1|186112_187117_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_065866341.1|187109_188483_-	aspartate kinase	NA	NA	NA	NA	NA
WP_065866342.1|188954_190271_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003626729.1|190290_191001_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_065866343.1|191003_192158_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_065866344.1|192159_193095_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_065866345.1|193087_193867_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_003626723.1|193887_195054_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012211734.1|195065_196124_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_147628221.1|196227_197328_+	serine hydrolase	NA	NA	NA	NA	NA
WP_079227764.1|197384_197960_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012211736.1|198004_199615_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_065866346.1|199899_200757_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014564905.1|203398_204421_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_172619764.1|204625_205933_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.7	2.0e-51
WP_014564907.1|205952_207734_+	adenine deaminase	NA	NA	NA	NA	NA
WP_065866348.1|208120_209905_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.8e-88
WP_012211741.1|212571_213126_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	42.4	2.1e-34
WP_065866349.1|213122_214577_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.2	1.1e-95
WP_065866350.1|214699_216403_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.6e-88
WP_012211745.1|216727_217432_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	25.5	2.2e-07
WP_012211746.1|218427_219150_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211430.1|219839_221117_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
>prophage 2
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	235042	245716	2058319	transposase	Clostridium_phage(14.29%)	11	NA	NA
WP_012211753.1|235042_235411_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0A7S1E5	Clostridium_phage	38.9	9.2e-10
WP_079227905.1|235432_235504_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012211754.1|235908_237297_+	amino acid permease	NA	NA	NA	NA	NA
WP_003626673.1|237438_238395_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.5	3.6e-114
WP_012211755.1|238409_238928_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.5	2.2e-25
WP_023190625.1|239047_239251_+	hypothetical protein	NA	Q9AZG0	Lactococcus_phage	50.0	5.6e-09
WP_023190626.1|239263_239446_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012211430.1|239514_240792_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
WP_012211756.1|241013_243431_+	HAD-IC family P-type ATPase	NA	E4ZFI9	Streptococcus_phage	20.2	1.2e-17
WP_065866356.1|243781_244642_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012211758.1|244654_245716_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.1e-30
>prophage 3
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	327056	392257	2058319	tRNA,protease,integrase,transposase	Staphylococcus_phage(13.33%)	57	324243:324261	351251:351269
324243:324261	attL	AAAGTGTCTGGGAAATAAC	NA	NA	NA	NA
WP_012211821.1|327056_328256_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.1	8.6e-49
WP_003628329.1|328294_328987_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003626512.1|329103_329934_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.9	5.3e-21
WP_003626511.1|329936_330167_+	YozE family protein	NA	NA	NA	NA	NA
WP_065866383.1|330214_331807_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_012211824.1|331830_332682_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_012211825.1|332671_333424_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	38.6	1.3e-26
WP_003628334.1|333484_334333_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.8	4.9e-30
WP_012211826.1|334404_336519_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.2	1.5e-96
WP_023191156.1|336552_337869_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_003626495.1|337868_338777_+	tyrosine recombinase	NA	A0A1P8DJJ6	Virus_Rctr41k	25.1	2.3e-14
WP_003628338.1|338785_339310_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_065866384.1|339320_340724_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	25.1	2.6e-28
WP_065866385.1|340885_341785_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_012211833.1|342767_343583_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003628344.1|345263_345647_+	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	3.1e-08
WP_003628346.1|345648_346026_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_065866386.1|347859_349956_+	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_012211842.1|349972_351232_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_065866387.1|351396_353127_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	3.0e-87
351251:351269	attR	AAAGTGTCTGGGAAATAAC	NA	NA	NA	NA
WP_023190807.1|354095_355868_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.6	2.9e-77
WP_003628456.1|355976_356426_+	Trp operon repressor	NA	NA	NA	NA	NA
WP_065866388.1|356654_357287_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012211845.1|357387_358002_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_012211846.1|358126_359224_+	serine hydrolase	NA	NA	NA	NA	NA
WP_065866904.1|359290_360118_+	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_012211848.1|360117_360675_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_012211849.1|360757_361963_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_065866389.1|362011_363346_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_023191009.1|363505_364792_+	peptidase T	NA	NA	NA	NA	NA
WP_023191010.1|364797_365010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628488.1|365551_365902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866390.1|365993_366626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014563664.1|366538_367084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052541195.1|368053_368635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211857.1|369970_370681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866392.1|370791_371970_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.0	5.4e-120
WP_065866393.1|372152_372590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866394.1|372678_373155_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003628508.1|373419_373839_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_020829165.1|373854_374616_+	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_003626474.1|374618_375242_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_014563645.1|375632_375992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023191285.1|376101_376593_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_065866395.1|377097_378333_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.1	1.6e-53
WP_065866396.1|378611_378890_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_065866397.1|378889_379237_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_065866398.1|379621_380125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866399.1|380628_380928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866400.1|380957_381593_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065866402.1|382389_384894_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.0	1.2e-137
WP_065866403.1|385482_386100_+	non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_003628533.1|386254_386689_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003626445.1|386685_387114_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_065866404.1|387437_388952_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	24.6	1.1e-24
WP_065866406.1|390488_390737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866407.1|391054_392257_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	30.2	6.9e-38
>prophage 4
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	421614	490701	2058319	integrase,transposase	Listeria_phage(11.11%)	42	463383:463408	496176:496201
WP_065866421.1|421614_422544_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	51.3	3.6e-87
WP_079227785.1|422609_423668_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_065866423.1|423773_426797_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.3	1.9e-15
WP_014564904.1|428065_429331_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_012211885.1|429333_430152_+	DUF3100 domain-containing protein	NA	NA	NA	NA	NA
WP_023191117.1|430144_430636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866424.1|431984_432890_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_065866427.1|443549_445496_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.3	1.8e-59
WP_003619518.1|445693_446059_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_147628227.1|446344_447676_+	amino acid permease	NA	NA	NA	NA	NA
WP_065866429.1|448371_449559_+	amidohydrolase	NA	NA	NA	NA	NA
WP_065866906.1|452259_453507_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_012211895.1|455389_455923_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_079227881.1|456124_457390_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_023190467.1|457556_457787_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_012211896.1|457921_458473_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003626373.1|460004_460244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190890.1|461272_461608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628653.1|461990_463370_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
463383:463408	attL	ATACGCGTGGTGCTAGTTAAATCGTT	NA	NA	NA	NA
WP_065866431.1|463481_464222_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065866432.1|465605_467009_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_065866433.1|467210_468224_+	serine hydrolase	NA	NA	NA	NA	NA
WP_012211903.1|469185_471924_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_035513343.1|471959_472172_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014918760.1|473647_474145_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_052541144.1|474180_474594_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_012211907.1|474595_475033_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003626351.1|475562_476216_-	endonuclease III	NA	NA	NA	NA	NA
WP_065866435.1|476353_476563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003614991.1|476642_476993_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_065866436.1|476989_478063_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	42.3	8.0e-38
WP_065866437.1|478046_479384_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003614994.1|479373_480465_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_003622249.1|480476_481013_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003615004.1|482234_482894_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003626333.1|482874_483549_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_065866907.1|483558_484299_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	2.0e-32
WP_003613446.1|484310_485171_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014563535.1|485989_487021_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	39.2	1.8e-34
WP_003626323.1|487134_487635_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	45.4	1.6e-33
WP_012211358.1|488582_489761_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003626321.1|490080_490701_+|integrase	tyrosine-type recombinase/integrase	integrase	E2ELN7	Clostridium_phage	36.4	4.3e-20
496176:496201	attR	AACGATTTAACTAGCACCACGCGTAT	NA	NA	NA	NA
>prophage 5
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	574529	644600	2058319	tRNA,protease,transposase	Lactobacillus_virus(10.53%)	54	NA	NA
WP_003628907.1|574529_576593_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003627460.1|576585_577503_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_012211975.1|577756_578509_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_012211976.1|578509_579415_-	GTPase Era	NA	NA	NA	NA	NA
WP_012211977.1|579414_579939_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_012211978.1|579941_580901_-	PhoH family protein	NA	W8D063	Erwinia_phage	46.5	1.3e-47
WP_012211979.1|580926_581370_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	32.9	2.0e-11
WP_002880182.1|581479_581656_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023190641.1|581912_582749_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_035513591.1|583119_583575_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_012211982.1|583782_584661_+	YitT family protein	NA	NA	NA	NA	NA
WP_065866467.1|585210_586239_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.7	2.6e-46
WP_003627474.1|586405_587011_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_003627475.1|587013_587175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211984.1|587190_588357_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014918653.1|588477_589014_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_172619748.1|591472_592702_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.0	1.8e-126
WP_012211987.1|593737_594592_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065866469.1|594720_596994_+	HAD-IC family P-type ATPase	NA	A7IUR5	Paramecium_bursaria_Chlorella_virus	25.5	7.1e-44
WP_079227799.1|597061_597562_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_012211992.1|600127_601057_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	59.5	2.2e-100
WP_003628968.1|601200_601728_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012211993.1|601832_604106_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.9	3.7e-77
WP_003627502.1|604226_604916_-	class A sortase	NA	NA	NA	NA	NA
WP_065866471.1|604918_606757_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	4.0e-21
WP_012211995.1|607231_608386_-	molecular chaperone DnaJ	NA	A0A167RAM8	Powai_lake_megavirus	29.0	1.4e-19
WP_065866472.1|608467_610294_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	9.2e-143
WP_023190314.1|610311_610911_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_065866473.1|610926_611976_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_065866474.1|612145_613108_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SD03	Indivirus	30.1	6.1e-05
WP_065866475.1|613113_614007_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_012211999.1|614058_614424_-	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_065866476.1|614443_617056_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.5	9.7e-21
WP_065866477.1|617060_617372_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_012212001.1|617374_617671_-	YlxR family protein	NA	NA	NA	NA	NA
WP_012212002.1|617679_618861_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_065866478.1|618880_619357_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_065866479.1|619466_623777_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	34.1	1.2e-18
WP_065866480.1|623782_625480_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_020829285.1|625522_626779_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003629019.1|626789_627605_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_014918626.1|627606_628341_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.7	5.0e-23
WP_023190307.1|628343_628901_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_014563421.1|628900_629626_-	UMP kinase	NA	NA	NA	NA	NA
WP_065866481.1|629764_630790_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_023190305.1|630823_631597_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_023190304.1|631758_632790_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003627532.1|632855_633470_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_012212008.1|633529_634711_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	36.1	4.7e-47
WP_023190303.1|634768_636712_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.2	3.6e-60
WP_065866482.1|636806_638591_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	23.0	3.1e-18
WP_172619749.1|639651_640905_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	55.1	2.0e-112
WP_065866448.1|642100_643279_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_065866483.1|643355_644600_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	1.3e-10
>prophage 6
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	703604	845513	2058319	tRNA,protease,transposase	Streptococcus_phage(11.11%)	111	NA	NA
WP_065866501.1|703604_704930_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.3	1.6e-56
WP_065866502.1|704959_705568_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	8.8e-34
WP_065866503.1|705675_706287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003547962.1|706352_706532_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_046814349.1|706602_708399_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_065866504.1|708521_709757_-	SLAP domain-containing protein	NA	X2CXX8	Lactobacillus_phage	50.9	2.7e-61
WP_023191382.1|710216_711113_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	26.6	2.4e-11
WP_025283704.1|711121_711478_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	38.6	5.0e-13
WP_065866506.1|712192_714574_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_003627616.1|714626_715052_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003627617.1|715044_715326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866507.1|715441_716305_-	sugar transporter	NA	NA	NA	NA	NA
WP_157952330.1|716483_716636_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_065866508.1|718956_722145_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_065866509.1|722137_723223_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.1	1.3e-56
WP_065866510.1|723222_724500_-	dihydroorotase	NA	NA	NA	NA	NA
WP_065866511.1|724499_725456_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	34.5	2.2e-26
WP_065866512.1|725601_726144_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_065866513.1|726310_727234_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003629217.1|727489_728194_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003627631.1|728195_728819_+	orotate phosphoribosyltransferase	NA	A0A0B5IW17	Pandoravirus	32.9	9.1e-26
WP_023190998.1|730592_730787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079227810.1|731342_731726_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_065866514.1|732892_735514_+	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	30.0	1.8e-83
WP_065866515.1|735570_736806_-	MFS transporter	NA	NA	NA	NA	NA
WP_065866516.1|736940_737237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023192717.1|737384_737678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212055.1|737779_738442_+	serine dehydratase	NA	NA	NA	NA	NA
WP_023191365.1|738456_739338_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_065866517.1|739342_739669_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_052747907.1|740018_740558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814366.1|740569_740932_-	hypothetical protein	NA	E8ZDN5	Streptococcus_phage	50.0	3.3e-12
WP_079227812.1|742462_743431_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_060471342.1|744805_745225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866519.1|746724_748176_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_012212067.1|748357_748864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866520.1|749737_749998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866521.1|750114_750900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866522.1|750963_751668_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003629414.1|751687_752095_-	OsmC family protein	NA	NA	NA	NA	NA
WP_025283748.1|752113_753286_-	MFS transporter	NA	NA	NA	NA	NA
WP_079227814.1|755159_755987_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065866524.1|756095_756536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866525.1|756656_757652_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_012212073.1|757772_759236_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_012212074.1|759257_760424_-	galactokinase	NA	NA	NA	NA	NA
WP_154021786.1|760826_760964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023191085.1|761635_762223_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_012212077.1|762219_762837_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_012212078.1|764989_766864_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_003627719.1|766936_768166_-	MFS transporter	NA	NA	NA	NA	NA
WP_065866526.1|768320_769718_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_012211430.1|770130_771408_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
WP_110549469.1|771614_771701_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_065866527.1|774355_775441_+	BMP family protein	NA	A0A0A7DN02	Lactobacillus_phage	49.6	3.0e-77
WP_065866528.1|775509_777054_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.9	4.0e-14
WP_003627725.1|777034_778183_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003627726.1|778188_779145_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_065866529.1|779175_780015_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065866530.1|780214_781552_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	1.3e-48
WP_052541609.1|781526_781757_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143441508.1|781796_782147_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_172619750.1|782140_782317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866531.1|782485_783763_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.2	3.8e-10
WP_003627020.1|783965_785222_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_079227816.1|785234_787370_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.3	5.6e-75
WP_003627023.1|787366_788416_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	43.9	9.2e-63
WP_003627024.1|788447_789881_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	5.3e-61
WP_012212086.1|789856_792088_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	38.9	7.8e-144
WP_003627026.1|792084_792756_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003627027.1|792755_793007_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003627029.1|793006_793723_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	39.1	7.5e-40
WP_065866532.1|793919_795056_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_065866533.1|795048_795537_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.1	4.8e-22
WP_065866534.1|795547_797209_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_065866535.1|797589_798348_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.7	6.3e-21
WP_065866536.1|798363_799509_-	MFS transporter	NA	NA	NA	NA	NA
WP_065866537.1|799645_800599_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_065866530.1|802178_803516_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	1.3e-48
WP_052541609.1|803490_803721_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172619750.1|804104_804281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079227910.1|804323_804485_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_065866539.1|805714_807631_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_065866542.1|811764_812772_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_065866543.1|813973_815860_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	33.5	3.1e-93
WP_012212098.1|815843_816800_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_003627059.1|816904_817897_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	5.3e-52
WP_023190867.1|819473_820487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866544.1|820587_821493_-	ABC transporter	NA	NA	NA	NA	NA
WP_065866545.1|822604_823942_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003627072.1|825701_826622_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003627073.1|826700_827102_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_012212103.1|827160_827388_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_012212104.1|827388_828069_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003627079.1|828089_828650_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003548272.1|828698_828848_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_023190296.1|828925_831034_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_065866546.1|831124_833716_+	YfhO family protein	NA	NA	NA	NA	NA
WP_065866547.1|833823_834747_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_079227881.1|834812_836078_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_079227825.1|836280_836577_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003627089.1|836545_836887_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_065866549.1|837073_837988_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_012212109.1|838050_838527_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_065866550.1|838603_841018_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_012212111.1|841021_842071_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.3	5.3e-34
WP_012212112.1|842355_842706_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065866551.1|842817_843585_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_065866552.1|843695_843968_+	acylphosphatase	NA	NA	NA	NA	NA
WP_065866553.1|844014_844977_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_003627102.1|845024_845513_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
>prophage 7
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	860209	929304	2058319	tRNA,bacteriocin,transposase	Bacillus_phage(23.08%)	54	NA	NA
WP_065866559.1|860209_862144_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.2	2.8e-97
WP_012212130.1|862434_863343_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	28.1	9.2e-27
WP_065866560.1|863375_864707_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_003627138.1|864709_865177_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_065866561.1|865179_865782_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003627142.1|865778_866609_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	25.9	7.1e-18
WP_065866562.1|866617_869281_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	30.4	2.0e-61
WP_023192833.1|872468_872750_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_065866563.1|872755_873745_-	type I-B CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_065866564.1|873754_874246_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_065866565.1|874261_876691_-	CRISPR-associated helicase/endonuclease Cas3	NA	A0A2R2ZGW0	Clostridioides_phage	23.5	4.8e-30
WP_065866566.1|876833_877547_-	type I-B CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_023192831.1|877533_878436_-	type I-B CRISPR-associated protein Cas7/Cst2/DevR	NA	NA	NA	NA	NA
WP_172619752.1|878454_880194_-	type I-B CRISPR-associated protein Cas8b1/Cst1	NA	NA	NA	NA	NA
WP_003627162.1|880229_880985_-	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_003629695.1|883474_884128_-	flavodoxin	NA	NA	NA	NA	NA
WP_003629702.1|884272_885154_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_012212140.1|885171_885486_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_065866568.1|885892_886870_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_065866569.1|887007_888522_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_065866570.1|888610_889588_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_012212142.1|889642_890956_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_101812619.1|891110_891545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023191291.1|891516_891684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003629717.1|891781_891958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866571.1|892135_892768_+	aggregation promoting protein	NA	A0A0E3XCL7	Enterococcus_phage	62.2	7.1e-18
WP_003629734.1|892802_893447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866573.1|895365_900336_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	32.8	3.1e-15
WP_065866574.1|900990_901848_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012211358.1|902114_903293_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_065866575.1|903778_905104_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	35.8	2.8e-56
WP_012212126.1|905133_905742_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
WP_025283820.1|905849_906047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023191293.1|907765_909073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866577.1|909124_909772_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_023191989.1|909791_910112_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_012212149.1|910181_910835_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_172619753.1|910846_912040_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003627193.1|912026_912770_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	1.7e-18
WP_014918422.1|912784_913120_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012212153.1|913615_914053_+	HIT family protein	NA	NA	NA	NA	NA
WP_003627197.1|914062_914398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212154.1|914516_915419_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_065866579.1|915557_915980_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_065866580.1|915925_917683_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	3.6e-88
WP_003627200.1|917830_918808_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_065866581.1|918800_921302_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003627202.1|921282_922503_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_003627204.1|922511_922862_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_065866582.1|922882_924940_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_012212158.1|925028_925886_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003627210.1|925925_926072_-	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_012212159.1|927128_927881_+	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	30.7	1.4e-25
WP_012211430.1|928026_929304_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
>prophage 8
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	971200	1056485	2058319	tRNA,holin,transposase	Staphylococcus_phage(14.81%)	60	NA	NA
WP_172412571.1|971200_973618_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.8	0.0e+00
WP_023190442.1|973903_974566_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_065866591.1|975726_977187_-	MFS transporter	NA	S4TR35	Salmonella_phage	24.2	4.9e-06
WP_065866592.1|977205_978405_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.0	1.4e-139
WP_012212191.1|978856_979747_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003627921.1|985465_985924_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.4	2.1e-43
WP_012211475.1|985936_988276_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.8	9.5e-84
WP_003632304.1|988350_988584_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_012211474.1|988650_990708_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.7	1.3e-142
WP_014563108.1|990783_991806_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_012211472.1|991805_992849_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003627915.1|992862_994026_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_079227881.1|995888_997154_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_079227835.1|1004383_1005337_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	26.2	2.0e-16
WP_065866594.1|1005345_1005996_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_012211469.1|1006010_1006619_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_003632178.1|1006615_1007395_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_012211468.1|1007394_1008018_-	YutD family protein	NA	NA	NA	NA	NA
WP_065866595.1|1008001_1009393_-	bifunctional metallophosphatase/5'-nucleotidase	NA	S4W5J5	Pandoravirus	22.4	1.0e-05
WP_003627737.1|1009407_1009728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211466.1|1009821_1011192_+	glycerophosphodiester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	26.5	1.6e-11
WP_012211465.1|1011272_1012274_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	26.3	1.1e-20
WP_023191004.1|1012420_1013527_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_012211463.1|1013592_1013964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211462.1|1013981_1014407_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_012211461.1|1014540_1015392_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_065866596.1|1015559_1016804_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.3	3.1e-09
WP_065866597.1|1018550_1019171_-	XTP/dITP diphosphatase	NA	A0A2P1DNP2	Cassava_brown_streak_virus	34.0	5.1e-13
WP_065866598.1|1019170_1019974_-	glutamate racemase	NA	NA	NA	NA	NA
WP_065866599.1|1020050_1020464_+	YslB family protein	NA	NA	NA	NA	NA
WP_065866600.1|1020598_1021456_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065866601.1|1021526_1021898_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_003627748.1|1021942_1022254_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.8	1.3e-17
WP_065866602.1|1022354_1024712_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	48.7	9.7e-20
WP_003627751.1|1024775_1025087_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_014563089.1|1025088_1025517_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003627753.1|1025516_1025774_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_065866603.1|1025834_1028474_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.0	6.1e-63
WP_065866604.1|1028743_1029229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211447.1|1029816_1031178_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.2	4.4e-49
WP_065866605.1|1031170_1032127_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_003631554.1|1032186_1033308_-	DNA polymerase IV	NA	A0A1P8CWP4	Bacillus_phage	24.5	2.4e-16
WP_065866606.1|1033300_1034752_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	32.4	3.3e-63
WP_003631553.1|1034887_1035313_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_003627765.1|1035383_1036400_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	7.4e-09
WP_003627766.1|1036448_1037039_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_025283302.1|1037039_1038950_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.7	4.4e-55
WP_065866607.1|1038949_1041547_-	DNA mismatch repair protein MutS	NA	F2QAF7	Pyramimonas_orientalis_virus	25.2	1.6e-39
WP_012211438.1|1041706_1043329_-	chaperonin GroEL	NA	A0A240F766	uncultured_virus	54.0	4.4e-157
WP_003627770.1|1043382_1043667_-	co-chaperone GroES	NA	A0A221S304	uncultured_virus	40.7	1.2e-12
WP_065866608.1|1043882_1044413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061469.1|1044710_1044803_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_079227838.1|1044946_1045240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812609.1|1047195_1047726_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_065866609.1|1049256_1050990_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.7e-88
WP_012211434.1|1050954_1051701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866610.1|1051697_1052156_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003625963.1|1052295_1052943_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003625961.1|1053117_1055031_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.7	3.5e-60
WP_065866611.1|1055207_1056485_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	4.0e-12
>prophage 9
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	1142857	1184421	2058319	tRNA,protease,bacteriocin,transposase	Lactobacillus_virus(30.0%)	31	NA	NA
WP_065866629.1|1142857_1145338_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.3	4.8e-118
WP_003625767.1|1145442_1145898_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_065866630.1|1146263_1146746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023190458.1|1147058_1148609_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	35.6	1.5e-82
WP_003625761.1|1148624_1149650_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_065866631.1|1149727_1150618_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_065866632.1|1150670_1152836_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	48.0	6.0e-109
WP_003625756.1|1152930_1154187_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_003625754.1|1154228_1154591_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012211366.1|1154590_1154968_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003625749.1|1155033_1155276_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_065866633.1|1155287_1158785_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_012211364.1|1158786_1159344_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_012211363.1|1159478_1160450_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003631233.1|1160637_1161345_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_023190465.1|1162128_1163259_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.7	7.2e-29
WP_003625735.1|1163261_1163618_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_012211361.1|1163700_1165212_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.1	3.8e-70
WP_003625729.1|1165224_1166592_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_003625728.1|1166717_1166963_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_065866634.1|1167147_1167978_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_172619754.1|1168164_1169424_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.2	1.3e-124
WP_014562970.1|1169694_1170771_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_172619766.1|1170860_1171676_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_012211358.1|1171973_1173152_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003625618.1|1176795_1178031_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	1.2e-101
WP_172619755.1|1178783_1180043_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	55.4	3.0e-116
WP_003625614.1|1180428_1182006_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	34.1	6.3e-23
WP_003625612.1|1182202_1182355_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003625610.1|1182397_1182691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079227852.1|1183191_1184421_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.7	7.1e-123
>prophage 10
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	1435204	1511365	2058319	tRNA,holin,protease,transposase	Moraxella_phage(20.0%)	58	NA	NA
WP_012212407.1|1435204_1436590_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_003630694.1|1436598_1438584_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_003624927.1|1438723_1440127_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	27.6	7.5e-36
WP_003624929.1|1440227_1441787_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_023190340.1|1441880_1442984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003624933.1|1443048_1443201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212404.1|1444704_1446627_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.6	4.0e-96
WP_003624940.1|1446626_1446914_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_065866722.1|1446913_1447291_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_065866723.1|1447303_1447750_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_003630691.1|1447850_1448105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147628244.1|1448205_1449510_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.1	8.5e-50
WP_065866725.1|1450897_1452214_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.8	1.1e-33
WP_012212400.1|1453863_1455174_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.7	1.7e-42
WP_003624955.1|1455351_1456086_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065866727.1|1458833_1460141_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.0	6.3e-37
WP_012212398.1|1460377_1461178_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_012212397.1|1461225_1461912_-	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	50.6	5.4e-56
WP_003624967.1|1461936_1462584_-	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	47.9	1.1e-47
WP_103659039.1|1462754_1463174_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004561128.1|1465088_1465808_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_004561127.1|1465925_1466753_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	28.8	9.6e-23
WP_065866728.1|1466860_1467466_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_065866729.1|1469833_1470937_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003624988.1|1471025_1471682_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_101871943.1|1472524_1472620_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_023190505.1|1472773_1473055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212392.1|1473051_1473909_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065866730.1|1474000_1474630_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_065866731.1|1474634_1476203_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.1	3.2e-11
WP_004561119.1|1476240_1476510_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_041810776.1|1476496_1476805_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_065866732.1|1476933_1478103_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_065866733.1|1478256_1480113_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.6	1.2e-68
WP_147628247.1|1480533_1481757_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.3	1.0e-121
WP_023190739.1|1482583_1483720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003630632.1|1483739_1484036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003630630.1|1484213_1484366_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_065866735.1|1484381_1485896_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.4	4.4e-34
WP_023190737.1|1485895_1487134_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.4	2.0e-24
WP_003625019.1|1487192_1487432_+	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_003630624.1|1487424_1488711_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003625023.1|1488710_1489655_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003630622.1|1489866_1490067_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023190734.1|1490115_1490823_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_023190733.1|1490837_1491227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035513724.1|1491231_1491639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079227701.1|1494417_1496034_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_012212381.1|1496072_1496309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866737.1|1499652_1500978_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_065866738.1|1500946_1501876_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_065866739.1|1502160_1504284_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.4	3.8e-116
WP_003625047.1|1504390_1505032_+	signal peptidase I	NA	NA	NA	NA	NA
WP_012212375.1|1505125_1505890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003630598.1|1505980_1507342_+	amino acid permease	NA	NA	NA	NA	NA
WP_065866740.1|1507377_1508751_+	amino acid permease	NA	NA	NA	NA	NA
WP_012212372.1|1509800_1511192_+	APC family permease	NA	NA	NA	NA	NA
WP_079227714.1|1511212_1511365_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	1515418	1594391	2058319	bacteriocin,transposase	unidentified_phage(11.76%)	54	NA	NA
WP_012211358.1|1515418_1516597_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_079227878.1|1516693_1517308_+	McbB family protein	NA	NA	NA	NA	NA
WP_014919596.1|1517308_1518115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014919595.1|1518116_1519112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190668.1|1519116_1520193_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_065866741.1|1520656_1521670_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	41.4	8.0e-64
WP_023190667.1|1522116_1523172_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_023190666.1|1523610_1524603_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	67.3	1.7e-130
WP_012212368.1|1524813_1526103_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.3	5.8e-67
WP_012212367.1|1526106_1527405_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.5	1.7e-18
WP_012212366.1|1527473_1527836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190665.1|1527933_1528413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|1528685_1529864_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_023190663.1|1530431_1530932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003630570.1|1530949_1531594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025284001.1|1532642_1533125_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	42.5	5.4e-18
WP_079227881.1|1533339_1534605_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_065866742.1|1534665_1535352_-	cobalamin biosynthesis protein CobQ	NA	NA	NA	NA	NA
WP_065866743.1|1535633_1536446_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_065866744.1|1538126_1538900_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_065866922.1|1540630_1541356_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_012212342.1|1542957_1543755_+	Mrr restriction system protein	NA	NA	NA	NA	NA
WP_003617037.1|1544008_1544644_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_035513562.1|1546071_1547121_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.6	2.8e-51
WP_052540350.1|1548959_1549310_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172619757.1|1549580_1550837_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_111194059.1|1550954_1551074_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_023191696.1|1551477_1551576_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_172619758.1|1553071_1553467_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_172619745.1|1553911_1554328_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.2	4.1e-06
WP_025283989.1|1554688_1555699_+	ADP-ribosylglycohydrolase family protein	NA	A0A2K9L0L0	Tupanvirus	23.4	2.4e-07
WP_065866747.1|1555704_1557063_+	cytosine permease	NA	NA	NA	NA	NA
WP_046814534.1|1557063_1557954_+	ribokinase	NA	NA	NA	NA	NA
WP_065866748.1|1560227_1561388_+	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	22.1	5.7e-05
WP_065866749.1|1561411_1562251_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_035514399.1|1563841_1564054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212335.1|1564423_1565773_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.3	7.0e-124
WP_065866751.1|1565914_1567192_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	2.9e-10
WP_023191339.1|1567655_1567991_-	EutP/PduV family microcompartment system protein	NA	NA	NA	NA	NA
WP_003630445.1|1569098_1569809_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_023191341.1|1569816_1571481_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	2.4e-20
WP_035515559.1|1571468_1572365_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_025283980.1|1573198_1574593_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_065866752.1|1575056_1577495_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_023191344.1|1577582_1578629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003630431.1|1579057_1579807_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_023191345.1|1580063_1580387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212329.1|1580444_1581671_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.3	1.8e-38
WP_012212328.1|1582014_1582533_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_065866753.1|1582997_1585265_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	1.2e-59
WP_025283976.1|1587595_1588483_-	EamA family transporter	NA	NA	NA	NA	NA
WP_079227719.1|1590135_1590549_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	42.5	7.6e-21
WP_012212126.1|1591013_1591622_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
WP_012211358.1|1593212_1594391_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	1618487	1676585	2058319	bacteriocin,transposase	Bacillus_phage(20.0%)	52	NA	NA
WP_065866762.1|1618487_1619666_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_035514011.1|1620072_1620291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212307.1|1621566_1622478_+	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.7	2.8e-60
WP_003627923.1|1622499_1623684_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_065866763.1|1623649_1624207_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_079227888.1|1624514_1624868_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023190550.1|1625131_1626139_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	53.7	2.7e-96
WP_003627927.1|1626119_1626545_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	38.3	1.1e-11
WP_052541598.1|1626537_1628706_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	47.5	1.1e-171
WP_065866764.1|1628707_1630411_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.6e-88
WP_065866765.1|1630577_1631750_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_065866766.1|1631868_1632831_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_065866767.1|1632860_1633175_-	helveticin	NA	NA	NA	NA	NA
WP_023061231.1|1633491_1633845_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	39.8	2.9e-13
WP_023192344.1|1633828_1634263_+	phage repressor	NA	F8J1D9	Lactobacillus_phage	33.3	5.6e-14
WP_065866768.1|1635869_1637138_-	MFS transporter	NA	NA	NA	NA	NA
WP_025284014.1|1637237_1638098_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023190700.1|1639729_1640977_-	MFS transporter	NA	NA	NA	NA	NA
WP_020828954.1|1641127_1642108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627391.1|1642171_1642531_-	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	1.5e-20
WP_065866769.1|1642756_1645291_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.3	5.8e-71
WP_023190694.1|1647066_1647711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023191578.1|1647769_1648531_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_025283955.1|1648527_1649283_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_020828959.1|1649426_1650026_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003630236.1|1650136_1650664_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046814510.1|1650664_1651726_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003630234.1|1651727_1652402_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.7e-33
WP_012212290.1|1652446_1653859_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003630233.1|1653960_1654203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866771.1|1654380_1654989_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	2.0e-33
WP_012212288.1|1655018_1656344_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.3	2.1e-56
WP_023190785.1|1656628_1657252_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023190786.1|1657334_1657874_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003627370.1|1657887_1658436_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	38.8	1.1e-27
WP_012212286.1|1658528_1659320_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_003627368.1|1659328_1660258_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_012212285.1|1660299_1660836_-	CvpA family protein	NA	NA	NA	NA	NA
WP_012212284.1|1660997_1661720_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_012212283.1|1661734_1662574_+	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	44.0	2.7e-17
WP_003627364.1|1662589_1663369_+	ParA family protein	NA	Q8JL10	Natrialba_phage	31.5	4.3e-25
WP_065866772.1|1663346_1664231_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.7	1.4e-16
WP_003627362.1|1664223_1664487_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_003627361.1|1664536_1665637_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_012212281.1|1665645_1666428_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_023190789.1|1666541_1668266_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	7.6e-38
WP_065866924.1|1668275_1670135_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	9.6e-47
WP_012212277.1|1670313_1671000_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	9.6e-37
WP_012212276.1|1671003_1672152_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.7	2.0e-18
WP_003627351.1|1672202_1673774_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_012212275.1|1673782_1674532_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_025283944.1|1676261_1676585_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 13
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	1689604	1743244	2058319	bacteriocin,transposase	Bacillus_phage(20.0%)	45	NA	NA
WP_003631064.1|1689604_1689877_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_065866780.1|1690774_1692571_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_025283934.1|1692732_1693974_+	LCP family protein	NA	NA	NA	NA	NA
WP_041810751.1|1694728_1695253_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003630153.1|1695417_1695795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866781.1|1695803_1697345_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	28.0	1.7e-44
WP_065866782.1|1697355_1698126_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_020828971.1|1698128_1698614_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_025283928.1|1698817_1699531_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_065866783.1|1699681_1700923_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	56.8	7.4e-120
WP_003627306.1|1701162_1701699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190806.1|1701811_1702156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866784.1|1702428_1703628_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.0	2.9e-121
WP_065866785.1|1703900_1704542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866786.1|1704556_1706062_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_023190300.1|1706154_1706454_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_065866787.1|1706548_1707094_+	AAA family ATPase	NA	A0A218KC48	Bacillus_phage	31.7	1.2e-10
WP_065866788.1|1707283_1707835_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	45.2	8.6e-20
WP_065866925.1|1708241_1708625_+	ATPase	NA	NA	NA	NA	NA
WP_052541579.1|1708797_1709541_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	47.2	3.4e-19
WP_025283920.1|1709695_1710628_+	C40 family peptidase	NA	M9MUG9	Rhodococcus_phage	37.6	1.6e-13
WP_065866789.1|1710765_1711221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866790.1|1711337_1712516_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_023190766.1|1712805_1712949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866792.1|1714341_1715199_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065866793.1|1715609_1716434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866794.1|1717521_1718787_-	GTPase HflX	NA	NA	NA	NA	NA
WP_065866795.1|1719263_1720325_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	31.1	5.0e-16
WP_065866796.1|1720336_1721224_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_065866797.1|1721234_1722029_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_065866798.1|1722028_1722799_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_065866799.1|1723700_1724816_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_172619760.1|1724884_1725901_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_065866801.1|1725914_1727033_+	EpsG family protein	NA	NA	NA	NA	NA
WP_065866802.1|1727040_1728057_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_065866803.1|1728053_1728911_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065866804.1|1729791_1730781_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_065866805.1|1730777_1731827_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.4	2.4e-47
WP_065866806.1|1733640_1735104_+	flippase	NA	NA	NA	NA	NA
WP_065866807.1|1736274_1736670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866808.1|1736924_1738376_-	APC family permease	NA	NA	NA	NA	NA
WP_065866809.1|1738601_1740707_+	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_065866810.1|1740871_1741747_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.7	7.1e-77
WP_012212228.1|1741969_1742476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866811.1|1742698_1743244_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	1751995	1825729	2058319	tRNA,holin,protease,transposase	Lactobacillus_virus(23.08%)	53	NA	NA
WP_079227738.1|1751995_1753255_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.7	2.0e-125
WP_003627817.1|1753347_1753998_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_020829017.1|1754058_1754745_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_065866816.1|1754894_1757201_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012212220.1|1758740_1759301_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_023192120.1|1759359_1760274_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.6	9.5e-32
WP_003629975.1|1760308_1760881_+	elongation factor P	NA	NA	NA	NA	NA
WP_065866817.1|1760933_1762235_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_172619746.1|1762919_1763087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627831.1|1763237_1763741_-	nucleoside 2-deoxyribosyltransferase	NA	C1KFI2	Lactobacillus_virus	31.2	5.4e-13
WP_065866818.1|1763788_1764790_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_003627833.1|1764879_1765794_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_065866819.1|1765914_1767519_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.0	3.8e-15
WP_065866820.1|1767922_1768663_+	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	83.1	2.3e-121
WP_154021784.1|1770589_1770748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866821.1|1770762_1771584_+	Sir2 family NAD-dependent protein deacetylase	NA	NA	NA	NA	NA
WP_052541527.1|1771592_1772546_+	ribonuclease H-like domain-containing protein	NA	A0A0K2SUJ2	Clostridium_phage	33.1	1.5e-11
WP_003627841.1|1772636_1773491_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_003629948.1|1773532_1774960_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_065866822.1|1775213_1776299_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	3.2e-26
WP_003627844.1|1776298_1777165_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003629944.1|1777168_1777993_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_052541525.1|1777976_1779272_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_025283877.1|1779323_1780625_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_012212201.1|1780763_1781681_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_065866823.1|1781693_1782644_+	serine hydrolase	NA	NA	NA	NA	NA
WP_052541520.1|1782779_1783352_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065866824.1|1783356_1786725_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_012212197.1|1786883_1787918_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_065866825.1|1787963_1789346_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012212194.1|1791212_1791821_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	38.5	4.7e-35
WP_065866826.1|1791820_1792372_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065866827.1|1792594_1793902_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	1.8e-92
WP_012211477.1|1800458_1800860_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_065866828.1|1803054_1804065_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_065866829.1|1804083_1804896_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_065866830.1|1804924_1805845_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_012211481.1|1805848_1806217_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_065866831.1|1807245_1807761_+	acetyltransferase	NA	NA	NA	NA	NA
WP_065866832.1|1807798_1809172_-	amino acid permease	NA	NA	NA	NA	NA
WP_065866833.1|1809485_1812110_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_065866834.1|1812304_1814116_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.2	1.4e-90
WP_003626988.1|1814189_1814483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866835.1|1814841_1816167_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.5	4.3e-57
WP_003627960.1|1816196_1816805_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
WP_023190978.1|1816965_1817079_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_065866836.1|1817876_1818344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866837.1|1818297_1818855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866926.1|1818938_1819418_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_065866838.1|1819749_1820934_+	acetate kinase	NA	NA	NA	NA	NA
WP_003632732.1|1821855_1822083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866927.1|1822228_1822645_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_079227746.1|1824475_1825729_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.8	3.2e-123
>prophage 15
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	1830742	1905379	2058319	tRNA,transposase	Lactococcus_phage(14.29%)	53	NA	NA
WP_172619761.1|1830742_1831972_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.7	1.8e-126
WP_065866843.1|1832583_1833738_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_065866844.1|1834012_1835254_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.5	2.8e-119
WP_065866845.1|1835460_1837212_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	37.7	2.3e-90
WP_003632976.1|1837365_1837764_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003626960.1|1837862_1838063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211496.1|1838174_1838567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211497.1|1840251_1840947_+	SLAP domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	50.0	3.2e-11
WP_065866928.1|1841084_1842143_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_023190837.1|1842212_1842791_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	37.1	2.5e-22
WP_079227751.1|1842791_1844009_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	37.9	8.3e-15
WP_065866846.1|1844059_1844755_+	glycerophosphodiester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	31.5	1.5e-13
WP_012211503.1|1848114_1848666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866847.1|1849056_1850172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003633005.1|1850260_1850962_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003633007.1|1851025_1851412_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A0F7LBI5	uncultured_marine_virus	47.2	7.1e-13
WP_020829039.1|1852749_1853478_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_065866848.1|1853485_1854586_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_065866849.1|1854673_1856152_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.0	7.7e-116
WP_012211508.1|1856148_1856979_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	51.4	5.7e-68
WP_065866850.1|1857177_1858419_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.3	1.5e-117
WP_065866851.1|1861354_1862509_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_065866852.1|1862513_1863944_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_046813920.1|1863946_1864645_+	glycosyl transferase	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	27.6	2.1e-07
WP_003626912.1|1864632_1865103_+	SprT family protein	NA	NA	NA	NA	NA
WP_003633047.1|1865340_1865988_+	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	47.7	1.0e-27
WP_065866853.1|1866073_1868320_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.3	5.3e-132
WP_065866854.1|1868360_1870367_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	35.9	3.2e-104
WP_020829042.1|1870379_1871528_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_003633051.1|1871541_1871850_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003626902.1|1871849_1873289_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_012211519.1|1873293_1874724_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_065866855.1|1874748_1875669_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.8	9.3e-19
WP_003626897.1|1875735_1876428_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_046813922.1|1876471_1877176_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_003626893.1|1877357_1877699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046813923.1|1877735_1879112_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_003626890.1|1879476_1880829_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	48.2	1.9e-116
WP_065866856.1|1882315_1883278_-	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_065866857.1|1883296_1884475_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_065866930.1|1884495_1885281_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_012211526.1|1887345_1887546_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	1.4e-20
WP_023190958.1|1887808_1888198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866858.1|1889563_1890064_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003627960.1|1890166_1890775_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
WP_065866835.1|1890804_1892130_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.5	4.3e-57
WP_060471716.1|1896621_1896858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079227754.1|1897023_1897560_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012211430.1|1897748_1899026_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
WP_012211358.1|1901064_1902243_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_172619762.1|1902312_1902792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866861.1|1902885_1903962_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_012211358.1|1904200_1905379_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_LR698986	Lactobacillus helveticus isolate MGYG-HGUT-02384 chromosome 1	2058319	1925250	1990171	2058319	bacteriocin,transposase	Bacillus_phage(23.08%)	53	NA	NA
WP_065866866.1|1925250_1926480_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QMQ9	Streptococcus_phage	36.6	1.4e-49
WP_012211542.1|1927234_1927975_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	7.2e-38
WP_012211543.1|1927985_1928804_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012211544.1|1928803_1929445_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012211545.1|1929459_1930113_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_065866867.1|1932118_1933420_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003626829.1|1933569_1934913_-	PFL family protein	NA	NA	NA	NA	NA
WP_014919426.1|1934925_1935195_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_065866868.1|1935349_1936756_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_065866869.1|1936976_1937780_+	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_012211551.1|1937893_1938820_+	ribokinase	NA	A0A2H4N7X4	Lake_Baikal_phage	37.5	6.3e-07
WP_012211552.1|1938819_1939512_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_012211553.1|1939572_1941588_+	KUP/HAK/KT family potassium transporter	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.4	1.3e-65
WP_012211554.1|1941705_1942632_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_023190338.1|1943430_1943625_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_079227756.1|1943650_1944904_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	56.0	2.5e-115
WP_012211556.1|1945023_1945317_+	AAC(3) family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012211557.1|1945406_1946225_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003626810.1|1947277_1948072_+	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	27.6	7.3e-12
WP_012211559.1|1948083_1949361_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_012211560.1|1949335_1950574_+	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.8	4.7e-98
WP_012211561.1|1950560_1951022_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_012211562.1|1951014_1952418_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_012211563.1|1952417_1952741_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_012211564.1|1952827_1953193_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_065866871.1|1953198_1953963_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_065866872.1|1954259_1956659_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_012211567.1|1956732_1957581_+	patatin family protein	NA	NA	NA	NA	NA
WP_065866873.1|1962273_1962759_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_079227881.1|1962851_1964117_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_012211571.1|1964297_1965659_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012211570.1|1966501_1966774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023190478.1|1968406_1968976_+	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	27.6	4.9e-10
WP_012211573.1|1970309_1971014_+	lysozyme	NA	NA	NA	NA	NA
WP_065866874.1|1971013_1972246_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	28.5	2.1e-34
WP_023190482.1|1972242_1973571_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_014919182.1|1973738_1973927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211575.1|1974034_1975177_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.6	4.2e-29
WP_012211576.1|1975200_1975740_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003626773.1|1975732_1976179_-	flavodoxin	NA	NA	NA	NA	NA
WP_065866875.1|1976322_1977150_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_065866876.1|1977158_1978082_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003626768.1|1978143_1979043_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.1	6.4e-73
WP_079227881.1|1979240_1980506_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_065866877.1|1982009_1983170_+	thiolase family protein	NA	NA	NA	NA	NA
WP_065866878.1|1983169_1984381_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_023190743.1|1984380_1985544_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_065866879.1|1985582_1985867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023190745.1|1985948_1986173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866880.1|1987267_1987609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035513324.1|1987640_1987865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866881.1|1987879_1988152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866883.1|1988764_1990171_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
