The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483472	Acinetobacter baumannii strain NCTC13421 chromosome 1	4044162	710900	762799	4044162	capsid,integrase,terminase	Acinetobacter_phage(90.16%)	76	710142:710162	762968:762988
710142:710162	attL	GTGCGCCCTGCGGGACTCGAA	NA	NA	NA	NA
WP_000028947.1|710900_711110_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	3.7e-32
WP_000130785.1|711106_711715_-	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	57.0	3.6e-43
WP_000765548.1|711711_712371_-	hypothetical protein	NA	A0A2H4JDC0	uncultured_Caudovirales_phage	59.0	9.8e-79
WP_000993558.1|712367_713306_-	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	82.3	7.5e-141
WP_001056658.1|713535_713928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371040.1|713924_714686_-	hypothetical protein	NA	I2GUJ1	Acinetobacter_phage	52.3	4.2e-57
WP_000380112.1|714678_714906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076118.1|714905_715097_-	hypothetical protein	NA	A0A1B1P9G9	Acinetobacter_phage	65.2	4.1e-14
WP_000065151.1|715291_717559_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	100.0	0.0e+00
WP_000370485.1|717691_717907_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000105769.1|717921_718704_-	helix-turn-helix domain-containing protein	NA	J7I4M9	Acinetobacter_phage	77.1	3.7e-101
WP_001217698.1|718831_719008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051086.1|719004_719271_+	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	77.3	6.2e-32
WP_000047869.1|719366_719534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000061204.1|719530_720424_+	GntR family transcriptional regulator	NA	A0A068C8G6	Acinetobacter_phage	46.8	3.5e-47
WP_000093310.1|720423_721749_+	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	91.8	9.0e-233
WP_001068421.1|721745_721997_+	hypothetical protein	NA	A0A0P0IE39	Acinetobacter_phage	88.0	5.6e-35
WP_001001967.1|721993_722170_+	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	86.2	1.7e-17
WP_000826377.1|722166_722823_+	hypothetical protein	NA	A0A0N7IRF9	Acinetobacter_phage	100.0	2.1e-129
WP_000801875.1|722819_723185_+	hypothetical protein	NA	A0A1J0MGQ3	Acinetobacter_phage	64.5	1.4e-34
WP_000066269.1|723177_723357_+	hypothetical protein	NA	A0A0D4DCD9	Acinetobacter_phage	83.1	1.0e-22
WP_001278405.1|723422_723608_+	hypothetical protein	NA	A0A0D4DCN1	Acinetobacter_phage	96.4	2.5e-24
WP_001204261.1|723600_723948_+	hypothetical protein	NA	I2GUD2	Acinetobacter_phage	91.1	1.8e-23
WP_000360554.1|724018_724576_+	hypothetical protein	NA	I2GUD3	Acinetobacter_phage	59.7	2.5e-43
WP_000206511.1|724572_724998_+	VRR-NUC domain-containing protein	NA	A0A0D4DBJ8	Acinetobacter_phage	97.2	2.7e-74
WP_000524894.1|725007_725682_+	metallophosphoesterase	NA	A0A1J0MGN8	Acinetobacter_phage	51.0	7.2e-53
WP_000837877.1|725692_725962_+	hypothetical protein	NA	A0A0D4DC03	Acinetobacter_phage	97.8	5.4e-44
WP_000994942.1|725972_726509_+	hypothetical protein	NA	A0A0D4DCD6	Acinetobacter_phage	96.6	1.0e-94
WP_001203942.1|727208_727484_+	DUF968 domain-containing protein	NA	A0A0D4DC07	Acinetobacter_phage	69.2	2.7e-30
WP_000091776.1|727483_727669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020584.1|727765_728836_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	32.6	5.9e-33
WP_000433694.1|728893_729376_+	hypothetical protein	NA	A0A0D4DC11	Acinetobacter_phage	73.1	3.1e-66
WP_000497985.1|729432_729636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000378515.1|729677_730145_+	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	78.1	9.7e-65
WP_000372122.1|730113_730755_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	87.8	3.1e-114
WP_000729387.1|730813_731329_+	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_001132930.1|731288_732581_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
WP_000268265.1|732620_733961_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	93.8	1.3e-239
WP_000146968.1|733970_735077_+|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	91.0	7.1e-191
WP_000004552.1|735073_735304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291449.1|735319_735472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000589034.1|735523_735838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278744.1|735946_736702_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	98.0	3.8e-127
WP_000502910.1|736715_737666_+	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	97.8	1.6e-175
WP_000524483.1|737710_738067_+	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	83.9	1.0e-42
WP_000505830.1|738070_738451_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	83.3	3.4e-52
WP_000524214.1|738450_738819_+	hypothetical protein	NA	J7I467	Acinetobacter_phage	95.9	9.3e-63
WP_000043392.1|738880_739411_+	hypothetical protein	NA	A0A0D4DCP9	Acinetobacter_phage	100.0	3.4e-98
WP_000539744.1|739452_739821_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	99.2	5.0e-64
WP_002039534.1|739777_740221_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	88.4	3.9e-71
WP_001277691.1|740222_740441_+	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	95.8	1.5e-31
WP_000064570.1|740536_740887_+	hypothetical protein	NA	J7I469	Acinetobacter_phage	89.7	6.4e-53
WP_001284999.1|740886_741984_+	hypothetical protein	NA	A0A0N7IRE5	Acinetobacter_phage	41.2	4.2e-74
WP_000094258.1|742079_742997_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	94.4	1.5e-162
WP_001185578.1|743066_743582_+	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	95.9	3.6e-76
WP_000335868.1|744084_744384_+	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_000274931.1|744392_744851_+	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_001983384.1|744956_745133_+	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	59.6	8.2e-09
WP_000523931.1|745141_745465_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000725052.1|745497_745881_+	hypothetical protein	NA	A0A0D4DBP2	Acinetobacter_phage	67.7	2.2e-46
WP_000599538.1|745942_746686_+	hypothetical protein	NA	A0A0N7IRG5	Acinetobacter_phage	91.5	5.6e-123
WP_000041780.1|746699_747011_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000538615.1|747126_747297_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835375.1|747293_748295_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	42.2	6.4e-21
WP_000130334.1|748625_748973_+	hypothetical protein	NA	A0A0N7IRG4	Acinetobacter_phage	97.4	1.6e-59
WP_000046172.1|749033_753929_+	tape measure protein	NA	J7I4Q7	Acinetobacter_phage	95.7	0.0e+00
WP_000277446.1|753978_754377_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
WP_000368384.1|754376_754883_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.6	3.8e-91
WP_000835156.1|754879_755242_+	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	98.3	2.6e-65
WP_000590487.1|755234_758681_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	97.7	0.0e+00
WP_000433920.1|758749_759139_+	hypothetical protein	NA	A0A0D4DBQ9	Acinetobacter_phage	85.3	3.1e-56
WP_001019703.1|759141_759684_+	hypothetical protein	NA	J7I0Y1	Acinetobacter_phage	88.9	1.2e-90
WP_000091121.1|759889_760156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000107290.1|760275_760782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854583.1|760822_761227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001127117.1|761554_762799_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.5	8.0e-82
762968:762988	attR	GTGCGCCCTGCGGGACTCGAA	NA	NA	NA	NA
>prophage 2
NZ_LS483472	Acinetobacter baumannii strain NCTC13421 chromosome 1	4044162	1206660	1221457	4044162		Acinetobacter_phage(100.0%)	10	NA	NA
WP_001187843.1|1206660_1207209_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	99.5	1.5e-96
WP_000893677.1|1207471_1208971_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	97.0	1.2e-278
WP_001076822.1|1208972_1211348_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.7	0.0e+00
WP_001164227.1|1211354_1212338_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	99.4	1.0e-188
WP_000066126.1|1212348_1213044_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_000608308.1|1213053_1213860_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.6	1.8e-146
WP_001982145.1|1213869_1214919_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000281154.1|1215275_1218008_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.7	0.0e+00
WP_000960544.1|1218086_1220786_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	97.8	0.0e+00
WP_000566783.1|1220881_1221457_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	99.5	4.2e-110
>prophage 3
NZ_LS483472	Acinetobacter baumannii strain NCTC13421 chromosome 1	4044162	1267400	1284110	4044162	integrase	Acinetobacter_phage(81.48%)	34	1264660:1264674	1280057:1280071
1264660:1264674	attL	GGTCAAATCTTTAGC	NA	NA	NA	NA
WP_000110172.1|1267400_1268213_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	37.2	5.0e-40
WP_001010536.1|1268209_1268983_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000128669.1|1268979_1269915_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	8.3e-23
WP_000135937.1|1270212_1271199_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	97.9	2.9e-183
WP_000123991.1|1271195_1271465_-	hypothetical protein	NA	A0A1B1P9G0	Acinetobacter_phage	100.0	4.7e-48
WP_001291999.1|1271476_1271692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000028947.1|1271688_1271898_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	3.7e-32
WP_000130804.1|1271894_1272236_-	hypothetical protein	NA	I2GUB3	Acinetobacter_phage	57.3	1.7e-21
WP_000717852.1|1272247_1272511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001000839.1|1272507_1272765_-	hypothetical protein	NA	K4HYN5	Acinetobacter_phage	77.5	3.6e-29
WP_001056663.1|1272769_1273666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993522.1|1273668_1274520_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	G8CLD3	Synechococcus_phage	31.6	9.5e-34
WP_000453627.1|1274529_1274820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000991217.1|1274819_1275086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021797.1|1275105_1275483_-	hypothetical protein	NA	A0A068CDD9	Acinetobacter_phage	38.3	7.7e-12
WP_000560785.1|1275685_1275901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000923284.1|1276329_1276839_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	36.5	1.3e-17
WP_000418027.1|1276984_1277194_-	hypothetical protein	NA	A0A1B1P9G7	Acinetobacter_phage	98.5	2.5e-28
WP_000867174.1|1277203_1277950_-	helix-turn-helix domain-containing protein	NA	A0A1B1P9J5	Acinetobacter_phage	100.0	1.3e-140
WP_001068245.1|1278073_1278304_+	hypothetical protein	NA	A0A1B1P9I7	Acinetobacter_phage	100.0	1.6e-36
WP_000051088.1|1278314_1278581_+	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	79.5	1.2e-32
WP_001070070.1|1278777_1278951_+	hypothetical protein	NA	A0A0P0J0G1	Acinetobacter_phage	96.5	1.8e-24
WP_000200304.1|1278947_1279691_+	replication protein	NA	A0A0P0HSN8	Acinetobacter_phage	91.6	1.1e-46
WP_000106165.1|1279690_1281016_+	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	98.2	1.3e-247
1280057:1280071	attR	GCTAAAGATTTGACC	NA	NA	NA	NA
WP_001068421.1|1281012_1281264_+	hypothetical protein	NA	A0A0P0IE39	Acinetobacter_phage	88.0	5.6e-35
WP_001001967.1|1281260_1281437_+	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	86.2	1.7e-17
WP_000801877.1|1281433_1281745_+	hypothetical protein	NA	A0A0P0I8J0	Acinetobacter_phage	73.1	1.8e-35
WP_000066269.1|1281737_1281917_+	hypothetical protein	NA	A0A0D4DCD9	Acinetobacter_phage	83.1	1.0e-22
WP_001278405.1|1281982_1282168_+	hypothetical protein	NA	A0A0D4DCN1	Acinetobacter_phage	96.4	2.5e-24
WP_001204257.1|1282160_1282493_+	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	44.7	2.0e-11
WP_000356498.1|1282496_1282946_+	hypothetical protein	NA	A0A0D4DBZ8	Acinetobacter_phage	64.1	3.4e-14
WP_001123238.1|1282936_1283248_+	hypothetical protein	NA	A0A0D4DCM1	Acinetobacter_phage	95.1	1.1e-59
WP_000206497.1|1283244_1283637_+	DUF559 domain-containing protein	NA	A0A1B1P9J0	Acinetobacter_phage	80.8	2.1e-52
WP_001277128.1|1283633_1284110_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
>prophage 4
NZ_LS483472	Acinetobacter baumannii strain NCTC13421 chromosome 1	4044162	1287416	1320337	4044162	capsid,terminase	Acinetobacter_phage(100.0%)	41	NA	NA
WP_001136767.1|1287416_1287872_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	98.0	1.0e-82
WP_000378508.1|1287933_1288368_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	100.0	3.4e-80
WP_000435252.1|1288336_1288978_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	98.1	6.7e-125
WP_000212566.1|1289036_1289507_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_000102080.1|1289496_1290924_+|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	100.0	7.6e-270
WP_001286352.1|1290920_1292372_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	99.6	3.2e-284
WP_000179763.1|1292373_1293477_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	100.0	2.7e-206
WP_000965231.1|1293485_1293914_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
WP_000004363.1|1294012_1294255_+	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
WP_001139861.1|1294472_1294664_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000770049.1|1294777_1295545_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
WP_000214198.1|1295572_1296529_+	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	97.5	4.8e-175
WP_000692540.1|1296594_1297260_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.8	2.6e-111
WP_000008496.1|1297264_1297654_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	7.3e-66
WP_000524213.1|1297655_1298024_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	95.1	1.2e-62
WP_000247952.1|1298032_1298437_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.7	2.2e-65
WP_000539748.1|1298408_1298777_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	2.6e-52
WP_002040017.1|1298733_1299177_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	86.4	4.4e-67
WP_001277691.1|1299178_1299397_+	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	95.8	1.5e-31
WP_000064569.1|1299492_1299843_+	hypothetical protein	NA	J7I469	Acinetobacter_phage	88.9	1.4e-52
WP_001285008.1|1299842_1300940_+	hypothetical protein	NA	A0A0N7IRE5	Acinetobacter_phage	41.0	7.1e-74
WP_000094258.1|1301035_1301953_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	94.4	1.5e-162
WP_001185605.1|1302022_1302538_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	98.5	1.1e-72
WP_001258718.1|1303088_1303799_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000065059.1|1303913_1304843_-	ORF6N domain-containing protein	NA	A0A0P0J0J7	Acinetobacter_phage	86.5	4.7e-87
WP_000453244.1|1305051_1305288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000722131.1|1305374_1305896_+	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	67.8	7.8e-63
WP_000106804.1|1305914_1306190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046535.1|1306267_1310575_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	97.1	0.0e+00
WP_000134295.1|1311043_1311775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000959543.1|1311764_1312409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991941.1|1312435_1313143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277446.1|1313279_1313678_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
WP_000368382.1|1313677_1314184_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	98.2	3.8e-91
WP_000835153.1|1314180_1314543_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	78.3	1.4e-50
WP_000598523.1|1314535_1317982_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	98.2	0.0e+00
WP_000138204.1|1318048_1318405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001083663.1|1318401_1318620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208716.1|1318609_1319164_+	lysozyme	NA	A0A068CDE9	Acinetobacter_phage	79.9	1.3e-79
WP_000079982.1|1319330_1319852_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_001197968.1|1320148_1320337_+	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	96.7	1.1e-27
>prophage 5
NZ_LS483472	Acinetobacter baumannii strain NCTC13421 chromosome 1	4044162	2583780	2595450	4044162	capsid,terminase	Acinetobacter_phage(30.0%)	14	NA	NA
WP_000433906.1|2583780_2584170_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	96.9	1.1e-64
WP_001068512.1|2584320_2585307_+	right-handed parallel beta-helix repeat-containing protein	NA	U5PSS0	Bacillus_phage	31.7	5.7e-14
WP_001990242.1|2585367_2586366_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_001990240.1|2586362_2586854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000060043.1|2586857_2587328_-	hypothetical protein	NA	M4T3R5	Psychrobacter_phage	41.8	8.1e-19
WP_000653192.1|2587346_2588546_-	DUF2213 domain-containing protein	NA	A0A2I7R2U8	Vibrio_phage	28.5	2.0e-21
WP_001140766.1|2588599_2589232_-	hypothetical protein	NA	U5U717	Lactobacillus_phage	24.5	2.8e-06
WP_000032786.1|2589272_2589461_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001273094.1|2589540_2590353_-|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	42.1	2.7e-54
WP_000852322.1|2590297_2591632_-	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	40.0	3.7e-85
WP_001086349.1|2591640_2593131_-|terminase	phage terminase large subunit	terminase	I3PGT7	Xanthomonas_phage	41.2	1.4e-88
WP_000113266.1|2593108_2593591_-	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	85.8	2.2e-67
WP_001004672.1|2594338_2594683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138417.1|2594991_2595450_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	46.6	2.0e-30
>prophage 6
NZ_LS483472	Acinetobacter baumannii strain NCTC13421 chromosome 1	4044162	2732447	2747033	4044162		Acinetobacter_phage(50.0%)	25	NA	NA
WP_001136753.1|2732447_2732903_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	68.9	2.2e-53
WP_000991091.1|2733358_2733892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000994864.1|2733888_2734653_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	1.0e-63
WP_000124475.1|2734649_2735693_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
WP_001055561.1|2735696_2737175_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	53.3	9.7e-135
WP_002029044.1|2737171_2737558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000606802.1|2737563_2738538_-	phosphoadenosine phosphosulfate reductase family protein	NA	A4JX51	Burkholderia_virus	47.7	2.7e-77
WP_000218440.1|2738534_2739173_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	39.9	9.0e-29
WP_000575722.1|2739169_2739625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200145.1|2739621_2739807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290739.1|2739803_2740004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818521.1|2740037_2740412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172739.1|2740447_2740651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001108434.1|2740786_2741551_+	S24 family peptidase	NA	A0A0P0I8E0	Acinetobacter_phage	63.0	1.6e-77
WP_000794429.1|2741554_2741839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183423.1|2742033_2742372_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	39.3	1.6e-13
WP_001072361.1|2742452_2742782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856471.1|2742778_2743150_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	40.0	6.4e-11
WP_000645466.1|2743324_2744005_+	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_000805204.1|2744017_2745046_+	ead/Ea22-like family protein	NA	A0A2I7QY11	Vibrio_phage	29.0	3.8e-13
WP_000986116.1|2745186_2745477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464381.1|2745477_2745657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000609003.1|2745649_2746186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000578498.1|2746182_2746692_+	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	85.1	1.1e-32
WP_001038586.1|2746688_2747033_+	hypothetical protein	NA	A0A0P0IYD2	Acinetobacter_phage	78.8	7.4e-38
>prophage 7
NZ_LS483472	Acinetobacter baumannii strain NCTC13421 chromosome 1	4044162	3445575	3508762	4044162	transposase,integrase,protease	uncultured_Caudovirales_phage(18.18%)	60	3457059:3457075	3482545:3482561
WP_001289250.1|3445575_3446889_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.0e-127
WP_000289452.1|3446990_3447596_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.6	1.2e-62
WP_001198432.1|3447788_3449123_-	trigger factor	NA	NA	NA	NA	NA
WP_000052885.1|3449534_3451766_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_001984475.1|3451870_3452554_+	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	30.1	4.3e-21
WP_000978841.1|3453012_3454710_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_000009638.1|3454793_3455954_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001217230.1|3455953_3456547_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_002009379.1|3456588_3457131_+	sel1 repeat family protein	NA	NA	NA	NA	NA
3457059:3457075	attL	TGCTGCAAACTTAACTC	NA	NA	NA	NA
WP_000106715.1|3457299_3457926_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	D2KCJ6	Cassava_brown_streak_virus	30.8	8.9e-13
WP_001196409.1|3458121_3458997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908081.1|3459248_3459467_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000887761.1|3459478_3459916_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_001072727.1|3459912_3460683_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_000205448.1|3460856_3463037_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_000736399.1|3463496_3464207_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
WP_000573060.1|3464207_3466118_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000417085.1|3466122_3467043_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000081835.1|3467072_3468188_+	TniQ family protein	NA	NA	NA	NA	NA
WP_002017214.1|3468180_3469611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529372.1|3469985_3470357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095006.1|3470429_3470729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034564.1|3470796_3471648_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
WP_001277980.1|3471660_3473127_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.6	2.3e-213
WP_085947913.1|3473130_3474221_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000262332.1|3474322_3474655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001992510.1|3474662_3475217_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001046004.1|3475881_3476703_-	carbapenem-hydrolyzing class D beta-lactamase OXA-23	NA	NA	NA	NA	NA
WP_087486612.1|3476808_3477898_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001144964.1|3478256_3480053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085920645.1|3482303_3483074_-	NRDE family protein	NA	NA	NA	NA	NA
3482545:3482561	attR	TGCTGCAAACTTAACTC	NA	NA	NA	NA
WP_000959085.1|3483176_3483995_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000889270.1|3484068_3484428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000881950.1|3484438_3484801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001203170.1|3484923_3485766_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	61.8	7.1e-98
WP_000312548.1|3485810_3486320_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	46.0	2.4e-24
WP_000551518.1|3486334_3487390_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_001183413.1|3487490_3488012_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000885431.1|3488072_3488477_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_001011664.1|3488476_3489097_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_000730960.1|3489141_3489858_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_000080849.1|3490288_3491179_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_000056618.1|3491226_3491919_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001088252.1|3492031_3493480_+	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000048256.1|3493647_3493884_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001205031.1|3493896_3494052_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001119808.1|3494200_3495910_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_000027403.1|3495947_3496226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985993.1|3496338_3496872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001183874.1|3496922_3497282_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000699342.1|3497289_3497529_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_000050371.1|3497602_3499582_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	28.4	1.6e-63
WP_000859455.1|3499698_3500271_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_000265761.1|3500408_3501167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024269.1|3501254_3503891_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	33.5	2.6e-90
WP_000368721.1|3503926_3504376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029768.1|3504523_3504901_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000648641.1|3505000_3506011_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000165735.1|3506058_3506304_-	SlyX family protein	NA	NA	NA	NA	NA
WP_088631513.1|3507672_3508762_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
>prophage 8
NZ_LS483472	Acinetobacter baumannii strain NCTC13421 chromosome 1	4044162	3709966	3768623	4044162	transposase,integrase,tRNA	Escherichia_phage(19.05%)	59	3707352:3707367	3756112:3756127
3707352:3707367	attL	TTGCAGCACACGCAGC	NA	NA	NA	NA
WP_000216752.1|3709966_3710899_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000907680.1|3710949_3712146_-	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_000908240.1|3712170_3713517_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_000942501.1|3713677_3713929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278226.1|3713949_3715803_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_001991212.1|3715799_3716063_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_000608735.1|3716206_3717127_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	2.3e-33
WP_000011168.1|3717273_3718089_+	DsbC family protein	NA	NA	NA	NA	NA
WP_000805827.1|3718333_3719635_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000063593.1|3719690_3720830_+	threonine synthase	NA	NA	NA	NA	NA
WP_001984577.1|3720938_3721985_-	D-alanyl-D-alanine endopeptidase PBP7/8	NA	NA	NA	NA	NA
WP_000633799.1|3722197_3722833_+	response regulator	NA	NA	NA	NA	NA
WP_001991214.1|3722888_3724412_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.5	4.7e-07
WP_000840548.1|3724436_3725858_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_000939109.1|3725861_3727046_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
WP_000128749.1|3727061_3728609_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_000881094.1|3728734_3729805_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000586912.1|3729804_3730905_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000673449.1|3731048_3732497_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
WP_001151590.1|3732489_3732897_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_001985629.1|3732935_3733574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354154.1|3733704_3733923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493866.1|3733981_3734641_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
WP_001083669.1|3734683_3735976_-	DNA adenine methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
WP_001292523.1|3735972_3737058_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.3	3.3e-47
WP_000543541.1|3737073_3737532_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_000738515.1|3737690_3739088_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	7.0e-34
WP_000780326.1|3739145_3739484_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_000894500.1|3739763_3739991_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_000010453.1|3740056_3740914_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001144958.1|3740996_3742793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000492599.1|3743087_3744575_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	78.6	1.2e-217
WP_000137809.1|3744975_3746265_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
WP_000021528.1|3746286_3746799_-	signal peptidase II	NA	NA	NA	NA	NA
WP_000041516.1|3746802_3747699_-	cation transporter	NA	NA	NA	NA	NA
WP_001219639.1|3747794_3748202_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000947164.1|3748323_3748587_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_000168107.1|3748643_3749027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001991400.1|3749089_3749239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170318974.1|3749232_3749682_-	recombinase family protein	NA	Q71TD8	Escherichia_phage	63.7	9.7e-38
WP_000862068.1|3749732_3750077_-	hypothetical protein	NA	A0A2I7S8K9	Vibrio_phage	41.4	2.0e-11
WP_000017328.1|3750073_3750361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|3750384_3750885_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|3751012_3751852_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3751845_3752193_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|3752356_3753148_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001102919.1|3753560_3754073_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002089484.1|3754191_3754656_-	aminoglycoside N-acetyltransferase AAC(3)-Ia	NA	NA	NA	NA	NA
WP_000845052.1|3754825_3755860_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	44.5	5.0e-69
WP_000454193.1|3755933_3756284_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
3756112:3756127	attR	GCTGCGTGTGCTGCAA	NA	NA	NA	NA
WP_001067855.1|3756431_3757136_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|3757265_3758081_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_000902128.1|3758234_3758414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|3758680_3759385_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000904905.1|3759396_3760056_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.4e-37
WP_001067855.1|3763079_3763784_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|3763854_3764715_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001217881.1|3764897_3765455_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_001143757.1|3765617_3768623_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.1	0.0e+00
>prophage 9
NZ_LS483472	Acinetobacter baumannii strain NCTC13421 chromosome 1	4044162	3788250	3797493	4044162	transposase	uncultured_Caudovirales_phage(71.43%)	11	NA	NA
WP_000137809.1|3788250_3789540_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
WP_000021528.1|3789561_3790074_-	signal peptidase II	NA	NA	NA	NA	NA
WP_000041516.1|3790077_3790974_-	cation transporter	NA	NA	NA	NA	NA
WP_001219642.1|3791069_3791477_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001275666.1|3792299_3792734_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	56.5	2.9e-39
WP_000372102.1|3792791_3793112_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	63.7	2.1e-26
WP_000670219.1|3793118_3793592_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	53.2	3.9e-37
WP_000068656.1|3793599_3794643_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_000174605.1|3794648_3795353_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.9	1.3e-92
WP_001172025.1|3795370_3796324_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.1	2.4e-62
WP_000192758.1|3796425_3797493_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	58.7	7.1e-95
