The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS999833	Lentilitoribacter sp. Alg239-R112 chromosome I	2695248	695543	709230	2695248	capsid,portal,tail,head,protease	Dinoroseobacter_phage(20.0%)	15	NA	NA
WP_162651818.1|695543_699404_-	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0K1Y6G6	Rhodobacter_phage	37.8	2.5e-214
WP_162651819.1|699427_699862_-	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	43.7	6.1e-29
WP_162651820.1|699858_700752_-	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	45.1	2.4e-64
WP_162651821.1|700748_701384_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	46.1	4.4e-44
WP_162651822.1|701418_702009_-|tail	phage tail tape measure protein	tail	A0A0P0ZBQ1	Stx2-converting_phage	37.4	1.4e-07
WP_162651823.1|702023_702176_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_162653542.1|702268_702640_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_162651824.1|702657_703065_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_162651825.1|703086_703497_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_162653543.1|703654_703963_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_162651826.1|703989_704556_-|head,tail	phage head-tail connector protein	head,tail	A0A223LGP4	Pseudoalteromonas_phage	28.8	5.6e-06
WP_162651827.1|704658_705936_-|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	40.0	1.2e-80
WP_162651828.1|705976_706552_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	42.4	2.0e-27
WP_162653544.1|706614_707778_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	36.2	1.0e-62
WP_162651829.1|707865_709230_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	42.0	4.2e-84
>prophage 2
NZ_LS999833	Lentilitoribacter sp. Alg239-R112 chromosome I	2695248	1251350	1266837	2695248	tRNA	uncultured_Mediterranean_phage(50.0%)	14	NA	NA
WP_162652285.1|1251350_1252169_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.5	3.3e-52
WP_162652286.1|1252186_1252966_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_162652287.1|1252962_1253946_-	KpsF/GutQ family sugar-phosphate isomerase	NA	E5E465	Acinetobacter_phage	35.1	7.1e-17
WP_162652288.1|1254141_1255131_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	34.5	7.4e-46
WP_162652289.1|1255135_1256257_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	53.6	3.2e-106
WP_162652290.1|1256265_1257327_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_162652291.1|1257354_1257828_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	55.0	8.4e-40
WP_162652292.1|1257853_1258414_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	58.8	1.3e-47
WP_162652293.1|1258490_1258991_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.4	1.2e-25
WP_162652294.1|1259044_1261846_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.6	4.9e-95
WP_162652295.1|1262030_1262660_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_162653587.1|1262673_1263036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162653588.1|1263142_1263655_-	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	54.1	3.6e-44
WP_162652296.1|1263939_1266837_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	61.0	0.0e+00
>prophage 3
NZ_LS999833	Lentilitoribacter sp. Alg239-R112 chromosome I	2695248	1309780	1320023	2695248	tRNA	uncultured_Mediterranean_phage(77.78%)	11	NA	NA
WP_162652332.1|1309780_1311502_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0Y0AH42	Bacillus_phage	35.9	1.6e-08
WP_162652333.1|1311609_1312263_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	NA	NA	NA	NA
WP_162652334.1|1312265_1313021_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	37.8	4.3e-38
WP_162652335.1|1313050_1314331_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.9	4.5e-96
WP_162652336.1|1314383_1315214_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	42.3	6.0e-49
WP_162652337.1|1315210_1315831_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_162652338.1|1315876_1316077_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	62.8	3.3e-06
WP_162652339.1|1316115_1317219_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	29.3	5.4e-13
WP_162653596.1|1317268_1318009_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	44.6	3.2e-38
WP_162653597.1|1318032_1318866_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.7	1.2e-36
WP_162652340.1|1318991_1320023_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	41.1	1.0e-21
>prophage 4
NZ_LS999833	Lentilitoribacter sp. Alg239-R112 chromosome I	2695248	1377349	1388630	2695248		Cellulophaga_phage(16.67%)	8	NA	NA
WP_162652390.1|1377349_1377841_+	xanthine phosphoribosyltransferase	NA	M4T1R9	Cellulophaga_phage	28.2	4.4e-07
WP_162652391.1|1377915_1380105_-	esterase-like activity of phytase family protein	NA	E3SJA5	Synechococcus_phage	46.8	5.5e-94
WP_162652392.1|1380747_1384485_+	vitamin B12-dependent ribonucleotide reductase	NA	A0A1X9SGV9	Bradyrhizobium_phage	54.2	0.0e+00
WP_162652393.1|1384565_1385312_+	metallophosphoesterase	NA	S5MD19	Sinorhizobium_phage	32.0	1.7e-26
WP_162652394.1|1385410_1386499_+	serine hydrolase	NA	NA	NA	NA	NA
WP_162652395.1|1386501_1386894_-	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	30.5	5.7e-10
WP_162652396.1|1386993_1387389_-	SUF system Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_162652397.1|1387397_1388630_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.2	1.8e-94
>prophage 5
NZ_LS999833	Lentilitoribacter sp. Alg239-R112 chromosome I	2695248	1994231	2057112	2695248	integrase,transposase	Bacillus_virus(33.33%)	58	2027611:2027651	2057225:2057265
WP_162652898.1|1994231_1995140_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	34.0	5.0e-33
WP_162652899.1|1995172_1995469_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162652900.1|1995465_1995756_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_162652901.1|1995799_1996213_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_162652902.1|1996307_1996820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162652903.1|1997223_1998018_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_162652904.1|1998270_1999257_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	35.6	7.6e-51
WP_162652905.1|1999288_1999636_-	VanZ family protein	NA	NA	NA	NA	NA
WP_162652906.1|1999661_2001008_-	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_162652907.1|2001085_2002648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162652908.1|2002688_2003858_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_162652909.1|2004205_2005315_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162652910.1|2005523_2006747_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_162652911.1|2006967_2008476_+	GumC family protein	NA	NA	NA	NA	NA
WP_162652912.1|2009452_2009746_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	44.0	2.6e-15
WP_162652913.1|2009763_2010042_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_162653647.1|2010165_2010768_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_162652914.1|2010764_2011823_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.9	6.9e-26
WP_162652915.1|2011832_2013578_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_162652916.1|2013662_2014784_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_162652917.1|2014810_2015647_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_162652918.1|2015968_2016853_-	EamA family transporter	NA	NA	NA	NA	NA
WP_162652919.1|2016919_2017318_-	RidA family protein	NA	NA	NA	NA	NA
WP_162652920.1|2017433_2018330_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162652921.1|2019947_2020772_+	MFS transporter	NA	NA	NA	NA	NA
WP_162652922.1|2021079_2022090_-	glucokinase	NA	NA	NA	NA	NA
WP_162652923.1|2022086_2023199_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.0	6.6e-27
WP_162652924.1|2023234_2024074_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_162652925.1|2024075_2024963_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_162652926.1|2024987_2026235_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_162652927.1|2026367_2027564_+	ROK family protein	NA	NA	NA	NA	NA
2027611:2027651	attL	GGGCTTGTCGCAAAGTTCATTGAGTTAACGTGATTTTGAGG	NA	NA	NA	NA
WP_162652928.1|2027809_2028448_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_162652929.1|2028451_2029369_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_174244221.1|2029493_2031083_-	L-fucose/L-arabinose isomerase family protein	NA	NA	NA	NA	NA
WP_174244244.1|2031084_2032716_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_162652932.1|2032758_2034261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162652933.1|2034391_2035330_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_162652934.1|2035330_2036464_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	33.3	2.0e-26
WP_162652935.1|2036466_2037300_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_162652936.1|2037296_2038193_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_162652937.1|2038338_2039619_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_162652938.1|2039690_2040692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162652939.1|2040978_2042013_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_162652940.1|2042065_2042836_-	ATP-binding cassette domain-containing protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	26.5	4.3e-09
WP_162652941.1|2042832_2043843_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_162652942.1|2043902_2044934_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_162652943.1|2045259_2046336_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.0	1.2e-22
WP_162652944.1|2046366_2047206_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_162652945.1|2047195_2048095_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_162652946.1|2048177_2049455_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_162652947.1|2050003_2050399_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_162652948.1|2050423_2050732_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_162652949.1|2050789_2051878_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_162652950.1|2051874_2053155_-	class II D-tagatose-bisphosphate aldolase, non-catalytic subunit	NA	NA	NA	NA	NA
WP_162652951.1|2053138_2054101_-	ROK family protein	NA	NA	NA	NA	NA
WP_162652952.1|2054081_2055170_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_162652953.1|2055162_2056041_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_162653648.1|2056419_2057112_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	37.4	4.8e-28
2057225:2057265	attR	CCTCAAAATCACGTTAACTCAATGAACTTTGCGACAAGCCC	NA	NA	NA	NA
>prophage 6
NZ_LS999833	Lentilitoribacter sp. Alg239-R112 chromosome I	2695248	2508406	2518942	2695248		Acanthocystis_turfacea_Chlorella_virus(22.22%)	11	NA	NA
WP_162653347.1|2508406_2509282_+	sugar nucleotide-binding protein	NA	A0A2L2DJC0	Acanthamoeba_polyphaga_mimivirus	30.4	8.5e-30
WP_162653348.1|2509274_2510285_+	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	36.7	4.3e-41
WP_162653349.1|2510277_2511405_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	45.6	4.8e-102
WP_162653350.1|2511486_2512608_+	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	63.7	4.5e-132
WP_162653351.1|2512613_2513573_+	NAD-dependent epimerase/dehydratase family protein	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.8	2.1e-82
WP_162653352.1|2513629_2513875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162653353.1|2513916_2514882_-	GDP-mannose 4,6-dehydratase	NA	A9YVQ9	Ostreococcus_tauri_virus	28.9	1.5e-22
WP_162653354.1|2514872_2516228_-	methyltransferase domain-containing protein	NA	A0A2H4UUL2	Bodo_saltans_virus	37.0	1.7e-69
WP_162653355.1|2516347_2517529_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_162653356.1|2517564_2517960_-	hypothetical protein	NA	M1H7V2	Paramecium_bursaria_Chlorella_virus	42.5	3.5e-15
WP_162653695.1|2517970_2518942_-	hypothetical protein	NA	H8ZJG6	Ostreococcus_tauri_virus	30.5	1.7e-18
>prophage 1
NZ_LS999835	Lentilitoribacter sp. Alg239-R112 chromosome III	471140	126296	134731	471140	tRNA	Bacillus_phage(16.67%)	8	NA	NA
WP_162654887.1|126296_128039_-	stimulus-sensing domain-containing protein	NA	W8CYF6	Bacillus_phage	26.9	4.4e-17
WP_162654581.1|128150_128858_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.7	1.7e-07
WP_162654582.1|129184_130798_+	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	51.8	2.5e-152
WP_162654583.1|130898_131333_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_162654584.1|131423_131876_+	peptidoglycan-binding protein LysM	NA	A0A0A7RW06	Clostridium_phage	43.1	1.7e-05
WP_162654585.1|131939_132554_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	U5XK15	Phormidium_phage	29.1	4.5e-17
WP_162654586.1|132558_133647_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_162654587.1|133732_134731_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.2	8.0e-32
