The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR595855	Raoultella sp. NCTC 9189 strain NCTC9189 chromosome 1	5689207	2260338	2307611	5689207	terminase,plate,holin,head,lysis	Enterobacteria_phage(20.75%)	75	NA	NA
WP_143966893.1|2260338_2261628_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	63.7	1.9e-158
WP_143966894.1|2261672_2261918_-	excisionase family protein	NA	S4TND0	Salmonella_phage	74.1	3.9e-33
WP_143966895.1|2261932_2262172_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	50.0	2.4e-11
WP_143966896.1|2262175_2262394_-	TraR/DksA C4-type zinc finger protein	NA	A0A0N7C211	Escherichia_phage	59.4	9.5e-15
WP_143966897.1|2262390_2262768_-	DUF2591 family protein	NA	NA	NA	NA	NA
WP_143966898.1|2262764_2262950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143966899.1|2262946_2263141_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	59.5	6.3e-10
WP_143966900.1|2263137_2263359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143966901.1|2263355_2263907_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	54.9	3.8e-52
WP_143966902.1|2263903_2264062_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
WP_143966903.1|2264077_2264782_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	37.4	6.2e-23
WP_143966904.1|2264793_2265462_-	AAA family ATPase	NA	G9L667	Escherichia_phage	43.8	1.4e-48
WP_132731467.1|2265463_2266123_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	33.3	1.6e-20
WP_165905785.1|2266106_2266262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143966905.1|2266261_2266651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142523966.1|2266729_2266924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172620422.1|2267394_2267538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143966907.1|2267622_2268588_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	48.4	1.8e-76
WP_143966908.1|2268733_2268832_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_143966909.1|2268846_2269569_-	helix-turn-helix domain-containing protein	NA	E7C9R0	Salmonella_phage	62.4	5.2e-73
WP_143966910.1|2269637_2269865_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	56.7	2.0e-15
WP_132510072.1|2269904_2270225_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	69.8	1.9e-35
WP_143966911.1|2270310_2271219_+	replication protein	NA	K7PGT1	Enterobacteria_phage	49.7	3.9e-62
WP_143966912.1|2271215_2272064_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.9	1.5e-95
WP_143966913.1|2272060_2272369_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143966914.1|2272365_2272590_+	hypothetical protein	NA	H9C169	Pectobacterium_phage	50.0	3.5e-12
WP_143966916.1|2273184_2273493_+	hypothetical protein	NA	A0A1B3AZN4	Gordonia_phage	36.3	7.4e-05
WP_143966917.1|2273485_2274055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143966918.1|2274055_2274412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143966919.1|2275347_2275842_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	50.6	1.4e-08
WP_143966920.1|2275828_2276032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172620423.1|2276031_2276172_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	60.9	2.1e-07
WP_143966921.1|2276171_2276486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143966922.1|2276563_2276821_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	74.0	5.8e-27
WP_143966923.1|2277020_2277476_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	7.3e-57
WP_143966924.1|2277475_2277643_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	66.1	5.4e-10
WP_143966925.1|2277639_2278308_+	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	85.5	3.6e-113
WP_143966926.1|2278300_2278927_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	42.5	1.3e-35
WP_135184529.1|2278923_2279064_+	YlcG family protein	NA	NA	NA	NA	NA
WP_135184530.1|2279060_2279750_+	antiterminator	NA	I6PDF8	Cronobacter_phage	55.4	8.7e-62
WP_044346992.1|2280457_2280727_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	82.6	4.2e-36
WP_143967930.1|2280704_2281271_+	glycoside hydrolase family protein	NA	K7P7Q3	Enterobacteria_phage	82.4	9.0e-89
WP_135184531.1|2281270_2281738_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	77.4	7.2e-60
WP_143966927.1|2282235_2282451_+	hypothetical protein	NA	V5KSC6	Escherichia_phage	73.3	8.5e-08
WP_143966928.1|2282460_2283042_+|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	47.7	8.5e-34
WP_143966929.1|2283057_2284398_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	56.2	1.1e-132
WP_143966930.1|2284394_2285819_+	DUF1073 domain-containing protein	NA	A0A077KC81	Edwardsiella_phage	35.7	3.2e-74
WP_143967931.1|2285877_2286585_+|head	phage head morphogenesis protein	head	A0A077KGU5	Edwardsiella_phage	47.8	1.0e-49
WP_143966931.1|2286633_2287734_+	DUF2213 domain-containing protein	NA	A0A219YBB9	Aeromonas_phage	37.9	1.5e-60
WP_143966932.1|2287735_2288221_+	hypothetical protein	NA	A0A077KAW3	Edwardsiella_phage	47.8	2.9e-35
WP_143966933.1|2288220_2289246_+	hypothetical protein	NA	A0A077KC85	Edwardsiella_phage	35.3	4.6e-51
WP_143967932.1|2289375_2289579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143966934.1|2289582_2289987_+	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	40.7	7.2e-16
WP_143966935.1|2289979_2290429_+	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	56.4	1.5e-38
WP_143966936.1|2290425_2290794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143966937.1|2290775_2291327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143966938.1|2291330_2292812_+	DUF3383 family protein	NA	I2GUE7	Acinetobacter_phage	32.6	2.4e-56
WP_001518124.1|2292811_2293255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040155068.1|2293436_2294192_+	KilA-N domain-containing protein	NA	K7PGT4	Enterobacteria_phage	52.2	9.5e-62
WP_004196804.1|2294194_2294449_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	69.8	1.5e-19
WP_143966939.1|2294501_2294978_+	hypothetical protein	NA	A0A077KC08	Edwardsiella_phage	29.1	1.2e-06
WP_143966940.1|2295179_2297138_+	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	38.4	5.7e-42
WP_025713744.1|2297141_2297981_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	32.9	4.5e-28
WP_135184549.1|2297982_2298288_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	6.2e-20
WP_135184550.1|2298284_2299154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135184551.1|2299143_2299731_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	23.4	9.8e-06
WP_135184552.1|2299730_2300384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020958143.1|2300449_2300806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143966941.1|2300813_2302046_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	50.7	3.0e-105
WP_143966942.1|2302038_2302626_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	42.9	1.9e-33
WP_135184555.1|2302627_2303671_+	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	39.8	2.2e-16
WP_135185440.1|2304907_2306197_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	36.5	5.8e-67
WP_143966943.1|2306207_2306750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143966944.1|2307061_2307301_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	2.0e-21
WP_143966945.1|2307302_2307611_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	7.1e-24
>prophage 2
NZ_LR595855	Raoultella sp. NCTC 9189 strain NCTC9189 chromosome 1	5689207	2461382	2472499	5689207	integrase,transposase	Enterobacteria_phage(33.33%)	13	2457342:2457357	2473260:2473275
2457342:2457357	attL	AGTCACGCCAACGCGC	NA	NA	NA	NA
WP_041145918.1|2461382_2462408_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.2	8.2e-32
WP_041145917.1|2462702_2462792_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_041145916.1|2462955_2464122_+	MFS transporter	NA	NA	NA	NA	NA
WP_041145915.1|2464161_2464743_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_143966996.1|2464863_2465748_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	39.5	3.8e-17
WP_143966997.1|2465937_2467005_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	65.4	7.3e-132
WP_135184434.1|2466982_2467204_-	excisionase	NA	A0A1V0E5M4	Salmonella_phage	64.3	1.6e-17
WP_041145912.1|2467266_2467506_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.8	1.1e-24
WP_143966998.1|2467513_2467822_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	1.9e-24
WP_143966999.1|2467818_2468013_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	64.1	2.4e-09
WP_135184437.1|2468005_2468350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143967000.1|2468384_2469473_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.8	3.3e-108
WP_086013483.1|2471352_2472499_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	3.5e-148
2473260:2473275	attR	GCGCGTTGGCGTGACT	NA	NA	NA	NA
>prophage 3
NZ_LR595855	Raoultella sp. NCTC 9189 strain NCTC9189 chromosome 1	5689207	3073175	3142562	5689207	transposase,terminase,portal,plate,tail,holin,capsid,head,integrase	Pseudomonas_phage(13.89%)	76	3064930:3064946	3110876:3110892
3064930:3064946	attL	CGATTTCTTCACTGATG	NA	NA	NA	NA
WP_086816680.1|3073175_3074396_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_071844920.1|3074506_3074680_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_071844919.1|3074871_3074967_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_143967211.1|3075018_3075312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095097533.1|3075929_3076052_+	small membrane protein	NA	NA	NA	NA	NA
WP_041145354.1|3076708_3078133_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_041145353.1|3078155_3078962_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_143967212.1|3078951_3079881_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_143967213.1|3079882_3080896_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	56.8	6.2e-24
WP_143967214.1|3080913_3082059_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_041145349.1|3082359_3083778_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_115192872.1|3084092_3085490_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_041145347.1|3085489_3086500_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071844918.1|3086499_3086625_+	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_041145346.1|3086787_3087021_+	DUF2554 family protein	NA	NA	NA	NA	NA
WP_041145345.1|3087033_3088998_-	U32 family peptidase	NA	Q6DW11	Phage_TP	27.7	1.1e-21
WP_115192873.1|3089231_3089780_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143967215.1|3090092_3091259_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_115192875.1|3091238_3092105_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143967216.1|3092286_3093183_+	EamA family transporter	NA	NA	NA	NA	NA
WP_115192876.1|3093268_3093937_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_143967218.1|3095746_3096847_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JP34	Morganella_phage	59.0	2.0e-116
WP_143967219.1|3097746_3098295_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	91.7	8.1e-87
WP_143967220.1|3098495_3100415_+	hypothetical protein	NA	A0A0S1S0B7	Acinetobacter_phage	39.0	3.5e-100
WP_143967221.1|3100414_3101074_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	89.3	5.0e-06
WP_172620396.1|3101625_3101952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143967222.1|3101998_3102796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143967223.1|3104896_3105535_-	hypothetical protein	NA	A0A142IFY8	Pseudomonas_phage	52.5	9.7e-07
WP_143967224.1|3105616_3106279_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_143967225.1|3106275_3107424_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	31.5	3.0e-30
WP_143967226.1|3107413_3107863_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	45.9	5.4e-20
WP_143967227.1|3107859_3108438_-|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	36.4	4.2e-09
WP_143967228.1|3108437_3109514_-|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	31.9	1.4e-37
WP_143967229.1|3109510_3110911_-	DNA circularization N-terminal domain-containing protein	NA	NA	NA	NA	NA
3110876:3110892	attR	CATCAGTGAAGAAATCG	NA	NA	NA	NA
WP_143967230.1|3110981_3111716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143967231.1|3111772_3113608_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	41.0	2.2e-19
WP_143967232.1|3113752_3114031_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_143967233.1|3114034_3114403_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_143967234.1|3114406_3115924_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	43.8	9.7e-106
WP_116955723.1|3115924_3116104_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_116955722.1|3116107_3116653_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_116955721.1|3116649_3117012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143967235.1|3117017_3117398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143967236.1|3117399_3118449_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.4	2.8e-51
WP_116955719.1|3118546_3118951_-|head	head decoration protein	head	NA	NA	NA	NA
WP_172620433.1|3118950_3119526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075594564.1|3119527_3120397_-	S49 family peptidase	NA	K4I1N3	Providencia_phage	39.4	3.5e-52
WP_136071036.1|3120393_3121989_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.9	3.0e-89
WP_074193870.1|3122045_3122267_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_143967238.1|3122306_3124433_-|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	34.6	2.0e-96
WP_143967239.1|3124374_3124938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143967240.1|3125273_3125546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136895638.1|3125671_3126310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075594565.1|3126740_3127091_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	42.6	1.4e-12
WP_112150559.1|3127316_3127856_-	lysozyme	NA	K7PM52	Enterobacteria_phage	79.0	1.0e-81
WP_040225058.1|3127857_3128106_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_064359410.1|3129237_3129816_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	55.0	6.0e-48
WP_064359411.1|3129829_3130810_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.6	6.0e-133
WP_064359412.1|3130806_3131493_-	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	56.0	1.8e-59
WP_064159787.1|3131507_3131897_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	74.4	2.1e-49
WP_143967241.1|3131906_3132731_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.9	1.4e-114
WP_064359414.1|3132936_3133851_-	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	60.6	2.4e-30
WP_073972286.1|3133807_3134020_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.5	2.2e-16
WP_143967242.1|3134257_3134713_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.5	7.7e-67
WP_049186510.1|3134713_3134944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071995740.1|3134972_3135242_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	49.3	2.9e-13
WP_143967243.1|3135344_3135827_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	41.5	1.7e-11
WP_103468726.1|3135998_3137156_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	28.6	2.4e-35
WP_143967244.1|3137470_3138388_+	recombination-associated protein RdgC	NA	A0A1Y0SUG1	Pseudomonas_phage	35.7	4.3e-40
WP_143967245.1|3139153_3139969_+	ParB N-terminal domain-containing protein	NA	K7PKM7	Enterobacterial_phage	56.5	1.9e-71
WP_064359970.1|3140102_3140447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143967246.1|3140439_3141063_+	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	46.5	3.3e-44
WP_064359972.1|3141059_3141437_+	DUF2591 family protein	NA	F8TVJ2	EBPR_siphovirus	29.7	9.1e-05
WP_064359973.1|3141433_3141859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064359980.1|3141855_3142257_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	75.9	3.0e-54
WP_143967247.1|3142253_3142562_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	6.5e-25
>prophage 4
NZ_LR595855	Raoultella sp. NCTC 9189 strain NCTC9189 chromosome 1	5689207	3253731	3262746	5689207	integrase,tRNA	Escherichia_phage(50.0%)	7	3251516:3251532	3269784:3269800
3251516:3251532	attL	TCAATACCGTGATGCAG	NA	NA	NA	NA
WP_041145247.1|3253731_3254850_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.5	3.4e-116
WP_041145246.1|3254995_3255208_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_041145245.1|3255289_3255724_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	49.7	1.8e-28
WP_143967291.1|3255931_3258601_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	48.4	4.4e-101
WP_172620477.1|3259931_3260282_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	68.1	2.4e-31
WP_041145244.1|3260388_3261324_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	91.4	1.1e-136
WP_041145243.1|3261372_3262746_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.4	1.1e-50
3269784:3269800	attR	TCAATACCGTGATGCAG	NA	NA	NA	NA
>prophage 5
NZ_LR595855	Raoultella sp. NCTC 9189 strain NCTC9189 chromosome 1	5689207	3540105	3592159	5689207	transposase,terminase,portal,integrase,tail,protease,holin,head,capsid,tRNA	Klebsiella_phage(24.44%)	63	3554743:3554758	3593113:3593128
WP_086013483.1|3540105_3541252_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	3.5e-148
WP_143967386.1|3541882_3542776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143967387.1|3542982_3544011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143967388.1|3544111_3544861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143967955.1|3544862_3546341_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	36.5	4.9e-70
WP_143967389.1|3547025_3550091_-	kinase	NA	A0A286S259	Klebsiella_phage	66.6	0.0e+00
WP_143967390.1|3550087_3550474_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	51.6	7.3e-34
WP_106510754.1|3550481_3550964_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	1.4e-53
WP_143967391.1|3550950_3551430_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	82.4	1.4e-79
WP_143967392.1|3551429_3553853_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	82.1	0.0e+00
WP_143967393.1|3553923_3554316_-	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	40.6	3.6e-20
WP_143967394.1|3554379_3554643_-|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	94.3	2.2e-42
WP_143967395.1|3554675_3555029_-|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	80.3	1.6e-48
3554743:3554758	attL	CCATCGAGCGCACCAC	NA	NA	NA	NA
WP_143967396.1|3555071_3555554_-|tail	phage tail protein	tail	Q9MCU9	Escherichia_phage	57.1	1.7e-48
WP_131055188.1|3555973_3556513_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	88.8	5.7e-85
WP_131055190.1|3556505_3556856_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	62.6	5.6e-33
WP_143967397.1|3556857_3557055_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	90.8	1.3e-23
WP_143967398.1|3557120_3557453_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_131055363.1|3557458_3557710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131055194.1|3557755_3558976_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	62.1	2.3e-134
WP_025713387.1|3558985_3559693_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	2.2e-68
WP_131055199.1|3559668_3560988_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	59.1	7.6e-139
WP_143967399.1|3560994_3562731_-|terminase	terminase large subunit	terminase	M4QNU0	Tetraselmis_viridis_virus	44.6	2.9e-138
WP_014838137.1|3562684_3563149_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	6.3e-48
WP_143967956.1|3563330_3563681_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.4	8.4e-45
WP_143967400.1|3563934_3564999_-	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	28.4	7.0e-26
WP_143967957.1|3565355_3565625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143967401.1|3565630_3565867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143967402.1|3565869_3566340_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	83.4	5.0e-69
WP_138827759.1|3566433_3566715_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	72.0	6.5e-32
WP_143967403.1|3566701_3567097_-	hypothetical protein	NA	G8C7V8	Escherichia_phage	71.5	4.7e-44
WP_167874851.1|3567448_3567601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172620436.1|3567603_3568449_-	hypothetical protein	NA	A0A1B2IGT1	Erwinia_phage	72.0	9.9e-108
WP_071830677.1|3568684_3569143_+	hypothetical protein	NA	U5P096	Shigella_phage	35.2	9.7e-17
WP_143967404.1|3570042_3570369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143967405.1|3570546_3571368_+	hypothetical protein	NA	C9E2Q0	Enterococcus_phage	34.6	1.5e-28
WP_143967406.1|3571419_3571785_-	antitermination protein Q	NA	U5P0A5	Shigella_phage	80.0	4.8e-51
WP_143967407.1|3571802_3572861_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	54.7	3.7e-112
WP_143967408.1|3572869_3573394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172620437.1|3573390_3574272_-	antA/AntB antirepressor family protein	NA	Q8W644	Enterobacteria_phage	61.2	2.7e-52
WP_143967409.1|3574349_3574748_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	68.8	1.9e-45
WP_143967410.1|3574747_3575221_-|protease	SOS-response repressor and protease LexA	protease	A0A291AWY9	Escherichia_phage	56.9	3.5e-14
WP_143967411.1|3575217_3577068_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.9	1.0e-197
WP_143967961.1|3577060_3577966_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	61.2	4.9e-105
WP_143967412.1|3578156_3578618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143967413.1|3578614_3579526_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	74.3	9.8e-53
WP_087730925.1|3579515_3579695_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.1e-14
WP_143967414.1|3579867_3580419_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	68.3	1.1e-67
WP_143967415.1|3580447_3580657_-	cell division protein	NA	NA	NA	NA	NA
WP_087730921.1|3580757_3581384_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.3	3.2e-47
WP_143967416.1|3581765_3582251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143967419.1|3583144_3583516_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	87.8	3.8e-56
WP_143967420.1|3583562_3584390_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	72.0	3.2e-111
WP_026056029.1|3584531_3585059_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	68.6	1.3e-62
WP_143967421.1|3585058_3585259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143967422.1|3585251_3586037_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	1.1e-63
WP_143967423.1|3586164_3586677_+	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	37.8	2.0e-15
WP_143967424.1|3586794_3587040_+	excisionase	NA	NA	NA	NA	NA
WP_143967425.1|3587020_3588148_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	59.5	1.8e-120
WP_041145017.1|3588267_3589518_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.9	9.7e-19
WP_041145016.1|3589751_3590402_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_143716938.1|3590420_3590867_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_141334716.1|3591052_3592159_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3593113:3593128	attR	CCATCGAGCGCACCAC	NA	NA	NA	NA
>prophage 6
NZ_LR595855	Raoultella sp. NCTC 9189 strain NCTC9189 chromosome 1	5689207	3708160	3744541	5689207	terminase,portal,integrase,plate,tail,head,capsid	Enterobacteria_phage(45.16%)	50	3709584:3709604	3744612:3744632
WP_041144912.1|3708160_3708334_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
WP_041144911.1|3708716_3709313_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_041144910.1|3709333_3709561_+	hypothetical protein	NA	NA	NA	NA	NA
3709584:3709604	attL	AACCCGGATTGCTCCGGGTTT	NA	NA	NA	NA
WP_117022121.1|3709713_3710100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117083863.1|3710354_3710603_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_135184921.1|3710647_3711802_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.7	1.9e-178
WP_135184922.1|3711954_3713136_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	69.8	7.2e-157
WP_023328126.1|3713135_3713651_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.8	3.1e-64
WP_135184923.1|3713705_3714005_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	75.8	2.2e-33
WP_071836356.1|3714001_3714178_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	3.0e-11
WP_135184924.1|3714158_3717104_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	44.5	2.5e-206
WP_064363122.1|3717113_3717602_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.1	8.9e-53
WP_135184925.1|3717729_3718806_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	51.3	2.9e-35
WP_143967448.1|3718826_3719564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135185468.1|3719568_3720858_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	39.1	1.6e-69
WP_135184929.1|3721990_3722596_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	47.0	2.0e-41
WP_135184930.1|3722588_3723488_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.2	4.0e-91
WP_135184931.1|3723474_3723843_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	58.3	1.0e-29
WP_135184932.1|3723839_3724424_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	63.0	6.0e-64
WP_135184933.1|3724423_3725065_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	47.3	9.9e-44
WP_135184934.1|3725061_3725520_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.8	4.5e-30
WP_135184936.1|3725664_3726060_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_135184937.1|3726056_3726608_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.3	7.8e-29
WP_080850474.1|3726604_3726886_-	hypothetical protein	NA	B9A7B8	Serratia_phage	54.5	7.0e-18
WP_047662772.1|3726876_3727077_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	66.2	5.1e-15
WP_135184938.1|3727076_3727574_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	69.7	3.8e-59
WP_135184939.1|3727676_3728603_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	75.3	1.5e-85
WP_135184940.1|3728649_3729696_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.2	3.1e-103
WP_135184941.1|3729720_3730554_-|capsid	GPO family capsid scaffolding protein	capsid	B9A7B4	Serratia_phage	73.6	1.2e-110
WP_135184942.1|3730711_3732433_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	65.8	4.5e-224
WP_135184943.1|3732432_3733485_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	67.5	4.6e-139
WP_064363226.1|3733943_3734288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077266616.1|3734287_3734695_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_064363228.1|3734800_3735115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117037663.1|3735236_3735650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135185469.1|3735680_3736382_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	69.3	3.8e-89
WP_135185470.1|3736484_3738728_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	44.2	2.7e-136
WP_162893500.1|3739041_3739197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162893501.1|3739207_3739381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143967449.1|3740329_3740524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080847087.1|3740520_3740748_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	40.6	7.1e-05
WP_143967450.1|3740756_3741302_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	27.2	1.6e-10
WP_143967451.1|3741294_3741522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080850602.1|3741590_3741863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143967452.1|3741870_3742080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135184946.1|3742076_3742316_-	DUF4754 family protein	NA	NA	NA	NA	NA
WP_135185471.1|3742328_3742541_-	DUF4761 domain-containing protein	NA	NA	NA	NA	NA
WP_082237315.1|3742716_3743049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116956178.1|3743143_3743446_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	62.0	8.8e-27
WP_143716976.1|3743533_3744541_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.9	1.9e-97
3744612:3744632	attR	AACCCGGATTGCTCCGGGTTT	NA	NA	NA	NA
>prophage 7
NZ_LR595855	Raoultella sp. NCTC 9189 strain NCTC9189 chromosome 1	5689207	3903975	3913713	5689207	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_135184983.1|3903975_3905697_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	3.4e-14
WP_143967492.1|3905841_3906546_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|3907056_3907275_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_076945049.1|3907411_3909691_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	2.1e-165
WP_041144775.1|3909721_3910039_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.9	9.0e-14
WP_041144774.1|3910364_3910586_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	5.1e-16
WP_143967493.1|3910654_3912601_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	3.8e-38
WP_041144772.1|3912597_3913713_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	47.1	2.4e-05
>prophage 8
NZ_LR595855	Raoultella sp. NCTC 9189 strain NCTC9189 chromosome 1	5689207	4606032	4611838	5689207		Enterobacteria_phage(100.0%)	8	NA	NA
WP_123550889.1|4606032_4606599_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	1.3e-58
WP_143967678.1|4606616_4606862_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	7.2e-19
WP_143967679.1|4606858_4607596_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.2	5.4e-70
WP_143967680.1|4608137_4608404_+	AlpA family phage regulatory protein	NA	Q7M299	Enterobacteria_phage	70.5	9.8e-30
WP_143967681.1|4608400_4608952_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	66.7	2.4e-30
WP_004098168.1|4608948_4609176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185276.1|4609172_4609493_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_143967682.1|4609504_4611838_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	81.3	0.0e+00
