The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483485	Aggregatibacter aphrophilus strain NCTC11096 chromosome 1	2290909	96115	106155	2290909	integrase,tRNA	Serratia_phage(16.67%)	8	96041:96057	108738:108754
96041:96057	attL	AAAACGACCGCACTTTT	NA	NA	NA	NA
WP_111300618.1|96115_98131_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.4	1.3e-142
WP_005705008.1|98316_98895_-	thymidine kinase	NA	A0A076YPF1	Citrobacter_phage	51.6	5.2e-52
WP_109059177.1|98897_99131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111300616.1|99202_100231_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	1.2e-110
WP_005701713.1|100455_100671_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_111300614.1|100793_102572_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	31.6	5.6e-44
WP_109842989.1|102643_104515_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.5	1.0e-35
WP_032995430.1|104913_106155_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	38.0	8.3e-71
108738:108754	attR	AAAACGACCGCACTTTT	NA	NA	NA	NA
>prophage 2
NZ_LS483485	Aggregatibacter aphrophilus strain NCTC11096 chromosome 1	2290909	504245	552905	2290909	protease,tRNA,integrase,plate	uncultured_Mediterranean_phage(28.57%)	36	495051:495065	554244:554258
495051:495065	attL	TTGCCAAACTGGCAG	NA	NA	NA	NA
WP_111301496.1|504245_505343_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_005701977.1|505402_505732_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_111301498.1|505790_506408_-	DsbA family protein	NA	NA	NA	NA	NA
WP_005703612.1|506422_506689_-	YihD family protein	NA	NA	NA	NA	NA
WP_005703611.1|506755_507337_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_083014296.1|507447_507969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111301502.1|509619_510561_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_111301504.1|510565_512230_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_005703604.1|512366_512603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111711189.1|512804_513788_+	DUF4424 family protein	NA	NA	NA	NA	NA
WP_005703599.1|513811_514231_+	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_111711190.1|517048_517693_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	46.0	1.3e-43
WP_111301209.1|517799_521030_-|protease	autotransporter serine protease	protease	NA	NA	NA	NA
WP_005703593.1|521519_525203_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_005701995.1|525199_526627_-	type VI secretion system domain-containing protein	NA	NA	NA	NA	NA
WP_005701996.1|526628_527255_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_005703591.1|527280_528138_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_005701999.1|528134_529478_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_005703590.1|529481_530168_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_005702001.1|530182_530968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111301203.1|530969_531968_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_005703587.1|531931_533683_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_005702007.1|533683_534100_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_005703586.1|534109_535594_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_005702010.1|535615_536113_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_111301202.1|536304_536964_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_111711191.1|536966_539828_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.0	5.0e-18
WP_005702013.1|540025_540715_+	nicotinamide riboside transporter PnuC	NA	U5J9C5	Bacillus_phage	34.4	1.8e-35
WP_111301199.1|540771_541476_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_111301197.1|541565_542894_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	31.1	6.9e-47
WP_111301195.1|542915_545516_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.7	2.3e-30
WP_111711192.1|545794_547138_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_111301191.1|547124_547970_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_032995056.1|548160_549285_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.0	2.1e-25
WP_111301187.1|549707_550799_-	YdcF family protein	NA	NA	NA	NA	NA
WP_111711193.1|551660_552905_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	40.3	8.6e-84
554244:554258	attR	TTGCCAAACTGGCAG	NA	NA	NA	NA
>prophage 3
NZ_LS483485	Aggregatibacter aphrophilus strain NCTC11096 chromosome 1	2290909	1441035	1522899	2290909	protease,capsid,terminase,portal,integrase,tRNA,head,tail,transposase	uncultured_Caudovirales_phage(30.43%)	82	1472211:1472232	1504542:1504563
WP_111300071.1|1441035_1441257_-|transposase	transposase	transposase	Q716C2	Shigella_phage	50.7	2.4e-13
WP_109842834.1|1441435_1442878_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_109842833.1|1443030_1443507_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_050693758.1|1443571_1443874_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_005703292.1|1443974_1444589_-	riboflavin synthase	NA	NA	NA	NA	NA
WP_111300460.1|1444613_1446011_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_111300069.1|1446171_1448343_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_111711256.1|1448398_1450144_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	26.5	3.1e-07
WP_111300458.1|1450254_1450575_-	YciU family protein	NA	NA	NA	NA	NA
WP_111300065.1|1450678_1453318_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_032994854.1|1453602_1454601_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.2	4.2e-33
WP_032994904.1|1454927_1456031_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_065295092.1|1456211_1456925_+	YdcF family protein	NA	NA	NA	NA	NA
WP_005703282.1|1456902_1457895_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_005700607.1|1458375_1458987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005703276.1|1460837_1461098_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_005703275.1|1461241_1461502_-	acetolactate synthase 3 catalytic subunit	NA	NA	NA	NA	NA
WP_172452391.1|1461529_1462192_-	acetolactate synthase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	33.5	4.5e-23
WP_032994852.1|1462624_1464154_-	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_005703272.1|1464593_1464992_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005700590.1|1465062_1465899_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_005700586.1|1466062_1466692_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_111300063.1|1466805_1468746_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	41.8	1.7e-115
WP_111300061.1|1468834_1469365_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_111711257.1|1469441_1470281_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.0	9.0e-37
WP_083015382.1|1470289_1471072_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_005700578.1|1471179_1471497_+	YqcC family protein	NA	NA	NA	NA	NA
WP_111300057.1|1471490_1472201_+|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
1472211:1472232	attL	AAAAAAACGACCGCACTTTTTA	NA	NA	NA	NA
WP_033002552.1|1472254_1472416_+	YoaH family protein	NA	NA	NA	NA	NA
WP_005700573.1|1472625_1472835_+	cold shock domain-containing protein CspD	NA	A0A1J0GVA5	Vibrio_phage	53.1	2.1e-11
WP_050693738.1|1472900_1473347_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_111300055.1|1473482_1475258_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_111300053.1|1475399_1475930_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_111300051.1|1476384_1477581_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1V0E8G8	Vibrio_phage	38.0	2.2e-76
WP_111300049.1|1477745_1479536_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	38.1	4.3e-76
WP_111300047.1|1479519_1479963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109082734.1|1479962_1480277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111300045.1|1480276_1480486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111300043.1|1480482_1480686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111300041.1|1480678_1480909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111300039.1|1480901_1481117_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_111711258.1|1481311_1481488_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	38.6	3.2e-05
WP_111300035.1|1481742_1482054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111300033.1|1482065_1482269_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_111300031.1|1482455_1483427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172452405.1|1483521_1483854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111300027.1|1483977_1484262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111300025.1|1484258_1485926_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	71.6	3.4e-245
WP_111300023.1|1485932_1486301_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	64.3	1.7e-35
WP_111300021.1|1486403_1486766_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	53.6	1.1e-28
WP_006719251.1|1486780_1487095_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	49.5	2.7e-18
WP_041175043.1|1487081_1487426_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_111300019.1|1487409_1488642_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	62.3	4.7e-143
WP_111300017.1|1488643_1489210_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.6	9.7e-51
WP_111300015.1|1489263_1490451_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	63.0	6.8e-131
WP_005703257.1|1491091_1492402_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	2.9e-66
WP_111300011.1|1492407_1492764_+	DsrE family protein	NA	NA	NA	NA	NA
WP_111300009.1|1492826_1496489_+	exodeoxyribonuclease V subunit beta	NA	NA	NA	NA	NA
WP_111300007.1|1496488_1498468_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	50.0	6.3e-04
WP_005551622.1|1498480_1499077_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005700564.1|1499318_1499747_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_005700563.1|1499764_1500157_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_111300005.1|1500308_1501094_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_111300003.1|1501272_1502691_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_111300001.1|1502824_1504447_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_111299999.1|1504634_1505417_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
1504542:1504563	attR	TAAAAAGTGCGGTCGTTTTTTT	NA	NA	NA	NA
WP_111299997.1|1505484_1507965_-	trimethylamine-N-oxide reductase TorA	NA	NA	NA	NA	NA
WP_111711259.1|1508028_1509126_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_111299993.1|1509430_1510879_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_012771509.1|1511137_1511287_+	nitrate/trimethylamine N-oxide reductase NapE/TorE	NA	NA	NA	NA	NA
WP_005703242.1|1511302_1512478_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_111299991.1|1512489_1514949_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	26.3	5.3e-61
WP_050332701.1|1514899_1515523_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_111299989.1|1515602_1516307_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_005703237.1|1516444_1517419_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.3	1.2e-32
WP_111300456.1|1517778_1518792_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_111711260.1|1518846_1519335_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_111299985.1|1519328_1519574_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_111299983.1|1519574_1520030_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_005703231.1|1520233_1520875_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_005703230.1|1520886_1521330_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	57.8	2.0e-27
WP_109064004.1|1521495_1522899_-|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	37.3	5.3e-82
