The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS991421	Lactobacillus zeae isolate CECT 9104 chromosome 1	3045762	3625	10412	3045762	tail,holin	Lactobacillus_phage(87.5%)	8	NA	NA
WP_093997701.1|3625_5578_+|tail	phage tail family protein	tail	B4XYQ4	Lactobacillus_phage	44.3	3.5e-140
WP_093997700.1|5578_8032_+|tail	phage tail protein	tail	A8YQK1	Lactobacillus_phage	61.3	0.0e+00
WP_093997699.1|8049_8334_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	78.7	5.2e-37
WP_093997698.1|8330_8462_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	97.7	8.5e-19
WP_093997697.1|8492_8870_+	hypothetical protein	NA	A0A0P0IV33	Lactobacillus_phage	94.4	8.7e-64
WP_093997696.1|8862_9096_+	hypothetical protein	NA	A0A0P0I3H2	Lactobacillus_phage	71.4	1.3e-06
WP_093997695.1|9085_9358_+|holin	holin	holin	Q9MCC7	Lactobacillus_phage	93.3	5.3e-39
WP_093997694.1|9359_10412_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	95.7	3.6e-200
>prophage 2
NZ_LS991421	Lactobacillus zeae isolate CECT 9104 chromosome 1	3045762	628945	641664	3045762	integrase,head,terminase,portal,capsid	Streptococcus_phage(22.22%)	19	628920:628942	642584:642606
628920:628942	attL	GTGGTGCACTTTTTGGTGCACTT	NA	NA	NA	NA
WP_070652139.1|628945_630097_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	34.6	4.1e-56
WP_070652140.1|630174_630948_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064520436.1|631066_631261_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064520437.1|631285_631561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070650593.1|631640_631862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115656712.1|631972_632164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115656713.1|632212_632494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013245606.1|632490_632679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115656714.1|632662_633475_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	31.1	9.7e-12
WP_070650358.1|633487_635074_+	DNA primase	NA	A0A0M4RE09	Enterococcus_phage	31.5	1.1e-40
WP_168165293.1|635395_635560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093997740.1|635561_635897_+|head	phage head closure protein	head	Q6J1Y0	Lactobacillus_phage	39.8	3.0e-15
WP_070650359.1|635901_636087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083311552.1|636083_636506_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	47.1	2.9e-23
WP_093997739.1|636622_637093_+|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	27.2	2.1e-06
WP_115656715.1|637089_638793_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	42.3	6.2e-117
WP_083311539.1|638758_638938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115656716.1|638942_640124_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	34.7	6.3e-60
WP_115656717.1|640110_641664_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.9	4.7e-39
642584:642606	attR	GTGGTGCACTTTTTGGTGCACTT	NA	NA	NA	NA
>prophage 3
NZ_LS991421	Lactobacillus zeae isolate CECT 9104 chromosome 1	3045762	2265151	2328574	3045762	transposase,protease,tRNA,bacteriocin	Streptococcus_phage(28.57%)	58	NA	NA
WP_070650329.1|2265151_2266558_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	9.5e-55
WP_070650330.1|2267187_2268582_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_049170030.1|2268753_2270247_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_070650331.1|2270395_2271223_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_083311551.1|2271372_2272497_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_070650332.1|2272786_2273563_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_070650333.1|2273588_2274467_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	41.0	1.2e-34
WP_070650334.1|2274747_2275644_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010492251.1|2275748_2276864_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_010492253.1|2276884_2278249_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_070650335.1|2278268_2278808_-	hypothetical protein	NA	J9PV85	Bacillus_phage	48.6	5.2e-38
WP_070650336.1|2279146_2279437_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_070650337.1|2279895_2281215_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.8	3.4e-62
WP_070650338.1|2281345_2282692_+	C1 family peptidase	NA	A0A2H4UU28	Bodo_saltans_virus	28.8	1.1e-47
WP_070650339.1|2282823_2283189_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SEX8	Streptococcus_phage	44.9	9.4e-23
WP_047105520.1|2283175_2283400_-	AbrB family transcriptional regulator	NA	Q708N8	Streptococcus_phage	42.3	3.1e-08
WP_070650340.1|2283621_2284722_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_070650341.1|2284721_2285915_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_070650342.1|2285929_2286808_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	3.1e-11
WP_047105515.1|2286968_2289023_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.5	7.3e-64
WP_070650343.1|2289158_2291789_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	38.5	1.1e-83
WP_083311550.1|2292069_2292732_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_025013311.1|2292817_2293489_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_070650345.1|2293651_2294758_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_047105507.1|2294829_2295114_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_047105506.1|2295274_2296390_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_070650346.1|2296600_2296810_-	CsbD family protein	NA	NA	NA	NA	NA
WP_093997905.1|2296965_2298159_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_070650348.1|2298155_2299385_-	MFS transporter	NA	NA	NA	NA	NA
WP_070650349.1|2299407_2300151_-	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_070650350.1|2300147_2301362_-	MFS transporter	NA	NA	NA	NA	NA
WP_070650351.1|2301486_2302665_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010492291.1|2302776_2303034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010492293.1|2303136_2303343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070650352.1|2303541_2303796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070650357.1|2304138_2305383_+	MFS transporter	NA	NA	NA	NA	NA
WP_070650353.1|2305483_2306740_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	54.6	5.6e-107
WP_070650354.1|2306831_2307671_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.7	2.1e-46
WP_070650230.1|2308042_2309500_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_070650594.1|2310104_2310647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010492305.1|2310917_2311475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070650595.1|2311621_2312821_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_115656740.1|2313021_2314077_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_070650597.1|2314344_2314995_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	38.9	5.8e-07
WP_070650598.1|2315217_2315862_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070650599.1|2315991_2316324_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_093997889.1|2316320_2317124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070650601.1|2317140_2317431_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_155807535.1|2317726_2317894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047105493.1|2318195_2319173_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_070650602.1|2319459_2320815_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_070650603.1|2320928_2322308_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_070650604.1|2322319_2324512_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	25.6	3.4e-35
WP_168165295.1|2324828_2324975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070650605.1|2325141_2326443_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_070650606.1|2326444_2327251_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_070650607.1|2328190_2328349_-|bacteriocin	bacteriocin leader domain-containing protein	bacteriocin	NA	NA	NA	NA
WP_093997888.1|2328376_2328574_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 4
NZ_LS991421	Lactobacillus zeae isolate CECT 9104 chromosome 1	3045762	2872219	2929951	3045762	integrase,capsid,terminase,portal,protease,head	Staphylococcus_phage(21.43%)	58	2917441:2917460	2932339:2932358
WP_070651599.1|2872219_2872900_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_070651601.1|2873416_2875018_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010490455.1|2875021_2875768_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	7.3e-30
WP_010490452.1|2875906_2876167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070651602.1|2876193_2877468_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047106794.1|2877956_2878679_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_010490446.1|2878750_2879089_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_010490443.1|2879240_2879564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070651608.1|2880053_2880524_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_070651610.1|2880516_2882040_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_070651612.1|2882068_2882845_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_070651614.1|2882974_2883862_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_083311609.1|2884445_2885219_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_070651618.1|2885211_2886072_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_010490433.1|2887746_2888487_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	2.0e-32
WP_093997748.1|2888483_2889938_-	amino acid ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_070651626.1|2890216_2891677_-	amino acid ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_010490427.1|2891882_2892431_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_070651628.1|2892793_2893417_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_070651630.1|2893656_2894592_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_070651632.1|2894596_2895589_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_093997746.1|2895581_2897741_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_070651635.1|2898279_2899389_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_070651638.1|2899604_2900999_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_070651640.1|2901139_2901730_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_070651643.1|2901834_2902254_-	YjdF family protein	NA	NA	NA	NA	NA
WP_070651645.1|2902547_2903726_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_070651647.1|2903762_2905088_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	47.6	2.8e-16
WP_070651649.1|2905242_2906784_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_070651651.1|2906790_2907474_+	response regulator	NA	NA	NA	NA	NA
WP_070651680.1|2907604_2908156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070651682.1|2908567_2909497_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.0	3.0e-17
WP_070651653.1|2909480_2910251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_070651655.1|2910258_2910984_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	1.2e-26
WP_070651657.1|2910994_2911693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070651659.1|2911814_2913119_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_070651661.1|2913115_2913823_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_070651662.1|2914114_2914972_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_070651664.1|2915218_2915617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070651666.1|2915829_2916759_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_070651668.1|2917032_2917287_+	hypothetical protein	NA	NA	NA	NA	NA
2917441:2917460	attL	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
WP_093997745.1|2917557_2918715_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.8	1.3e-46
WP_016366757.1|2918820_2919378_-	helix-turn-helix domain-containing protein	NA	Q4ZC20	Staphylococcus_virus	42.6	2.5e-06
WP_070651672.1|2919557_2919833_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070651674.1|2919898_2920318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093997744.1|2920539_2920830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093997743.1|2920826_2921015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093997742.1|2920998_2921826_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_070650591.1|2921818_2923243_+	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.8	3.5e-65
WP_093997741.1|2923493_2923835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093997740.1|2923848_2924184_+|head	phage head closure protein	head	Q6J1Y0	Lactobacillus_phage	39.8	3.0e-15
WP_070650359.1|2924188_2924374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083311552.1|2924370_2924793_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	47.1	2.9e-23
WP_093997739.1|2924909_2925380_+|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	27.2	2.1e-06
WP_093997738.1|2925376_2927080_+|terminase	terminase	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	43.2	6.0e-120
WP_070650232.1|2927045_2927225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093997737.1|2927229_2928411_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.8	1.7e-60
WP_093997736.1|2928397_2929951_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.0	1.4e-38
2932339:2932358	attR	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
>prophage 5
NZ_LS991421	Lactobacillus zeae isolate CECT 9104 chromosome 1	3045762	2954854	2998541	3045762	transposase,protease,tRNA,bacteriocin	Paenibacillus_phage(14.29%)	38	NA	NA
WP_070651050.1|2954854_2956756_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_010490333.1|2956796_2958185_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_093997734.1|2958609_2959377_-	protein jag	NA	NA	NA	NA	NA
WP_010490329.1|2959394_2960231_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_010490327.1|2960260_2960617_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003568442.1|2961091_2961232_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_047106740.1|2961991_2963341_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_070651047.1|2963514_2964654_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	33.8	1.3e-14
WP_070651044.1|2965378_2965591_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_070651043.1|2965587_2966706_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_070651041.1|2966747_2968709_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.1	2.5e-146
WP_070651039.1|2968774_2971393_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	33.1	1.9e-112
WP_070651085.1|2971645_2972872_+	MFS transporter	NA	NA	NA	NA	NA
WP_010490299.1|2973013_2973445_+	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	50.9	1.3e-23
WP_010490297.1|2973571_2973868_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_010490295.1|2973897_2974491_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	93.1	3.6e-48
WP_003568467.1|2974580_2974817_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_171024651.1|2974899_2975409_-|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	NA	NA	NA	NA
WP_070651037.1|2975763_2977242_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_070651035.1|2977234_2978254_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_010490250.1|2978494_2978689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070651034.1|2979049_2979268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070651032.1|2979450_2979666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172493494.1|2980629_2981417_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070543888.1|2981784_2983452_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_070651027.1|2983454_2985194_+	alpha-glycosidase	NA	NA	NA	NA	NA
WP_070651026.1|2985312_2987571_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_003569641.1|2987563_2988244_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_070651025.1|2988236_2989364_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.3	2.3e-19
WP_070651023.1|2989376_2990984_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_070651021.1|2991075_2992308_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_070651018.1|2992361_2993720_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003569650.1|2993722_2994580_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_070651016.1|2994763_2995720_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115656753.1|2996032_2996401_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	42.6	4.7e-14
WP_093997732.1|2996534_2997322_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070651009.1|2997935_2998145_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_070651007.1|2998244_2998541_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 6
NZ_LS991421	Lactobacillus zeae isolate CECT 9104 chromosome 1	3045762	3006637	3040447	3045762	tail,integrase,capsid,terminase,portal,protease,head	Lactobacillus_phage(95.12%)	46	3005334:3005348	3012297:3012311
3005334:3005348	attL	AATCAAATCACGATT	NA	NA	NA	NA
WP_093997730.1|3006637_3007807_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	97.4	5.6e-218
WP_005686889.1|3007976_3008654_-	hypothetical protein	NA	A0A2D1GPN7	Lactobacillus_phage	100.0	5.7e-90
WP_093997729.1|3008711_3009359_-	helix-turn-helix domain-containing protein	NA	B4XYR6	Lactobacillus_phage	42.7	4.4e-39
WP_093997728.1|3009507_3009774_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_093997727.1|3009770_3010211_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_172493514.1|3010188_3010953_+	phage antirepressor KilAC domain-containing protein	NA	Q6J1W3	Lactobacillus_phage	72.8	1.3e-98
WP_010489711.1|3011201_3011558_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	97.5	2.6e-62
WP_172493496.1|3011678_3011831_+	hypothetical protein	NA	A0A0P0HRK6	Lactobacillus_phage	92.0	4.9e-18
WP_093997757.1|3011835_3012039_+	hypothetical protein	NA	U5U788	Lactobacillus_phage	92.5	8.3e-29
WP_005712713.1|3012057_3012543_+	siphovirus Gp157 family protein	NA	B4XYS3	Lactobacillus_phage	97.5	2.2e-80
3012297:3012311	attR	AATCAAATCACGATT	NA	NA	NA	NA
WP_115656754.1|3012543_3013251_+	AAA family ATPase	NA	B4XYS4	Lactobacillus_phage	96.2	3.2e-128
WP_093997724.1|3013254_3013812_+	DUF669 domain-containing protein	NA	B4XYS5	Lactobacillus_phage	95.1	1.5e-101
WP_093997723.1|3013826_3014624_+	replication protein	NA	Q6J1V6	Lactobacillus_phage	62.4	7.4e-81
WP_093997722.1|3014610_3015393_+	ATP-binding protein	NA	B4XYS7	Lactobacillus_phage	88.8	1.0e-127
WP_093997721.1|3015389_3015722_+	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	77.1	2.6e-40
WP_093997720.1|3015718_3015997_+	hypothetical protein	NA	A0A2D1GPK5	Lactobacillus_phage	92.1	9.3e-39
WP_093997719.1|3015993_3016443_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	93.2	8.2e-69
WP_093997718.1|3016489_3016744_+	hypothetical protein	NA	A8YQM4	Lactobacillus_phage	96.4	4.2e-38
WP_093997717.1|3016740_3017154_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	97.1	1.9e-72
WP_093997716.1|3017303_3018422_+	DNA cytosine methyltransferase	NA	A0A2H4PBE1	Lactobacillus_phage	60.8	1.0e-128
WP_093997715.1|3018459_3019161_+	N-6 DNA methylase	NA	A8YQM7	Lactobacillus_phage	96.5	1.3e-124
WP_093997714.1|3019279_3019813_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	67.6	3.3e-61
WP_093997713.1|3019805_3020366_+	HNH endonuclease	NA	B4XYU1	Lactobacillus_phage	37.4	9.0e-25
WP_172493397.1|3020355_3020532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093997712.1|3020518_3020728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032798766.1|3020720_3020927_+	hypothetical protein	NA	B4XYT6	Lactobacillus_phage	95.6	7.3e-33
WP_093997711.1|3020923_3021274_+	hypothetical protein	NA	C1KFT5	Lactobacillus_virus	50.4	9.3e-20
WP_093997710.1|3021472_3021691_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IXA5	Lactobacillus_phage	88.9	1.2e-30
WP_032953806.1|3021764_3022199_+	autolysin regulatory protein arpU	NA	A0A0P0IDA8	Lactobacillus_phage	71.2	9.7e-51
WP_093997709.1|3022508_3023216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093997707.1|3024176_3024971_+	HNH endonuclease	NA	B4XYU4	Lactobacillus_phage	97.0	1.2e-147
WP_005712753.1|3025171_3025627_+|terminase	P27 family phage terminase small subunit	terminase	B4XYP1	Lactobacillus_phage	99.3	1.0e-79
WP_048487182.1|3025648_3027361_+|terminase	terminase large subunit	terminase	B4XYP2	Lactobacillus_phage	98.4	0.0e+00
WP_003661399.1|3027372_3027564_+	hypothetical protein	NA	A0A2D1GPE7	Lactobacillus_phage	100.0	3.0e-28
WP_020752179.1|3027568_3028822_+|portal	phage portal protein	portal	B4XYP4	Lactobacillus_phage	98.3	6.5e-233
WP_015764348.1|3028775_3029405_+|head,protease	HK97 family phage prohead protease	head,protease	B4XYP5	Lactobacillus_phage	100.0	3.3e-116
WP_093997706.1|3029446_3030649_+|capsid	phage major capsid protein	capsid	A0A2D1GPG3	Lactobacillus_phage	94.2	7.7e-207
WP_047676111.1|3030666_3030906_+	Ig-like domain-containing protein	NA	U5U4N8	Lactobacillus_phage	97.5	2.5e-24
WP_093997705.1|3030916_3031276_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	96.6	4.7e-59
WP_005686978.1|3031265_3031595_+|head,tail	head-tail adaptor protein	head,tail	P94213	Lactobacillus_phage	97.2	1.5e-56
WP_015764352.1|3031594_3031981_+	HK97 gp10 family phage protein	NA	B4XYP9	Lactobacillus_phage	98.4	5.0e-67
WP_093997704.1|3031980_3032367_+|tail	phage tail protein	tail	U5U3W4	Lactobacillus_phage	97.7	6.3e-70
WP_093997703.1|3032400_3033018_+|tail	phage tail protein	tail	U5U3Z7	Lactobacillus_phage	97.5	1.0e-109
WP_047676100.1|3033117_3033531_+	hypothetical protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
WP_093997702.1|3033653_3038495_+|tail	phage tail tape measure protein	tail	U5U708	Lactobacillus_phage	82.3	0.0e+00
WP_115656756.1|3038575_3040447_+|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	46.0	1.7e-139
>prophage 1
NZ_LS991422	Lactobacillus zeae isolate CECT 9104 plasmid 2	27649	2139	26337	27649	holin,integrase,head,tail	Lactobacillus_phage(96.15%)	29	9702:9715	13900:13913
WP_093997721.1|2139_2472_-	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	77.1	2.6e-40
WP_093997723.1|3236_4034_-	replication protein	NA	Q6J1V6	Lactobacillus_phage	62.4	7.4e-81
WP_093997724.1|4048_4606_-	DUF669 domain-containing protein	NA	B4XYS5	Lactobacillus_phage	95.1	1.5e-101
WP_115656754.1|4609_5317_-	AAA family ATPase	NA	B4XYS4	Lactobacillus_phage	96.2	3.2e-128
WP_005712713.1|5317_5803_-	siphovirus Gp157 family protein	NA	B4XYS3	Lactobacillus_phage	97.5	2.2e-80
WP_093997757.1|5821_6025_-	hypothetical protein	NA	U5U788	Lactobacillus_phage	92.5	8.3e-29
WP_172493496.1|6029_6182_-	hypothetical protein	NA	A0A0P0HRK6	Lactobacillus_phage	92.0	4.9e-18
WP_010489711.1|6302_6659_-	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	97.5	2.6e-62
WP_172493514.1|6907_7672_-	phage antirepressor KilAC domain-containing protein	NA	Q6J1W3	Lactobacillus_phage	72.8	1.3e-98
WP_093997727.1|7649_8090_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_093997728.1|8086_8353_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_093997729.1|8501_9149_+	helix-turn-helix domain-containing protein	NA	B4XYR6	Lactobacillus_phage	42.7	4.4e-39
WP_005686889.1|9206_9884_+	hypothetical protein	NA	A0A2D1GPN7	Lactobacillus_phage	100.0	5.7e-90
9702:9715	attL	GGTTATGATCCAGA	NA	NA	NA	NA
WP_093997730.1|10053_11223_+|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	97.4	5.6e-218
WP_172493399.1|11576_11744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093997694.1|11727_12780_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	95.7	3.6e-200
WP_093997695.1|12781_13054_-|holin	holin	holin	Q9MCC7	Lactobacillus_phage	93.3	5.3e-39
WP_093997696.1|13043_13277_-	hypothetical protein	NA	A0A0P0I3H2	Lactobacillus_phage	71.4	1.3e-06
WP_093997697.1|13269_13647_-	hypothetical protein	NA	A0A0P0IV33	Lactobacillus_phage	94.4	8.7e-64
WP_093997698.1|13677_13809_-	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	97.7	8.5e-19
WP_093997699.1|13805_14090_-	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	78.7	5.2e-37
13900:13913	attR	TCTGGATCATAACC	NA	NA	NA	NA
WP_093997700.1|14107_16561_-|tail	phage tail protein	tail	A8YQK1	Lactobacillus_phage	61.3	0.0e+00
WP_093997701.1|16561_18514_-|tail	phage tail family protein	tail	B4XYQ4	Lactobacillus_phage	44.3	3.5e-140
WP_093997702.1|18514_23356_-|tail	phage tail tape measure protein	tail	U5U708	Lactobacillus_phage	82.3	0.0e+00
WP_047676100.1|23478_23892_-	hypothetical protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
WP_093997703.1|23990_24608_-|tail	phage tail protein	tail	U5U3Z7	Lactobacillus_phage	97.5	1.0e-109
WP_005686978.1|25408_25738_-|head,tail	head-tail adaptor protein	head,tail	P94213	Lactobacillus_phage	97.2	1.5e-56
WP_093997705.1|25727_26087_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	96.6	4.7e-59
WP_047676111.1|26097_26337_-	Ig-like domain-containing protein	NA	U5U4N8	Lactobacillus_phage	97.5	2.5e-24
