The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR594659	Variovorax sp. PBL-H6 chromosome 1	5990237	3431628	3473625	5990237	terminase,capsid,protease,head,integrase	uncultured_marine_virus(12.5%)	50	3466336:3466384	3477931:3477979
WP_162575126.1|3431628_3431994_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_162575127.1|3432418_3433600_-|capsid	phage major capsid protein	capsid	A0A0F7L2V9	uncultured_marine_virus	34.5	1.1e-35
WP_162575128.1|3433614_3434175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162575129.1|3434273_3434816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162575130.1|3434812_3435007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162577501.1|3435133_3435349_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_162575131.1|3435465_3435993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162575132.1|3435989_3436622_-	DUF3102 domain-containing protein	NA	NA	NA	NA	NA
WP_162575133.1|3436731_3437226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162575134.1|3437226_3437556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162575135.1|3437552_3437795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162575136.1|3437791_3437983_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_162575137.1|3438054_3438768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162575138.1|3438764_3438965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162575139.1|3439205_3439544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162575140.1|3439679_3440924_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	46.5	2.4e-94
WP_162575141.1|3441264_3441645_+	response regulator	NA	NA	NA	NA	NA
WP_162575142.1|3441691_3442909_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_162575143.1|3443046_3443442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162575144.1|3443438_3443876_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_162575145.1|3443881_3445375_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	39.3	2.2e-46
WP_162575146.1|3445396_3446506_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_162575147.1|3446502_3447609_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_162575148.1|3447617_3447989_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
WP_162575149.1|3448052_3448994_+	CysB family HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_162575150.1|3448990_3450157_+	methionine aminotransferase	NA	NA	NA	NA	NA
WP_106556648.1|3450266_3450425_+	DUF3309 domain-containing protein	NA	NA	NA	NA	NA
WP_162575151.1|3450506_3454472_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	29.6	1.3e-48
WP_162575152.1|3454470_3455817_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_162575153.1|3455828_3457040_+	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_162575154.1|3457036_3457861_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_162575155.1|3457915_3459064_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_162575156.1|3459073_3460255_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_162575157.1|3460251_3461118_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_162575158.1|3461114_3463073_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.6	1.2e-60
WP_162575159.1|3463845_3464067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162575160.1|3464130_3464325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162575161.1|3464466_3464994_+	dual specificity protein phosphatase family protein	NA	NA	NA	NA	NA
WP_162577502.1|3465781_3466279_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
3466336:3466384	attL	CTGGTAGGACGTACAAGATTCGAACTTGTGACCAACGGATTAAAAGTCC	NA	NA	NA	NA
WP_162577503.1|3466601_3467891_+|integrase	integrase	integrase	A0A248SL35	Klebsiella_phage	27.0	3.3e-14
WP_162575162.1|3468010_3468364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162575163.1|3468356_3468575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162575164.1|3468580_3469312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162577504.1|3469513_3469738_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162575165.1|3469748_3470009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162575166.1|3469989_3470568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162575167.1|3470577_3471111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162575168.1|3471107_3471728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162575169.1|3471859_3473089_+|capsid	phage major capsid protein	capsid	R9TPU0	Vibrio_phage	30.8	8.6e-36
WP_162575170.1|3473097_3473625_+|head,protease	HK97 family phage prohead protease	head,protease	B4UTP2	Rhizobium_phage	49.0	2.8e-28
3477931:3477979	attR	CTGGTAGGACGTACAAGATTCGAACTTGTGACCAACGGATTAAAAGTCC	NA	NA	NA	NA
>prophage 2
NZ_LR594659	Variovorax sp. PBL-H6 chromosome 1	5990237	4792432	4802705	5990237	tRNA	Vibrio_phage(16.67%)	10	NA	NA
WP_162576278.1|4792432_4793290_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	39.0	2.7e-44
WP_162576279.1|4793286_4794180_-	alpha/beta fold hydrolase	NA	A0A023W7H4	Mycobacterium_phage	26.1	4.5e-10
WP_174258336.1|4794214_4795075_-	2OG-Fe(II) oxygenase	NA	M1HVC9	Paramecium_bursaria_Chlorella_virus	35.7	8.7e-19
WP_162576281.1|4795053_4795839_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_162576282.1|4796022_4798893_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.9	3.2e-142
WP_162576283.1|4798979_4799870_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.5	4.7e-68
WP_162576284.1|4799850_4800969_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_162576285.1|4800981_4801209_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_162576286.1|4801239_4801797_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_162576287.1|4801802_4802705_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.2	1.3e-57
>prophage 3
NZ_LR594659	Variovorax sp. PBL-H6 chromosome 1	5990237	5344845	5354914	5990237		Acinetobacter_phage(37.5%)	11	NA	NA
WP_162576716.1|5344845_5346039_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	28.7	9.0e-14
WP_162576717.1|5346651_5347356_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	47.2	4.7e-47
WP_162576718.1|5347352_5348153_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	50.2	2.2e-56
WP_162576719.1|5348166_5349192_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	45.3	4.2e-76
WP_162576720.1|5349210_5349873_-	LysE family transporter	NA	NA	NA	NA	NA
WP_162576721.1|5349865_5350915_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_162576722.1|5350919_5351504_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	3.2e-57
WP_162576723.1|5351500_5351890_-	GxxExxY protein	NA	A9YW17	Ostreococcus_tauri_virus	29.0	7.2e-05
WP_162576724.1|5351889_5353392_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	29.7	9.5e-37
WP_162576725.1|5353634_5354141_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162576726.1|5354137_5354914_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	45.5	3.2e-12
>prophage 1
NZ_LR594660	Variovorax sp. PBL-H6 plasmid 2	839194	9851	16875	839194	transposase	Bacillus_phage(33.33%)	6	NA	NA
WP_068673609.1|9851_10799_-	thymidylate synthase	NA	A0A0M3MWR4	Testudinid_herpesvirus	33.8	3.7e-39
WP_068673611.1|10976_11591_-	transglycosylase SLT domain-containing protein	NA	A0A1L7N0Z2	Ralstonia_phage	38.4	9.3e-15
WP_162571143.1|11871_12531_+	hypothetical protein	NA	A0A141HRW8	Bacillus_phage	37.9	4.0e-32
WP_162571147.1|12620_14144_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.8	6.5e-17
WP_162570835.1|14136_14976_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.0	5.7e-31
WP_162571142.1|15087_16875_+	DNA topoisomerase IV subunit A	NA	A0A141HRZ7	Bacillus_phage	25.8	5.6e-28
>prophage 2
NZ_LR594660	Variovorax sp. PBL-H6 plasmid 2	839194	153161	159770	839194		Wolbachia_phage(16.67%)	9	NA	NA
WP_162487226.1|153161_154073_-	S49 family peptidase	NA	F8QZT1	Wolbachia_phage	28.7	3.6e-15
WP_068673909.1|154172_154565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146041332.1|154725_155064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068673913.1|155252_155840_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	40.4	1.0e-26
WP_068673915.1|156134_156680_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A248SJV3	Salicola_phage	47.2	2.4e-46
WP_068673919.1|157524_158058_-	macro domain-containing protein	NA	H6X3J2	Enterobacteria_phage	32.7	6.8e-14
WP_068673922.1|158116_158614_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_068673924.1|158636_159083_-	NUDIX hydrolase	NA	A0A023W5N2	Serratia_phage	45.6	1.1e-20
WP_162571056.1|159095_159770_-	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	30.2	4.0e-19
>prophage 3
NZ_LR594660	Variovorax sp. PBL-H6 plasmid 2	839194	461018	502832	839194	tRNA,transposase,integrase	Salmonella_phage(55.56%)	22	466674:466692	508244:508262
WP_162570839.1|461018_463562_-|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SJ93	Klosneuvirus	24.8	3.3e-58
WP_068674326.1|464034_464373_+	hypothetical protein	NA	A0A222YZD3	Escherichia_phage	55.7	2.7e-24
WP_162570838.1|464380_464650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162570837.1|464827_465007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162570836.1|465097_465727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162570835.1|465839_466679_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.0	5.7e-31
WP_162571147.1|466671_468195_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.8	6.5e-17
466674:466692	attL	ACGCATGACGCACCTCCTG	NA	NA	NA	NA
WP_003158660.1|468506_471422_+|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
WP_162572158.1|473517_474945_-	amidase	NA	NA	NA	NA	NA
WP_162577736.1|475031_475505_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_162577737.1|475501_476062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108499742.1|482495_483056_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	7.3e-51
WP_162572169.1|483365_483698_-	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_162572160.1|483915_484218_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_003158660.1|485057_487973_+|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
WP_162577738.1|489976_491008_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_162572158.1|491094_492522_+	amidase	NA	NA	NA	NA	NA
WP_003158660.1|494618_497534_-|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
WP_162572161.1|497648_497813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108499742.1|501109_501670_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	7.3e-51
WP_162572169.1|501979_502312_-	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_162572160.1|502529_502832_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
508244:508262	attR	ACGCATGACGCACCTCCTG	NA	NA	NA	NA
