The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR593887	Tuwongella immobilis isolate MBLW1 chromosome 1	6690754	3191197	3199878	6690754	terminase	Aggregatibacter_phage(16.67%)	7	NA	NA
WP_162658191.1|3191197_3192679_-	heat-shock protein Hsp70	NA	D0UIJ7	Aggregatibacter_phage	40.7	6.0e-84
WP_162658192.1|3192638_3193166_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	42.6	9.4e-24
WP_162658193.1|3193556_3194426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162658194.1|3194653_3196759_-	bifunctional DNA primase/polymerase	NA	A0A173H0P8	Pseudoalteromonas_phage	24.1	8.9e-49
WP_162658195.1|3196752_3198720_-	DEAD/DEAH box helicase family protein	NA	A0A1J0GWD7	Alteromonas_phage	37.8	1.5e-95
WP_162658196.1|3198716_3199292_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0H5AUD2	Pseudomonas_phage	44.6	7.1e-17
WP_162658197.1|3199362_3199878_-	DUF669 domain-containing protein	NA	A0A2I7QNK9	Vibrio_phage	49.6	3.2e-24
>prophage 2
NZ_LR593887	Tuwongella immobilis isolate MBLW1 chromosome 1	6690754	3984243	4060530	6690754	transposase,integrase,tRNA	Escherichia_phage(25.0%)	59	4046005:4046024	4062399:4062418
WP_162661508.1|3984243_3987102_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	48.5	8.4e-252
WP_162658855.1|3987078_3987843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658856.1|3987827_3988847_-	adenosyl-hopene transferase HpnH	NA	NA	NA	NA	NA
WP_174250796.1|3988871_3990800_-	squalene--hopene cyclase	NA	NA	NA	NA	NA
WP_162658858.1|3991207_3993436_+	FG-GAP repeat protein	NA	A0A2K9L1M9	Tupanvirus	33.1	2.2e-05
WP_162658859.1|3993456_3996417_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_162658860.1|3996565_3998029_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_162661510.1|3998056_4001239_-	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_162658861.1|4001520_4003464_+	DUF1592 domain-containing protein	NA	NA	NA	NA	NA
WP_162658862.1|4003475_4004858_+	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_162658863.1|4005095_4005722_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162658864.1|4005782_4006862_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_162658865.1|4006858_4010086_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_162658866.1|4010332_4012270_-	DUF4129 domain-containing protein	NA	NA	NA	NA	NA
WP_162658867.1|4012296_4013196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658868.1|4013384_4014323_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_162658869.1|4014430_4015015_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162658870.1|4015032_4015848_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_162658871.1|4015844_4017062_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_162658872.1|4017204_4018074_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	29.5	8.5e-22
WP_162658873.1|4018078_4019878_+	DUF3365 domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.5	1.9e-23
WP_162658874.1|4019965_4020556_+	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_162658875.1|4020642_4021497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162658876.1|4021699_4022170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658877.1|4022317_4023214_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_162658878.1|4023855_4025172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162658879.1|4025376_4026693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162658880.1|4028041_4028320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162658881.1|4028312_4028816_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162658882.1|4028908_4029085_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162658883.1|4029177_4029468_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162658884.1|4029948_4030476_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_162658885.1|4030505_4031426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658886.1|4031633_4032344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658887.1|4032343_4033237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658888.1|4033500_4033935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658889.1|4034208_4034739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658890.1|4035017_4035824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658891.1|4035950_4036844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658892.1|4037054_4037651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658893.1|4037731_4038622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658894.1|4038730_4039474_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_162658895.1|4039520_4039979_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_162658896.1|4039987_4040488_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162661512.1|4040418_4040898_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162658897.1|4040884_4041394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658898.1|4042984_4043428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658899.1|4043441_4044254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658900.1|4044553_4044850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658901.1|4044910_4045759_-	hypothetical protein	NA	NA	NA	NA	NA
4046005:4046024	attL	AAGCGAGCGAACGAACAAAG	NA	NA	NA	NA
WP_162658902.1|4046223_4047459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162658903.1|4048532_4049726_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_174250769.1|4050380_4053098_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_162658904.1|4053137_4053533_-	GxxExxY protein	NA	E5ESB4	Bathycoccus_sp._RCC1105_virus	35.8	6.2e-12
WP_162658905.1|4053899_4055519_-	site-specific DNA-methyltransferase	NA	A0A023MI13	Escherichia_phage	43.1	2.7e-90
WP_162658906.1|4055515_4056574_-	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	41.0	3.3e-20
WP_162658907.1|4056593_4057229_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_162658908.1|4057225_4060021_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	44.4	1.8e-214
WP_162661516.1|4060326_4060530_+|transposase	transposase	transposase	NA	NA	NA	NA
4062399:4062418	attR	AAGCGAGCGAACGAACAAAG	NA	NA	NA	NA
>prophage 3
NZ_LR593887	Tuwongella immobilis isolate MBLW1 chromosome 1	6690754	4309628	4335757	6690754	head,portal,tail,capsid,terminase,protease,integrase	environmental_Halophage(22.22%)	37	4306102:4306117	4326301:4326316
4306102:4306117	attL	GCGTCGCTCCATCGCC	NA	NA	NA	NA
WP_162659077.1|4309628_4310822_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_162659078.1|4311084_4311573_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_162659079.1|4312020_4313358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162659080.1|4313415_4313673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162659081.1|4313867_4314092_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_162659082.1|4314084_4314465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659083.1|4314461_4314971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162658101.1|4315170_4315392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659084.1|4315434_4315659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659085.1|4315651_4315990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659086.1|4316000_4316804_+	hypothetical protein	NA	A0A1B1IQW3	uncultured_Mediterranean_phage	37.8	1.9e-15
WP_162659087.1|4316810_4317203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659088.1|4317218_4318316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659089.1|4318303_4318933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659090.1|4318970_4319303_+	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_162659091.1|4319306_4319606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659092.1|4319618_4320104_+	hypothetical protein	NA	A0A0K0N6C7	Gordonia_phage	35.0	9.0e-05
WP_162659093.1|4320125_4320689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659094.1|4320681_4321434_+	DUF5131 family protein	NA	A0A142F2K7	Mycobacterium_phage	44.8	2.5e-54
WP_162659095.1|4321436_4322000_+	DUF4326 domain-containing protein	NA	A0A0S0N995	Pseudomonas_phage	39.6	1.0e-12
WP_162659096.1|4322097_4322346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659097.1|4322342_4323134_+	site-specific DNA-methyltransferase	NA	A0A0M4JJT6	Mollivirus	33.2	3.0e-34
WP_162659098.1|4323165_4323663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659099.1|4323895_4324672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659100.1|4324752_4325514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659101.1|4325626_4325899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659102.1|4325895_4326423_+	hypothetical protein	NA	NA	NA	NA	NA
4326301:4326316	attR	GGCGATGGAGCGACGC	NA	NA	NA	NA
WP_162659103.1|4326355_4327597_+|terminase	phage terminase large subunit	terminase	A0A1X9SGU8	Bradyrhizobium_phage	43.2	1.3e-36
WP_162659104.1|4327639_4329208_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_162659105.1|4329204_4329492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659106.1|4329495_4330272_+	hypothetical protein	NA	H9YRS9	environmental_Halophage	32.5	9.0e-07
WP_162659107.1|4330284_4331499_+|head,protease	HK97 family phage prohead protease	head,protease	H9YSG6	environmental_Halophage	25.3	2.6e-08
WP_162659108.1|4331532_4332942_+|capsid	phage major capsid protein	capsid	D6PFE3	uncultured_phage	26.9	6.0e-17
WP_162659109.1|4332999_4333401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659110.1|4333620_4333839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659111.1|4334212_4335043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162659112.1|4335046_4335757_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
>prophage 4
NZ_LR593887	Tuwongella immobilis isolate MBLW1 chromosome 1	6690754	6413326	6420365	6690754	terminase	Brucella_phage(16.67%)	9	NA	NA
WP_162660672.1|6413326_6414457_+	AAA family ATPase	NA	X2CXS1	Brucella_phage	23.7	1.5e-10
WP_162660674.1|6414453_6415101_+	YqaJ viral recombinase family protein	NA	A0A0B5D133	Listeria_phage	29.1	3.4e-07
WP_162657350.1|6415097_6416135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162660675.1|6416131_6416797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162660677.1|6416793_6417162_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0H5AUD2	Pseudomonas_phage	47.8	9.8e-20
WP_162660679.1|6417155_6417371_+	carbon storage regulator	NA	NA	NA	NA	NA
WP_162660681.1|6417380_6418112_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	48.4	2.5e-59
WP_162660683.1|6418276_6418846_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	38.5	6.2e-21
WP_162660685.1|6418778_6420365_+	hypothetical protein	NA	Q7Y5U7	Haemophilus_phage	33.9	7.4e-64
