The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483487	Fusobacterium ulcerans strain NCTC12112 chromosome 1	3539037	297458	309360	3539037		Staphylococcus_phage(40.0%)	12	NA	NA
WP_040490854.1|297458_299312_+	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	26.7	3.0e-24
WP_040490792.1|299331_299709_+	response regulator	NA	A0A220YL79	Alteromonas_virus	27.0	1.0e-08
WP_008698289.1|299705_300377_+	response regulator	NA	A0A1V0SGR9	Hokovirus	30.3	3.5e-07
WP_005979065.1|300386_301529_+	universal stress protein	NA	NA	NA	NA	NA
WP_040490796.1|301592_302426_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	54.3	4.9e-19
WP_005979069.1|302443_303778_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005979071.1|304155_304617_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.7	1.1e-41
WP_005979073.1|304634_305696_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.5	4.5e-49
WP_040490855.1|305713_306361_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.7	8.8e-32
WP_005979077.1|306378_307572_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	1.8e-115
WP_005979079.1|307685_308627_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	32.3	3.3e-11
WP_005979081.1|308640_309360_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	43.0	2.3e-28
>prophage 2
NZ_LS483487	Fusobacterium ulcerans strain NCTC12112 chromosome 1	3539037	1060898	1117938	3539037	integrase,tail,capsid,tRNA,protease,head,portal,terminase	Clostridium_phage(26.67%)	62	1100948:1100966	1120929:1120947
WP_005976710.1|1060898_1061627_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005976712.1|1061623_1062160_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_005976714.1|1062200_1062764_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_005976716.1|1062785_1067126_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	34.1	1.8e-24
WP_005976718.1|1067134_1068052_+	EamA family transporter	NA	NA	NA	NA	NA
WP_005976720.1|1068129_1068408_+	HU family DNA-binding protein	NA	G4WAL8	Salmonella_phage	40.7	1.6e-11
WP_005976722.1|1068660_1069863_+	threonine ammonia-lyase	NA	A0A1W6JHY1	Lactococcus_phage	27.8	7.4e-08
WP_005976724.1|1069941_1071216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976726.1|1071205_1071952_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_005976728.1|1071975_1073358_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_005976730.1|1073448_1074318_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_005976732.1|1074467_1075877_+	[FeFe] hydrogenase H-cluster radical SAM maturase HydG	NA	NA	NA	NA	NA
WP_005976734.1|1075948_1076188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005976736.1|1076353_1076953_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_005976738.1|1077210_1077594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976740.1|1077757_1078003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976742.1|1078131_1078908_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_005976746.1|1079182_1080055_+	AAA family ATPase	NA	Q56VQ0	Pseudomonas_phage	35.0	4.2e-21
WP_005976749.1|1080121_1080904_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_005976751.1|1080929_1082216_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_005976753.1|1082208_1082685_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_005976755.1|1082699_1083701_-	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_005976757.1|1083773_1084817_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.9	7.8e-22
WP_005976759.1|1085082_1086192_-	alanine racemase	NA	NA	NA	NA	NA
WP_005976761.1|1086207_1087533_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_005976763.1|1087580_1088939_-	GntP family permease	NA	NA	NA	NA	NA
WP_005976765.1|1089357_1089915_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005976767.1|1090042_1090891_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_005976769.1|1091099_1093061_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_170067064.1|1093696_1094815_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_005976771.1|1094849_1095239_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005976773.1|1095398_1095611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976775.1|1095641_1095806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976777.1|1095918_1096332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976781.1|1096566_1097034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167537209.1|1097026_1097194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976785.1|1097401_1098334_+	phage replisome organizer N-terminal domain-containing protein	NA	A0A1P8BKV2	Lactococcus_phage	37.6	9.1e-14
WP_005976787.1|1098347_1099157_+	ATP-binding protein	NA	A0A0S2SXI8	Bacillus_phage	32.5	5.0e-24
WP_005976789.1|1099170_1099686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976791.1|1099701_1100445_+	ParA family protein	NA	A0A0E3Y677	Fusobacterium_phage	46.9	2.7e-48
1100948:1100966	attL	AAAATCGCAACTTCCGAAA	NA	NA	NA	NA
WP_005976795.1|1101452_1101713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976798.1|1101804_1101981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976799.1|1101973_1102750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976800.1|1102752_1102953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976801.1|1102933_1104001_+|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	51.0	4.8e-91
WP_145959521.1|1104272_1104590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976803.1|1104597_1105140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976804.1|1105198_1106878_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_167537210.1|1107229_1107397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976806.1|1107686_1108787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976807.1|1108947_1109487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976808.1|1109486_1109918_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_005976809.1|1110031_1110487_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_005976810.1|1110488_1112204_+|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	44.1	6.4e-130
WP_005976811.1|1112200_1113475_+|portal	phage portal protein	portal	A6M949	Geobacillus_virus	45.0	6.5e-87
WP_005976812.1|1113443_1114202_+|protease	Clp protease ClpP	protease	A0A0A7RTN2	Clostridium_phage	47.0	6.0e-48
WP_005976813.1|1114202_1115354_+|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	46.8	1.7e-73
WP_005976814.1|1115366_1115648_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A6M953	Geobacillus_virus	42.6	2.8e-06
WP_005976815.1|1115648_1115981_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_005976816.1|1115984_1116392_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_005976817.1|1116401_1116845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005976818.1|1116846_1117938_+	hypothetical protein	NA	A0A090D804	Clostridium_phage	27.6	1.0e-24
1120929:1120947	attR	AAAATCGCAACTTCCGAAA	NA	NA	NA	NA
>prophage 3
NZ_LS483487	Fusobacterium ulcerans strain NCTC12112 chromosome 1	3539037	1364938	1370701	3539037		Prochlorococcus_phage(33.33%)	6	NA	NA
WP_111711112.1|1364938_1365418_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	47.4	2.8e-27
WP_005977777.1|1365481_1366198_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	43.2	4.0e-41
WP_005977775.1|1366197_1367595_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	34.6	8.8e-61
WP_005977773.1|1367617_1368619_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	44.0	1.4e-65
WP_005977769.1|1368606_1369182_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.8	6.0e-24
WP_040490711.1|1369195_1370701_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.0	3.6e-68
>prophage 4
NZ_LS483487	Fusobacterium ulcerans strain NCTC12112 chromosome 1	3539037	1808791	1852118	3539037	integrase,tail,holin,capsid,tRNA,terminase,portal,plate,protease	Fusobacterium_phage(71.43%)	49	1812563:1812583	1827430:1827450
WP_005979964.1|1808791_1809871_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005979966.1|1809895_1810672_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_005979967.1|1810880_1812560_+	hydroxylamine reductase	NA	NA	NA	NA	NA
1812563:1812583	attL	TTAAATTATAATTTTTATAAA	NA	NA	NA	NA
WP_005979968.1|1812744_1814151_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	34.8	4.7e-54
WP_005979969.1|1814343_1816053_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.2	2.8e-69
WP_040490831.1|1816127_1818704_-	ATP-dependent chaperone ClpB	NA	A0A0A8J958	Klebsiella_phage	36.6	5.3e-120
WP_005979973.1|1819087_1819585_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_005979975.1|1819677_1820907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005979978.1|1821271_1821877_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_005979980.1|1821973_1822768_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005979982.1|1822891_1824430_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_005979984.1|1824555_1825005_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	38.5	1.2e-16
WP_005979986.1|1825017_1825254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005979988.1|1825265_1825829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106878625.1|1825843_1826359_-	hypothetical protein	NA	A0A0E3U2P7	Fusobacterium_phage	36.3	5.1e-06
WP_005979991.1|1826371_1827346_-|integrase	site-specific integrase	integrase	A0A0E3U2P3	Fusobacterium_phage	39.8	4.5e-56
WP_040490632.1|1827866_1828097_-	hypothetical protein	NA	NA	NA	NA	NA
1827430:1827450	attR	TTAAATTATAATTTTTATAAA	NA	NA	NA	NA
WP_106878603.1|1828133_1829285_-	hypothetical protein	NA	A0A0E3Y5F3	Fusobacterium_phage	37.3	7.0e-48
WP_005979998.1|1829281_1829920_-|tail	phage tail protein I	tail	A0A0E3U255	Fusobacterium_phage	44.8	1.5e-44
WP_005980000.1|1829912_1831010_-|plate	baseplate J/gp47 family protein	plate	A0A0E3U2P1	Fusobacterium_phage	56.3	1.7e-115
WP_005980002.1|1831002_1831308_-	hypothetical protein	NA	A0A0E3Y6F8	Fusobacterium_phage	53.7	6.9e-19
WP_005980004.1|1831307_1831700_-|tail	phage tail protein	tail	A0A0E3Y6A2	Fusobacterium_phage	54.6	7.0e-32
WP_005980007.1|1831708_1832206_-|plate	phage baseplate assembly protein V	plate	A0A0E3Y4V1	Fusobacterium_phage	50.3	2.7e-41
WP_005980009.1|1832202_1833291_-	hypothetical protein	NA	A0A0E3U253	Fusobacterium_phage	44.3	1.3e-88
WP_005980012.1|1833292_1833502_-|tail	tail protein X	tail	A0A0C5AEF4	Bacteriophage	38.1	9.8e-09
WP_005980014.1|1833488_1836551_-|tail	phage tail tape measure protein	tail	A0A0E3U2N9	Fusobacterium_phage	38.3	7.5e-105
WP_005980016.1|1836615_1837008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980018.1|1837090_1837909_-	phage antirepressor KilAC domain-containing protein	NA	A0A2H4JAT4	uncultured_Caudovirales_phage	37.6	3.0e-37
WP_005980021.1|1837922_1838222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980023.1|1838345_1838519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980025.1|1838771_1839101_-	hypothetical protein	NA	A0A0E3Y5E7	Fusobacterium_phage	60.4	2.6e-24
WP_005980027.1|1839109_1839646_-|tail	phage major tail tube protein	tail	A0A0E3Y6F4	Fusobacterium_phage	57.0	1.3e-49
WP_005980028.1|1839662_1841078_-|tail	phage tail protein	tail	A0A0E3U251	Fusobacterium_phage	62.2	4.4e-177
WP_005980030.1|1841077_1841350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980032.1|1841359_1841821_-	hypothetical protein	NA	A0A0E3Y698	Fusobacterium_phage	43.1	2.0e-30
WP_005980034.1|1841817_1842384_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_005980036.1|1842383_1842734_-	hypothetical protein	NA	A0A0E3Y618	Fusobacterium_phage	45.1	3.7e-16
WP_005980038.1|1842708_1842939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980040.1|1842990_1844016_-|capsid	major capsid protein	capsid	A0A0E3U2N5	Fusobacterium_phage	54.4	3.9e-98
WP_005980043.1|1844027_1844354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980045.1|1844368_1845472_-|protease	Clp protease ClpP	protease	A0A0E3Y6E9	Fusobacterium_phage	41.5	1.0e-67
WP_005980047.1|1845464_1847000_-|portal	phage portal protein	portal	A0A0E3Y693	Fusobacterium_phage	64.6	2.1e-180
WP_005980049.1|1847003_1847222_-	hypothetical protein	NA	A0A0C5AEE0	Bacteriophage	45.6	3.0e-08
WP_051006467.1|1847221_1848988_-|terminase	phage terminase large subunit family protein	terminase	A0A0E3U2N4	Fusobacterium_phage	70.3	1.7e-247
WP_005980053.1|1848959_1849415_-	hypothetical protein	NA	A0A0E3Y4U4	Fusobacterium_phage	50.3	1.6e-32
WP_005980055.1|1849526_1850039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980057.1|1850197_1851220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980059.1|1851209_1851530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005980061.1|1851575_1852118_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0U4I901	Vibrio_phage	35.1	1.0e-20
>prophage 5
NZ_LS483487	Fusobacterium ulcerans strain NCTC12112 chromosome 1	3539037	1975579	2047025	3539037	tail,holin,integrase,capsid,tRNA,protease,head,portal,plate,terminase	Clostridium_phage(31.03%)	90	2009954:2009978	2047049:2047073
WP_005982247.1|1975579_1976749_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.4	1.4e-91
WP_111711121.1|1976767_1978948_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	34.1	7.1e-09
WP_005982243.1|1979046_1979559_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.2	1.7e-30
WP_005982242.1|1979573_1980422_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005982239.1|1980418_1981129_-	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005982237.1|1981121_1982396_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005982235.1|1982427_1982871_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	26.6	4.8e-05
WP_005982233.1|1983078_1983534_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005951295.1|1983547_1983997_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_005982230.1|1984028_1984877_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	42.3	2.2e-38
WP_005982228.1|1984900_1985833_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	45.6	3.7e-07
WP_005982226.1|1985847_1986315_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_008695677.1|1986324_1986798_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005982224.1|1986790_1987504_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_005982221.1|1987503_1988067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982218.1|1988063_1988882_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_005982215.1|1988878_1989991_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_005982212.1|1990173_1991151_-	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_005982210.1|1991224_1991698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982208.1|1991681_1992953_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.8	2.7e-93
WP_005982206.1|1992984_1993578_-	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
WP_005982204.1|1993661_1994672_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_005982202.1|1994692_1995172_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_005982200.1|1995201_1997283_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_005982198.1|1997298_2001741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982197.1|2001758_2002460_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_005982195.1|2002462_2004349_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_005982193.1|2004376_2005033_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_005982192.1|2005059_2006397_-	potassium transporter KtrB	NA	NA	NA	NA	NA
WP_005982190.1|2006580_2007822_-	peptidase T	NA	NA	NA	NA	NA
WP_005982188.1|2007899_2009288_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005982187.1|2009325_2009760_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
2009954:2009978	attL	ATTGTTAGTTGTTTGTTAGCTATAA	NA	NA	NA	NA
WP_005982184.1|2010068_2010539_-|holin	phage holin family protein	holin	M9Q253	Clostridium_phage	39.4	1.3e-16
WP_005982182.1|2010552_2011041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982180.1|2011053_2011626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982178.1|2011669_2012194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982177.1|2012266_2012974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982174.1|2012986_2013538_-	YmfQ family protein	NA	A0A0A7RTU9	Clostridium_phage	41.9	2.9e-28
WP_005982172.1|2013538_2014597_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	40.5	5.4e-63
WP_005982170.1|2014593_2015046_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_005982168.1|2015024_2015579_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_005982166.1|2015575_2016553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982164.1|2016545_2016986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982162.1|2016999_2018871_-	hypothetical protein	NA	A0A0E3Y5G6	Fusobacterium_phage	33.7	3.7e-30
WP_005982160.1|2018979_2019126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982158.1|2019277_2019691_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_005982156.1|2019709_2020144_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_005982154.1|2020156_2021221_-|terminase	terminase	terminase	A0A0A8WJL8	Clostridium_phage	35.5	4.6e-54
WP_005982152.1|2021213_2021666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982150.1|2021665_2022085_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_005982148.1|2022090_2022426_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_005982146.1|2022426_2022705_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7S0C9	Clostridium_phage	46.2	6.0e-14
WP_005982141.1|2022716_2023829_-|capsid	phage major capsid protein	capsid	Q2I8F7	Bacillus_phage	31.7	9.5e-42
WP_005982138.1|2023831_2024572_-|protease	Clp protease ClpP	protease	J9QE31	Clostridium_phage	38.9	5.5e-38
WP_005982136.1|2024564_2025785_-|portal	phage portal protein	portal	A6M949	Geobacillus_virus	47.5	1.0e-97
WP_005982134.1|2025807_2027514_-|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	49.7	3.6e-157
WP_005982132.1|2027517_2028009_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	34.2	1.6e-17
WP_005982129.1|2028099_2028531_-	hypothetical protein	NA	I2E8Y8	Clostridium_phage	36.4	4.5e-08
WP_005982128.1|2028766_2029177_-	hypothetical protein	NA	A0A2K5B275	Erysipelothrix_phage	26.5	1.4e-06
WP_005982126.1|2029179_2029431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982124.1|2029427_2029952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982122.1|2029952_2030132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040490925.1|2030258_2031194_-	site-specific DNA-methyltransferase	NA	G1D1F5	Mycobacterium_virus	39.0	6.5e-52
WP_005982117.1|2031197_2031953_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_005982115.1|2031936_2032143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982113.1|2032585_2034898_-	toprim domain-containing protein	NA	A0A1B1IP14	uncultured_Mediterranean_phage	27.1	6.8e-18
WP_005982110.1|2035539_2036172_-	ATP-binding protein	NA	A0A2I7R7K9	Vibrio_phage	42.0	9.2e-42
WP_005982108.1|2036176_2036749_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_167537220.1|2036745_2036922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982107.1|2036926_2037199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982105.1|2037211_2037385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982103.1|2037371_2037590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982100.1|2037574_2038288_-	phosphoadenosine phosphosulfate reductase family protein	NA	Q24LD4	Clostridium_phage	39.4	1.7e-28
WP_005982098.1|2038288_2038468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106878531.1|2038710_2038794_+	small toxic polypeptide LdrD	NA	NA	NA	NA	NA
WP_005982097.1|2038867_2039119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982095.1|2039131_2039296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982093.1|2039306_2039501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982091.1|2039514_2039832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982089.1|2039887_2040541_+	DUF4145 domain-containing protein	NA	A0A1L2JZ52	Aeribacillus_phage	29.1	2.1e-12
WP_005982087.1|2040497_2040695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982085.1|2040754_2040958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005982083.1|2041121_2041760_+	helix-turn-helix transcriptional regulator	NA	A0A0E3U270	Fusobacterium_phage	37.6	1.7e-27
WP_005982081.1|2041805_2042195_+	Ltp family lipoprotein	NA	Q6SEA6	Lactobacillus_prophage	59.3	2.6e-10
WP_005982079.1|2042233_2043355_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_005982077.1|2043347_2044010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005982074.1|2044039_2044807_+	adenine-specific DNA-methyltransferase	NA	R4THJ7	Phaeocystis_globosa_virus	31.3	2.3e-23
WP_005982070.1|2044790_2045210_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_051006478.1|2045675_2045858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005982066.1|2045999_2047025_+|integrase	site-specific integrase	integrase	A0A0E3Y5J2	Fusobacterium_phage	42.8	5.3e-55
2047049:2047073	attR	ATTGTTAGTTGTTTGTTAGCTATAA	NA	NA	NA	NA
>prophage 6
NZ_LS483487	Fusobacterium ulcerans strain NCTC12112 chromosome 1	3539037	2383631	2413582	3539037	holin,integrase,capsid,transposase,plate,terminase	Fusobacterium_phage(71.43%)	44	2395321:2395340	2417205:2417224
WP_040490909.1|2383631_2384078_-|holin	phage holin family protein	holin	D7RWK5	Brochothrix_phage	38.8	1.8e-12
WP_005981462.1|2384123_2384375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981460.1|2384377_2384761_-	M15 family metallopeptidase	NA	A0A076YI70	Citrobacter_phage	41.8	1.1e-18
WP_005981457.1|2384776_2385379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981455.1|2385391_2386087_-	hypothetical protein	NA	A0A0E3Y6G8	Fusobacterium_phage	31.1	6.4e-12
WP_005981453.1|2386087_2386618_-	hypothetical protein	NA	A0A0E3Y5G1	Fusobacterium_phage	43.0	4.5e-34
WP_005981451.1|2386622_2387777_-|plate	baseplate J/gp47 family protein	plate	A0A0E3Y634	Fusobacterium_phage	51.5	2.4e-104
WP_005981449.1|2387773_2388124_-	hypothetical protein	NA	A0A0E3U2P9	Fusobacterium_phage	58.9	1.2e-19
WP_005981447.1|2388133_2388787_-	hypothetical protein	NA	A0A0E3U262	Fusobacterium_phage	46.0	3.2e-29
WP_005981445.1|2388792_2389605_-	hypothetical protein	NA	A0A0E3Y4V7	Fusobacterium_phage	41.0	6.0e-54
WP_005981442.1|2389601_2389934_-	hypothetical protein	NA	A0A0E3Y6B2	Fusobacterium_phage	46.3	2.5e-22
WP_005981440.1|2389930_2390506_-	hypothetical protein	NA	A0A0E3U263	Fusobacterium_phage	49.6	7.3e-22
WP_005981438.1|2390498_2392193_-	hypothetical protein	NA	A0A0E3Y5G6	Fusobacterium_phage	41.0	5.6e-86
WP_005981435.1|2392381_2392834_-	hypothetical protein	NA	A0A0E3Y638	Fusobacterium_phage	35.3	1.6e-19
WP_005981433.1|2392837_2393281_-	DUF3277 family protein	NA	NA	NA	NA	NA
WP_005981432.1|2393293_2394292_-	hypothetical protein	NA	A0A0E3U2Q2	Fusobacterium_phage	54.7	6.6e-95
WP_005981431.1|2394284_2394785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981429.1|2394777_2395110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981426.1|2395112_2395565_-	hypothetical protein	NA	A0A0E3Y6H6	Fusobacterium_phage	41.4	1.3e-26
2395321:2395340	attL	CTTTTTTCATAAAGCTTTTT	NA	NA	NA	NA
WP_005981425.1|2395564_2395963_-	hypothetical protein	NA	A0A0E3Y5G9	Fusobacterium_phage	47.1	9.3e-24
WP_005981423.1|2395964_2396135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981421.1|2396136_2397249_-	DUF5309 family protein	NA	A0A2H4J2M3	uncultured_Caudovirales_phage	31.3	7.0e-37
WP_005981419.1|2397265_2397856_-	phage scaffolding protein	NA	NA	NA	NA	NA
WP_005981417.1|2397855_2398644_-|capsid	minor capsid protein	capsid	A0A0E3Y641	Fusobacterium_phage	38.1	5.7e-41
WP_005981415.1|2398643_2400137_-	hypothetical protein	NA	A0A0E3Y4W1	Fusobacterium_phage	39.9	1.9e-93
WP_040490877.1|2400248_2401592_-|terminase	PBSX family phage terminase large subunit	terminase	S6AVV7	Thermus_phage	53.6	9.8e-126
WP_005981411.1|2401524_2401968_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005981409.1|2402173_2402671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005981407.1|2402688_2402925_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005981405.1|2403039_2403936_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_167537218.1|2404203_2404341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981403.1|2404482_2405217_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005981401.1|2405310_2405904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981399.1|2405944_2406739_-	prohibitin family protein	NA	NA	NA	NA	NA
WP_167537217.1|2406756_2406906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981395.1|2406949_2407183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981393.1|2407199_2407472_-	hypothetical protein	NA	A0A0A7RWV6	Clostridium_phage	55.6	2.0e-22
WP_005981391.1|2407468_2407846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981389.1|2407926_2408328_-	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_005981387.1|2408330_2408975_-	DUF3164 family protein	NA	NA	NA	NA	NA
WP_005981384.1|2409037_2409289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981382.1|2410276_2412166_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A0N7ACC7	Bacillus_phage	27.3	3.7e-38
WP_005981380.1|2412177_2412588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005981375.1|2412796_2413582_-|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
2417205:2417224	attR	CTTTTTTCATAAAGCTTTTT	NA	NA	NA	NA
